Home | Community | Message Board


Lil Shop Of Spores
Please support our sponsors.

Mushrooms, Mycology and Psychedelics >> The Ethnobotanical Garden

Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Amazon Shop: San Pedro

Jump to first unread post. Pages: 1
OfflineInjectTruth
Wasting my Time,Waiting for theEnd
Male

Registered: 10/05/03
Posts: 778
Loc: New Jerusalem
Last seen: 8 years, 9 months
San Pedro on "Texas Justice"
    #4637152 - 09/09/05 10:17 AM (12 years, 1 month ago)

Do you guys watch Texas Justice? Ever see the cactus in the background. Im pretty sure its san pedro, at least some type of trichocerus. I tried emailing them this, but the form kept having errors.

Quote:

I just wanted to let you know, you have a schedule 1 substance growing on your set.

The cactus in the background, appears, from a distance to be a species of Trichocerus. There are over thirty trichocerus species which contain Mescaline, a schedule 1 entheogen, including Trichocerus Pachanoi, or San Pedro, a common landscaping cactus.

I believe San Pedro is the cactus in your courtroom. While legal in the US as an ornamental, preparation would be considered "manufacturing a controlled dangerous substance".

Not that Im a stickler, but I thought it was funny, given the fact that this is a show about the law. Just goes to show you how many twists and turns there are in the lawbooks.

Have a good one.




--------------------
On a personal level, Freaking Out is a process whereby an
individual casts off outmoded and restricting standars of
thinking, dress, and social etiquette in order to express
CREATIVELY his relationship to his immediate environment and
the social structure as a whole.

http://www.OrganicPharming.com - Ethno Shopping Portal


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineLocus
Male

Folding@home Statistics
Registered: 03/11/04
Posts: 6,101
Loc: ny/europe/other
Last seen: 26 days, 8 hours
Re: San Pedro on "Texas Justice" [Re: InjectTruth]
    #4637179 - 09/09/05 10:29 AM (12 years, 1 month ago)

I don't think it's that big a deal but whatever  :smirk:


--------------------

The important thing is not to stop questioning. Curiosity has its own reason for existing. One cannot help but be in awe when he contemplates the mysteries of eternity, of life, of the marvelous structure of reality. It is enough if one tries merely to comprehend a little of this mystery every day. Never lose a holy curiosity. ~ Albert Einstein
"Fear is the great barrier to human growth." ~ Dr. Robert Monroe



~~~*Dosis sola facit venenum*~~~

*Check my profile to listen to my music* :smile:


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: San Pedro on "Texas Justice" [Re: Locus]
    #4637187 - 09/09/05 10:35 AM (12 years, 1 month ago)

The thread title scared the shit out of me. I don't know what "Texas Justice" is, but I assumed you meant it made mention of the cactus.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleLetto
Load Universeinto Cannon. Aimat Brain. Fire.
Registered: 12/13/02
Posts: 2,321
Re: San Pedro on "Texas Justice" [Re: InjectTruth]
    #4637298 - 09/09/05 11:43 AM (12 years, 1 month ago)

There's no reason to inform them unless you want it taken off of the show.  :confused: Hell, I'd like to see cacti in all shows. I don't care if they're active or not.


Post Extras: Print Post  Remind Me! Notify Moderator
Invisiblerod
Ψ
 User Gallery

Registered: 06/29/05
Posts: 3,727
Re: San Pedro on "Texas Justice" [Re: InjectTruth]
    #4637301 - 09/09/05 11:47 AM (12 years, 1 month ago)

I,ve seen the cactus on that show before, but it never dawned on me it might be a pedro, i,m going to have to set and record it to see
if it is, that Judge is one bitchy mother.


Post Extras: Print Post  Remind Me! Notify Moderator
Offlinesupra
computerEnthusiast
Registered: 10/26/03
Posts: 6,446
Loc: TEXAS
Last seen: 6 years, 5 months
Re: San Pedro on "Texas Justice" [Re: InjectTruth]
    #4637451 - 09/09/05 12:38 PM (12 years, 1 month ago)

yes, lets bring the fact that one of our favorite cacti has mescaline in it to a judge, even though it is well known, there is no need to bring even more attention to it by emailing them about it  :handth:


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineEkstaza
stranger thanmost
 User Gallery

Registered: 04/11/03
Posts: 4,317
Loc: Around the corner
Last seen: 9 days, 26 minutes
Re: San Pedro on "Texas Justice" [Re: supra]
    #4637569 - 09/09/05 01:15 PM (12 years, 1 month ago)

Quote:

supra said:
yes, lets bring the fact that one of our favorite cacti has mescaline in it to a judge, even though it is well known, there is no need to bring even more attention to it by emailing them about it  :handth:



Exactly
Not only a judge, but a television judge. Lets give the media something to sensationalize. NOT!!! I have San Pedro's growing all over my yard and back porch, but I don't go telling the world,"Hey, I have a restricted drug growing in these seamingly normal ornamental cactii".


--------------------
YOUR EXPERIENCE WITH ANY GIVEN DRUG ISN'T THE DEFINITIVE MEASURE OF THE DRUGS EFFECTS.


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleHarveyWalbanger
Demiurge
Male

Registered: 06/24/02
Posts: 3,070
Loc: 8b
Re: San Pedro on "Texas Justice" [Re: InjectTruth]
    #4641721 - 09/10/05 01:20 PM (12 years, 1 month ago)

After watching many episodes.... its just a cereus : p


--------------------


Post Extras: Print Post  Remind Me! Notify Moderator
InvisiblePrisoner#1
Even Dumber ThanAdvertized!
 User Gallery

Registered: 01/22/03
Posts: 193,665
Loc: Pvt. Pubfag NutSuck
Re: San Pedro on "Texas Justice" [Re: HarveyWalbanger]
    #4641780 - 09/10/05 01:34 PM (12 years, 1 month ago)

cereusly?  :smirk:


Post Extras: Print Post  Remind Me! Notify Moderator
Offlinesupra
computerEnthusiast
Registered: 10/26/03
Posts: 6,446
Loc: TEXAS
Last seen: 6 years, 5 months
Re: San Pedro on "Texas Justice" [Re: Prisoner#1]
    #4643647 - 09/10/05 10:47 PM (12 years, 1 month ago)

Quote:

Prisoner#1 said:
cereusly?  :smirk:




:grin:


Post Extras: Print Post  Remind Me! Notify Moderator
Jump to top. Pages: 1

Amazon Shop: San Pedro

Mushrooms, Mycology and Psychedelics >> The Ethnobotanical Garden

Similar ThreadsPosterViewsRepliesLast post
* texas justice cactus
Psychoslut
611 3 05/15/03 05:16 PM
by Aneglakya
* texas justice cactus revisited
Psychoslut
431 0 07/22/03 03:12 PM
by Gumby
* san pedro outdoors Audi0 1,000 6 04/08/04 12:24 AM
by Psilygirl
* 5700 year old Peyote *still* stronger than your San Pedro :) Koala Koolio 3,541 19 01/22/15 06:26 PM
by ferrel_human
* WARNING: To Vendors who Peddle Dried San Pedro Skins
( 1 2 3 4 5 all )
mjshroomer 21,421 84 09/25/07 05:09 AM
by Nalim
* Exclusive Pictorial: How To Prepare San Pedro (Photos)
( 1 2 3 4 5 6 7 8 all )
mjshroomer 50,472 140 09/15/16 05:31 AM
by Mostly_Harmless
* Charity case.. San Pedro/Peruvian Torch seeds David.Hulse 940 4 08/17/07 09:05 PM
by deformedreality
* So I just bought a huge San Pedro cactus... (now with pics)
( 1 2 all )
MOTH 4,841 31 02/07/05 04:05 AM
by Maverik

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: Magash, karode13, naum, Mostly_Harmless
1,179 topic views. 0 members, 9 guests and 6 web crawlers are browsing this forum.
[ Toggle Favorite | Print Topic | Stats ]
Search this thread:
Shroom Supply
Please support our sponsors.

Copyright 1997-2017 Mind Media. Some rights reserved.

Generated in 0.034 seconds spending 0.007 seconds on 19 queries.