Home | Community | Message Board

Cannabis Seeds - Original Sensible Seeds
This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Shop: Unfolding Nature Unfolding Nature: Being in the Implicate Order   Kraken Kratom Kratom Capsules for Sale, Red Vein Kratom   Myyco.com Isolated Cubensis Liquid Culture For Sale

Jump to first unread post Pages: 1 | 2 | 3 | Next >  [ show all ]
InvisibleinfidelGOD
illusion

Registered: 04/18/02
Posts: 3,040
Loc: there
Philosophical Implications of Human Cloning
    #2297628 - 02/03/04 02:19 PM (20 years, 2 months ago)

(some of you are already aware of the philosophical issues surrounding human cloning)

for the others:

what is human cloning?

simply stated: it's taking human DNA and creating a human being
it's technically feasable, but unfortunately, there are some social barriers

what is DNA?

the blueprint for life. a molecule that uses a base4 system of storing information

G T A C

it can actually be expressed in binary:

G = 00
T = 01
A = 10
C = 11

now suppose that we clone a human being,
and that cloned human being is able to conceptualize
able to love, able to dream

now if a cloned human being can do these things,
what does it say about our own ability to do these things?
where do these abilities come from?

GTACCTAGCTTAAGCATAGGTACCTACGTACC
ATGTATCCAGTGATTACGTA001000100101001
000101001011010001010010010100101001001
01010101001-zero-one-zero-one-zero-yin-yang...

could it really be that simple?

do some people feel threatened by this?

which leads me to my next question:

why are some people opposed to human cloning?

what do they have to fear?

I think the answer is fairly obvious

and notice that it's mostly the religious types who are opposed to it.
what are they trying to protect?

those of us who are progressive thinkers aren't opposed to human cloning because we have no vested interest in the result one way or another.

but even today, here in the 21st century, there are people who would stand in the path of progress in order to protect their cherished beliefs...

Extras: Filter Print Post Top
OfflineChiefThunderbong
Inhale to theChief
 User Gallery

Registered: 10/18/02
Posts: 3,647
Last seen: 10 years, 9 months
Re: Philosophical Implications of Human Cloning [Re: infidelGOD]
    #2297685 - 02/03/04 02:36 PM (20 years, 2 months ago)

Quote:

and notice that it's mostly the religious types who are opposed to it.
what are they trying to protect?





If you've read my posts, you'll know I'm not at ALL religious but I'm against human cloning. I just don't think our society is capable of handling that much power, kinda like nukes. Are clones ordinary citizens, do they have the same rights as you and I? It just starts a whole bunch of issues....whats the benefit?


--------------------
Yeah spinnin' around again
yea caught in a tailspin

Extras: Filter Print Post Top
InvisibleinfidelGOD
illusion

Registered: 04/18/02
Posts: 3,040
Loc: there
Re: Philosophical Implications of Human Cloning [Re: ChiefThunderbong]
    #2297696 - 02/03/04 02:38 PM (20 years, 2 months ago)

It just starts a whole bunch of issues....whats the benefit?

you answered your own question.

Extras: Filter Print Post Top
OfflineChiefThunderbong
Inhale to theChief
 User Gallery

Registered: 10/18/02
Posts: 3,647
Last seen: 10 years, 9 months
Re: Philosophical Implications of Human Cloning [Re: infidelGOD]
    #2297717 - 02/03/04 02:45 PM (20 years, 2 months ago)

No I didn't....I see no benefits to cloning humans.


--------------------
Yeah spinnin' around again
yea caught in a tailspin

Extras: Filter Print Post Top
InvisibleinfidelGOD
illusion

Registered: 04/18/02
Posts: 3,040
Loc: there
Re: Philosophical Implications of Human Cloning [Re: ChiefThunderbong]
    #2297783 - 02/03/04 03:00 PM (20 years, 2 months ago)

well, the obvious one is that human cloning will answer one of the most important questions in philosophy and religion (which is a part of the reason there is so much opposition)

and there are other practical benefits too, like stem cell research, organ transplants (imagine having a copy of "you" minus the brain, providing you with spare organs for the rest of your life, possibly extending your life expectancy by several decades). or maybe parents who lose their children at an early age might want to "revive" them. or maybe an unmarried old man wants to extend his genetic legacy by cloning himself? why should they be prevented?

the question isn't why we should clone, the question is why shouldn't we be able to clone? why? just because some people are uncomfortable with the moral and philosophical implications? because it raises too many issues?

and for the record, I don't think we should be cloning until we have perfected it with animals and higher primates. everything I said above is assuming that we've worked out all the technical issues with human cloning (which will be done if research is allowed to continue).

Extras: Filter Print Post Top
InvisibleSwami
Eggshell Walker

Registered: 01/18/00
Posts: 15,413
Loc: In the hen house
Re: Philosophical Implications of Human Cloning [Re: infidelGOD]
    #2297875 - 02/03/04 03:26 PM (20 years, 2 months ago)

This is tangential, but important.

There are many hundreds of thousands (millions?) of abortions legally performed annually in the USA. The fetal tissue and amniotic fluid has many important medical uses in both research and in the treating of disease. However, because our society does not want to "encourage" abortions that are taking place anyway, these fetuses are dumped in landfill rather than be put to some good. This makes no sense to me whatsoever.


--------------------



The proof is in the pudding.

Extras: Filter Print Post Top
OfflineSpecialEd
+ one

Registered: 01/30/03
Posts: 6,220
Loc: : Gringo
Last seen: 9 years, 2 days
Re: Philosophical Implications of Human Cloning [Re: infidelGOD]
    #2298066 - 02/03/04 04:12 PM (20 years, 2 months ago)

Beliefs stunt progress. I'm sure there were zealots who crusaded against antibiotics because they were the devil.

Swami brought up a good point and I will share another.

My sister's father in law recently had a stroke. He is overweight, smokes, does not excercise, follows a bad diet. The doctors told him if he makes MASSIVE lifestyle changes, he could have another 7 happy years with his family. Else, he has a horrible 2-3 years of life.

Instead of heeding the doctors advice. He had his wife bring in a prayer circle so that the lord could heal him. He said, and I quote, "The lord has never let me down before."

He was kicked out of the hospital after 3 days because his wife brought him in Kentucky Fried Chicken.


--------------------
"Plus one upvote +1..."
--- //
-- :meff:
  /l_l\/
--\-/----

Extras: Filter Print Post Top
InvisibleinfidelGOD
illusion

Registered: 04/18/02
Posts: 3,040
Loc: there
Re: Philosophical Implications of Human Cloning [Re: SpecialEd]
    #2298194 - 02/03/04 04:37 PM (20 years, 2 months ago)

I'm sure there were zealots who crusaded against antibiotics

oh they're still around :smirk:
some people refuse medical treatment of any kind, prefering prayer over modern medical science.

and another example is that certain sects of Jehovah's witnesses (no doubt they consider themselves the only true christians) refuse blood transfusions because of some verse in the bible. this has lead to several deaths and even murder charges. what's even worse is that these people refuse blood transfusions for their CHILDREN! they'll pray and pray watching their children die right in front of them when a simple medical procedure could have saved them...

He is overweight, smokes, does not excercise, follows a bad diet

lol. these are the same people who say we shouldn't do drugs because the body is the lord's temple :rolleyes:

Extras: Filter Print Post Top
InvisibleinfidelGOD
illusion

Registered: 04/18/02
Posts: 3,040
Loc: there
Re: Philosophical Implications of Human Cloning [Re: infidelGOD]
    #2298284 - 02/03/04 05:07 PM (20 years, 2 months ago)

ok, back on topic.

suppose that rational voices prevail and human cloning is allowed,
we create a human being using GENES, which is just encoded INFORMATION
and that cloned person is able to conceptualize and use language and love
and dream and go to church to experience religion and God.
he is identical in every way to a normal human being. he has a SOUL.

this raises all kinds of uncomfortable questions like:

what does it mean to be human?
where does the soul come from?
where does the ability to conceptualize come from?

of course the answer is it comes from our genes and our environment

some people are threatened by this but this,
it seems to me, would be an immensely liberating realization for humanity
we would no longer have to invoke those mysterious, immaterial,
otherworldly, "metaphysical" forces to explain these functions.
we would be free from them.
and it would render irrelevant the religious paradigm and other antiquated philosophies.

could this be the reason there is so much resistance to progress?

Extras: Filter Print Post Top
InvisibletrendalM
J♠
Male User Gallery

Registered: 04/17/01
Posts: 20,815
Loc: Ontario, Canada Flag
Re: Philosophical Implications of Human Cloning [Re: infidelGOD]
    #2298313 - 02/03/04 05:13 PM (20 years, 2 months ago)

Well I have no religion to make me opposed to human cloning, nor do I disagree with it on any philosophical/moral grounds...

However I do not think that it should be attempted right now. Simple reason, really: we don't understand enough about the aging process or what will happen to the clone we "create". Dolly died of an advanced aging process long before her natural time should have come.

What will happen to the clone, then?

Will we doom a conscious, sentient being to a life of horrible physical malfunction? Is it right to knowingly bring a human into the world - through "artificial" means - who has little chance of a normal life?


--------------------
Once, men turned their thinking over to machines in the hope that this would set them free.
But that only permitted other men with machines to enslave them.

Extras: Filter Print Post Top
InvisibleinfidelGOD
illusion

Registered: 04/18/02
Posts: 3,040
Loc: there
Re: Philosophical Implications of Human Cloning [Re: trendal]
    #2298332 - 02/03/04 05:22 PM (20 years, 2 months ago)

yeah I agree with you, like I said, I don't think we should be cloning humans until we've perfected it in animals and we're reasonably sure of success in humans.

I'm not calling for immediate cloning of human beings...
but the thing is, we can't even research human cloning right now. and a lot of that is due to peoples moral objections to it.

we're not there yet scientifically (and we'll never get there if we can't even do research), but when we are, I hope we're not prevented from progressing because of morals.

cloning has tremendous potential for human health. it could help those who are sick and suffering. what could be more moral than that?

Extras: Filter Print Post Top
Invisiblevampirism
Stranger
Male User Gallery

Registered: 03/14/04
Posts: 8,120
Re: Philosophical Implications of Human Cloning [Re: infidelGOD]
    #2298349 - 02/03/04 05:31 PM (20 years, 2 months ago)

your logic is irrational..

clones will prove absolutely NOTHING.
Tell me how it proves anything to have a clone? We have clones of plants - they're exactly the same. We have clones of animals- they're fucked up because we don't know how to properly clone them yet.

A cloned human will be different from its source- I don't think you can avoid that culture and experience mold much of our action.

do twins make you think twice? They often act EXTREMELY similar
in fact, look at this: http://www.hindu.com/thehindu/seta/2003/05/15/stories/2003051500060200.htm

It makes no sense to clone a being in order to see if genetic similarity has anything to do with a soul when you have twins.

Besides, the questions you ask have nothing to do with genetics- they are psychological matters


I am against cloning and am not religious, but I know humans will be cloned anyway. Putting faith in clones to find answers is akin to looking at the world as if it were flat in order to provide explanations- so close, yet so far

Extras: Filter Print Post Top
InvisibletrendalM
J♠
Male User Gallery

Registered: 04/17/01
Posts: 20,815
Loc: Ontario, Canada Flag
Re: Philosophical Implications of Human Cloning [Re: ]
    #2298363 - 02/03/04 05:36 PM (20 years, 2 months ago)

Also, as per man a science-fiction story...human cloning combined with a form of artificial gestation which significantly decreases the gestation period could be used for the wrong purposes.

I don't think it far fetched to imagine armies made entirely of clones, probably genetically enhanced in some way, appearing at some point in the future!


--------------------
Once, men turned their thinking over to machines in the hope that this would set them free.
But that only permitted other men with machines to enslave them.

Extras: Filter Print Post Top
InvisibleinfidelGOD
illusion

Registered: 04/18/02
Posts: 3,040
Loc: there
Re: Philosophical Implications of Human Cloning [Re: ]
    #2298399 - 02/03/04 05:47 PM (20 years, 2 months ago)

It makes no sense to clone a being in order to see if genetic similarity has anything to do with a soul when you have twins.

I think you're missing the point. the religious view is that people who are born (including twins) are endowed with some kind of "soul" that comes from a source OTHER than our genes. if a cloned human being is shown to be identical to a normal human being (ability to love, conceptualize etc.), it proves that whatever we consider to be a soul is indeed derived from our genes (as well as our environment, of course), and not this other source.

Besides, the questions you ask have nothing to do with genetics- they are psychological matters

correct. I'm not discussing genetics, I'm discussing the philosophical implications of human cloning.

Putting faith in clones to find answers is akin to looking at the world as if it were flat in order to provide explanations- so close, yet so far

huh?

Extras: Filter Print Post Top
Invisiblevampirism
Stranger
Male User Gallery

Registered: 03/14/04
Posts: 8,120
Re: Philosophical Implications of Human Cloning [Re: infidelGOD]
    #2298456 - 02/03/04 06:01 PM (20 years, 2 months ago)

a) how does it prove it? I could argue that God put the soul in as the baby developed or something else like that

b) Well nevermind that I got a bit sidetracked :frown:  The philosophical implications are still lacking- there is no .proof.

c) nevermind that, analogies to metaphors which only I understand don't seem to work well..

What I'm trying to say is that a clone will prove nothing- it offers no proof in the least- do religions say that a soul is given upon conception or within a human during gestation? I never heard so.. We "create" test tube babies from sperm and eggs- we can choose the gender of the child doing so as well. Are you implying that religions say the joining of sperm and egg is the point that a soul enters?

Actually, there was a catholic church study done around 1300 which concluded that the soul enters when the creature takes human form- this was actually the church saying that fetuses are not human! Around 1700 some christians thought that they saw "fully-formed little humans" in close examination of a.. i don't know, blastoderm at that point or something?- early microscopy work nonetheless
This mistake is the current foundation for the church's stance on abortion.. The 1300 conclusion has not been formally denied mind you

So I just don't see how creating a human has anything to do with it having a soul. As far as the church is concerned ( i do not know other religion's arguments at all.. ), a human is a human if it looks like a human, acts like a human, smells like a human, etc..

Extras: Filter Print Post Top
OfflineStrumpling
Neuronaut
Registered: 10/11/02
Posts: 7,571
Loc: Hyperspace
Last seen: 12 years, 10 months
Re: Philosophical Implications of Human Cloning [Re: infidelGOD]
    #2298544 - 02/03/04 06:26 PM (20 years, 2 months ago)

I see no difference between cloning a human being and cloning a plant, like we humans do tons of times every day


--------------------
Insert an "I think" mentally in front of eveything I say that seems sketchy, because I certainly don't KNOW much. Also; feel free to yell at me.
In addition: SHPONGLE

Extras: Filter Print Post Top
InvisibleinfidelGOD
illusion

Registered: 04/18/02
Posts: 3,040
Loc: there
Re: Philosophical Implications of Human Cloning [Re: ]
    #2298564 - 02/03/04 06:34 PM (20 years, 2 months ago)

all good questions.

a) how does it prove it? I could argue that God put the soul in as the baby developed or something else like that

sure you could argue that.. but that's not the traditional religous view.
even if human are succesfully cloned, you could always come up with another argument to maintain that souls are given by God. I'm not trying to diminish spirituality. I'm aiming to break it all open into a more expansive and inclusive understanding. changing our understanding of God does not diminish God. it is dogma I'm trying to diminish.

Are you implying that religions say the joining of sperm and egg is the point that a soul enters?

some religions do say this

So I just don't see how creating a human has anything to do with it having a soul

ok. this is the crux of the issue. I'm saying that human cloning suggests that the soul isn't "granted" by a higher source. that the soul is nothing mysterious or supernatural - it's derived from genetics and accumulated experience. it's just a word we use...

Extras: Filter Print Post Top
InvisibleinfidelGOD
illusion

Registered: 04/18/02
Posts: 3,040
Loc: there
Re: Philosophical Implications of Human Cloning [Re: Strumpling]
    #2298569 - 02/03/04 06:36 PM (20 years, 2 months ago)

I see no difference between cloning a human being and cloning a plant

that's pretty much what I'm saying.

THIS is what's so frightening to some people.

they want to believe that humans are "special".

Extras: Filter Print Post Top
Invisiblevampirism
Stranger
Male User Gallery

Registered: 03/14/04
Posts: 8,120
Re: Philosophical Implications of Human Cloning [Re: infidelGOD]
    #2298587 - 02/03/04 06:40 PM (20 years, 2 months ago)

well how about test tube babies then? If they have an issue with cloning then it's inconsistent to have no problem with test tube babies, or choosing the gender of one's child for that matter. This comes down to free will, doesn't it?

Extras: Filter Print Post Top
InvisibleinfidelGOD
illusion

Registered: 04/18/02
Posts: 3,040
Loc: there
Re: Philosophical Implications of Human Cloning [Re: ]
    #2298618 - 02/03/04 06:49 PM (20 years, 2 months ago)

actually, some people DO have a problem with test tube babies and choosing genders of babies, genetic engineering, cloning, etc. they're all related issues and all raise similar moral and philosophical questions.

my point is that these questions should not stop us from making progress.
cloning and genetic engineering can have huge benefits for a lot of people.
and medical science should not answer to religious zealots.

Extras: Filter Print Post Top
Jump to top Pages: 1 | 2 | 3 | Next >  [ show all ]

Shop: Unfolding Nature Unfolding Nature: Being in the Implicate Order   Kraken Kratom Kratom Capsules for Sale, Red Vein Kratom   Myyco.com Isolated Cubensis Liquid Culture For Sale


Similar ThreadsPosterViewsRepliesLast post
* Spiritual and Philosophical implications behind LOTR
( 1 2 all )
ShroomismM 3,309 28 11/30/03 06:37 AM
by infidelGOD
* first human cloned
( 1 2 all )
quemo 2,472 24 12/28/02 06:18 PM
by ribbit
* In Defense of Cloning
( 1 2 3 all )
Adamist 2,947 49 12/30/02 09:59 AM
by silversoul7
* philosophers are instruments of the devil
( 1 2 3 all )
Positronius 6,346 43 03/04/09 05:15 AM
by Noteworthy
* Alien/Human Relations, Version 2
( 1 2 3 4 5 6 all )
ShroomismM 14,800 103 02/08/04 06:12 PM
by Shroomism
* The "Evils" of cloning
( 1 2 all )
chemkid 2,039 30 01/10/03 07:00 PM
by Spiffy
* Stanford announces plans to clone human embryos
( 1 2 all )
GoBlue! 2,598 34 12/12/02 11:24 AM
by raytrace
* Did Ancient philosophers trip out?
( 1 2 all )
Mithril 4,203 29 03/01/03 03:48 AM
by MarkostheGnostic

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: Middleman, DividedQuantum
5,987 topic views. 2 members, 21 guests and 11 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2024 Mind Media. Some rights reserved.

Generated in 0.03 seconds spending 0.007 seconds on 16 queries.