Psilocybe Cyanofibrillosa 2010-2011 picture gallery.

Home | Community | Message Board

You are not signed in.
New Account

Forum Index Search Posts Trusted Vendors Highlights Galleries FAQ User List Chat Store Random Growery

This site includes paid links. Please support our sponsors.

Mushrooms, Mycology and Psychedelics > Mushroom Hunting and Identification

Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Shop: Substrate Mix

Jump to first unread post

Pages: < Back | 1 | 2 | 3 [ show all ]

Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.

NeoSporen
Antibiotic cream

Registered: 09/05/09
Posts: 4,282
Loc: Graham, WA
Last seen: 7 months, 21 days

Re: Psilocybe Cyanofibrillosa 2010

[Re: falcon]
#15512082 - 12/13/11 06:29 PM (14 years, 9 months ago)

Thanks for the B-Day wishes and all the kind words everyone :sunny:

It has been a good day. I hope to continue documenting and photographing this species as much as possible in the following years. Next year will be much better. :cheers:

--------------------
Having lived through an existence close to nature, one accepts the small and simple things as most important in life. Sun, wind, rain and snow. The sounds birds make, smells of fresh wild flowers. Love of all kinds, from friends and family, thy self and our neighbors. Beautiful sunrises to the darkest clouds dancing above in the sky. To forgive, learn, share and express. This is the only thing a man such as myself can ask for. What comes as the result is nothing short of the core of human existence, to truly live free in body and mind.

Extras:

Top

Alan Rockefeller
Mycologist

Registered: 03/10/07
Posts: 48,928
Last seen: 1 day, 9 hours

Re: Psilocybe Cyanofibrillosa 2010-2011 picture gallery.

[Re: NeoSporen]
#25144776 - 04/17/18 03:02 AM (8 years, 5 months ago)

NeoSporen said:

I'm making this post just because it seems like there are some times that cyanofriscosa is confused with cyanofibrillosa, and thought that the pictures I have might help. Hope everyone enjoys.

Microscopy done by workman, but I would like to thank everyone that helped out with this i.d earlier this year.

First find, Renton WA

I just got DNA sequencing results back on these (http://mushroomobserver.org/109871), and they matched 100% with Psilocybe baeocystis. P. cyanofibrollosa (collected by Ganymede) has an ITS sequence that differs by 11 nucleotides.

ITS sequence of this collection: GAGGGCATGTGCTCGCCGTGTCATCTTTATCTCTCCACCtGTgcacCTTTTGTAGACCTGGATTAGTTAACTTTCCGAGGAAACTCGGTCGGGAGGATTGCTTTCACAAGCTCTCCTTGCAATTAACCCAGGCCTACGTTTTCATATACCCCAAAGAATGTAACAGAATGTATTATATTGGCCTTGTGCCTATAAACTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTACCAGCTTTTGCTGATAATGGCTTGGATGTGGGGGTCTTTTGCTGGCTTCGTCAAGAGGTCTGCTCCCCTTAAATGTATTAGCCGGTGCCCCGCGCAGAGCCGTCTATTGGTGTGATAATTATCTACGCCGTGGACCTTTGCATGAATGGGATTGCGCTGCTTCTAACCGTCCTTCACTGGACAATACAAATGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAg

Psilocybe cyanofibrollosa (Ganymede)
TAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATGAACTTGGCTCGGTTGCAGCTGGTCCTCTCGAGGGCATGTGCTCGCCTTGTCATCTTTATCTCTCCACCTGTGCACCTTTTGTAGACCTGGATTAGTTAACTTTCCGAGGCAACTCGGTCGGGAGGATTGCTTTCACAAGCTCTCCTTGCAATTAACCCAGGCCTACGTTTTCATATACCCCAAAGTATGTAACAGAATGTATCATATGGCCTTGTGCCTATAAACTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTACCAGCTTTTGCTGATAATGGCTTGGATGTGGGGGTCTTTTGCTGGCTTCGTCAAGAGGTCTGCTCCCCTTAAATGTATTAGCCGGTGCCCCGCGCAGAGCCGTCTATTGGTGTGATAATTATCTACGCCGTGGACGTCTGCATGAATGGGATTGCACTGCTTCTAACCGTCCTTCACTGGACAACACAAATGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTTGGCCGTCCGAGTTG

Extras:

Top

Jump to top

Pages: < Back | 1 | 2 | 3 [ show all ]

Shop: Substrate Mix

Mushrooms, Mycology and Psychedelics > Mushroom Hunting and Identification

Similar Threads	Poster	Views	Replies	Last post
Psilocybe cyanofibrillosa (pic)	mikeofyle	3,550	8	11/26/02 10:16 PM by Anonymous
Psilocybe Cyanofriscosa ( 1 2 3 4 ... 17 18 )	sui	62,772	352	01/24/07 03:13 AM by pscyanescens
Possible psilocybe azurescens =)	farmboybluez	12,142	16	09/20/17 03:08 PM by perkysmiles
Help, un-ID'd bluing Psilocybe sp. in Seattle. ( 1 2 all )	spores	8,057	21	11/20/01 08:25 AM by mikeofyle
Ps cyanofibrillosa ( 1 2 all )	cardboard	4,037	32	09/25/05 05:15 PM by phreakin
Psilocybe Castanella	Herbus	3,804	7	11/21/04 02:45 AM by mjshroomer
Blueing Mushroom Find in Oregon!!! (5/18) ( 1 2 3 4 5 6 7 8 all )	Joshua	31,461	140	12/08/18 02:14 PM by Colonel
Psylobye cyanfibrillosa	Hongosmeester	2,548	19	12/23/02 08:46 PM by FleshTemple

Extra information

You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: ToxicMan, karode13, inski, Alan Rockefeller, Duggstar, TimmiT, Anglerfish, Tmethyl, Lucis, Doc9151, Land Trout
8,563 topic views. 1 members, 17 guests and 51 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]