|
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
|
mjshroomer
Sage
Registered: 07/21/99
Posts: 13,774
Loc: gone with my shrooms
|
WARNING: To Vendors who Peddle Dried San Pedro Skins
#3734612 - 02/05/05 09:16 AM (18 years, 1 month ago) |
|
|
This morning it was brought to my attention that ethnobotanysource.com is one of many vendors of San Pedro who are offering dried peeled skins of San Pedro to the public and/or chunks of dried skins and/or San Pedro extracts.
I want to inform all of them that they are selling a controlled substance in a prepared form.
There are currently three factores for San pedro being legal in the United States of America. 1. They are used in grafting. This means that you can graft any catctus in the world which would not survive outside of its natural habitat to the top of a San Pedro cactus and it will survive out of its natural habitat.
2. It has a different Latin name than peyote (Lophophora williamsii) whereas San Pedro's Latin name is Thichocereus pachanoi and about 13 related species.
3. It is not sold on street corners like pot, cocaine, crack, heroin, etc. And it is not prepared in any manner.
Selling dried material is highly illegal. And the reason is is that it is prepared. While San Pedro in itself is not illegal as long as it is fresh, drying it and selling it as such is considered by the DEA and law enforcement agencies throughout the continental USA as contrabaned matrerials and you can be charged and presecuted under the law.
What you are doing by peeling the skins off and selling them is considered as manufacturing and being greedy by drying and selling in a dried form you could eventually lead to its being made illegal in the USA. And to criminal presecutions for possing mescaline which is illegal to have. Mescaline is a schedule 1 controlled substance and is illegal to pssess, sell, distribute, etc. Right now, fresh mushrooms in England and the UK are about to become illegal due to all of the idiots who decided to open stores and sell the frsh mushrooms openly to anyone who wanted them. Since 1976 it was not illegal in UK to posses such mushroms as long as they were fresh. Selling them publically became a whole new ball game and more than 300 shops now face closure this summer when the new laws are enacted against the sale of any fresh psilocybian mushroms in UK.
That means that the thousands of yearly pickers will now face prosecution if they are caught picking shrooms. Since 1976, not a single picker in the UK faced these kinda charges. So A few greedy people made the shrooms illegal for all.
This is what will happen to San Pedro if these people here in the USA continue to offer dried skins and extracts for sale to the general public on the internet.
And selling dried San Pedro can also lead to the fresh cacti becoming illegal in the United States. This is really a stupid thing to do and prospective buyers from any of these people who sell dried skins and extracts should tell the vendors who do so they are going to hurt others chances of experiencing this beautiful sacred entheogenic plant. I previously warned internet viewers about the shops in England several years ago that the law would take over and make the sales of fresh magic shrooms illegal and that int turn would cause thousands of others problems where there never were any as long as one could go pick the shrooms without fear of any legal hassles. Now those perspective pickers will face hassles and fines and jail terms for such activities. All because several hundred people became greedy and runined it for tghe majority.
Please think about this matter carefully because greedy vendors can hurt this for everyone.
This is not a paranoid response to the matter but a serious thought for all to make a point to the vendors who peddle the dried materials. They are illegal in that form. Think about it carefully becase it affects us all int he long run.
I have been fortunate regarding San pedro because i have used it since 1974 or so and NEver had a problem in obtaining it legally.
These sales by greedy vendors will bribng its downfall for all of us.
mj
|
gdman
badger, badger,badger...


Registered: 12/10/02
Posts: 16,286
Loc: Dancing In the Streets
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: mjshroomer]
#3734620 - 02/05/05 09:18 AM (18 years, 1 month ago) |
|
|
I thought this was a no brainer, guess not .
--------------------
Got a question about a substance? Erowid might already have your answer! Have questions about the mushroom experience? The Tripper's FAQ may have your answer or someone else might have had your question before. I know up on the top you are seeing great sights, but down at the bottom we, too, should have rights.
- Theodor Seuss Geisel Dr. Suess
"I didn't come here to be easily understood" - Steve
|
Stonehenge
Alt Center

Registered: 06/20/04
Posts: 14,850
Loc: S.E.
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: gdman]
#3734846 - 02/05/05 10:53 AM (18 years, 1 month ago) |
|
|
I agree, mjshroomer, this is a bad thing. I would not be at all surprised if some federal agency is investigating this now. I would also not be surprised if at some time in the future they announce a bunch of arrests and shut down some people. I hope not but this is the same administration that had a huge bust last year for glass. Yes, they busted people for selling glass and made it stick. I think the only reason ebay allows it now is because they are cooperating with the feds to help them catch as many people as possible. Ebay is the lowest form of scum and will turn you in or rip you off without a second thought. They will turn over your personal information to the law without a warrant or any legal papers.
-------------------- “A democracy cannot exist as a permanent form of government. It can only exist until the voters discover that they can vote themselves largesse from the public treasury. From that moment on, the majority always votes for the candidates promising the most benefits from the public treasury with the result that a democracy always collapses over loose fiscal policy, always followed by a dictatorship.” (attributed to Alexis de Tocqueville political philosopher Circa 1835)
Trade list http://www.shroomery.org/forums/showflat.php/Number/18047755
|
gdman
badger, badger,badger...


Registered: 12/10/02
Posts: 16,286
Loc: Dancing In the Streets
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: Stonehenge]
#3734860 - 02/05/05 10:56 AM (18 years, 1 month ago) |
|
|
someone said this before, I'll say it now, ebay- we do not elect them, yet they can run our lives.
--------------------
Got a question about a substance? Erowid might already have your answer! Have questions about the mushroom experience? The Tripper's FAQ may have your answer or someone else might have had your question before. I know up on the top you are seeing great sights, but down at the bottom we, too, should have rights.
- Theodor Seuss Geisel Dr. Suess
"I didn't come here to be easily understood" - Steve
|
enu
Stranger
Registered: 02/05/05
Posts: 1
Last seen: 18 years, 9 days
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: gdman]
#3735951 - 02/05/05 03:56 PM (18 years, 1 month ago) |
|
|
I agree, this needs to stop. If someone wishes to utilize this plant to it's full potential they should have no other option but to buy this plant in it's intended legitimate state and process discretely.
If this doesn't stop now by way of the voices of the community, we may very well wake up one day to find that someone else has stopped it for us.
I don't use this material, never had. But as it now stands I have the option to if I so desire.
The reason we as people lose are rights is because when we hear they are being taken away, or discover a situation which could potentially lead to their dissipation, we simply stand by on the sidelines gawking towards the field like idiot spectators.
My proposal is for as many people as possible to contact the people engaging in this activity and urge them to stop. Contact ebay and inform them of this activity before word spreads to far if entirely necessary.
Suggestions?
Edited by enu (02/05/05 03:57 PM)
|
Psilocybeingzz


Registered: 12/15/02
Posts: 14,463
Loc: International waters
Last seen: 10 years, 4 months
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: mjshroomer]
#3736117 - 02/05/05 04:28 PM (18 years, 1 month ago) |
|
|
So what your saying is I better buy as much as I can before its made illegal???
Oh.......wait I'm Canadian eh, even peyote is legal here (Sorry guys, I am bit trying to be a dick or anything )
|
felixhigh
Scientist


Registered: 06/24/01
Posts: 7,543
Loc: Ly
Last seen: 13 days, 14 minutes
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: Psilocybeingzz]
#3736743 - 02/05/05 06:27 PM (18 years, 1 month ago) |
|
|
heh, good one, psilo! 
MJ, this is a huge bomb. it really is a pity for the vendors of plants and herbs in the US that this market is darn gray area whereas in other countries (specially poor countries) it often is the backbone of the local medicine... here in brazil there are people that simply don't have a pharmacy in a range of hundreds of miles, they rely on the woods for healing. so much that even in the big city one is able to find most (not ALL) healing plants, and there's a increasing number of people (i am referring to the whole planet now) seeking plants rather than pills for healing or whatever is their purposes (spiritual, etc...)... the vendors should try to set themselves as best as they can in the law matters, by knowing the law and using what could be used against them in their favor...
FH
|
biglo
Shroomery BabySitter



Registered: 11/22/02
Posts: 603
Loc: US of A
Last seen: 7 years, 7 months
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: felixhigh]
#3737933 - 02/05/05 10:10 PM (18 years, 1 month ago) |
|
|
It's only a matter of time before all grey market activities all become illegal here in our great free country. I believe it is only a matter of time before spores, salvia, poppy pods, cough syrup *DXM, and just about any plant that can alter perception is made illegal. The only good thing is we have the knowledge and way to distribute it so that people can find and identify them. It's not like the police can identify every "illegal" plant on the planet, we just need to privately cultivate and spread such plants to preserve them. The Indians of South America and Mexico preserved this information for generations under Spanish rule, and so must we, and hope for a time when people become more sensible. Till then we must preserve and fight for change. As for greedy motherfuckers trying to make a profit, they will always be around until they can't make extraordinary profits from plants that should be freely cultivated and harvested. Greedy people will eventually ruin it for everyone, but all we can do for now is pressure these vendors to do better business practices, to at least prolong the golden period we live in, which, unfortunately will probably be coming to an end at some point.
|
World Spirit
PNW



Registered: 07/27/01
Posts: 9,817
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: mjshroomer]
#3738103 - 02/05/05 10:42 PM (18 years, 1 month ago) |
|
|
I stand with MJ on this issue. The whole cactus should be sold fresh because of the social climate we're dealing with.
|
Boom
just a tester

Registered: 06/16/04
Posts: 11,252
Loc: Cypress Creek
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: World Spirit]
#3738456 - 02/05/05 11:58 PM (18 years, 1 month ago) |
|
|
But the bag I got in the mail said it was Incense, and not for human consumption... 
I recall reading something in the DEA microgram 'bout someone being found with dried cacti skins...So it is only a matter of time
|
theocean06
Yeah, I've donefour already...

Registered: 07/10/04
Posts: 1,458
Last seen: 11 years, 8 months
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: Boom]
#3740088 - 02/06/05 08:28 AM (18 years, 1 month ago) |
|
|
"it's only a matter of time..."
I hate threads like these. Not because they aren't making a good point (this thread is), but because it always brings me down - thinking about something like San Pedro being made illegal.
--------------------
The story of life is quicker then the blink of an eye, the story of love is hello, goodbye. - Hendrix
|
spores
haploid


Registered: 02/18/99
Posts: 2,486
Loc: Washington
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: mjshroomer]
#3740441 - 02/06/05 11:16 AM (18 years, 1 month ago) |
|
|
yeah, that shit's been going on quite a while , I totally agree with you that it has a high potential to cause unwanted attention to san pedro.
hopefully they will listen to you before something happens, somehow I doubt they will until the DEA knocks on their door though, like the foolish chemical suppliers who advertised their shit on google and ruined a good thing for the rest of us last summer .
DH
|
felixhigh
Scientist


Registered: 06/24/01
Posts: 7,543
Loc: Ly
Last seen: 13 days, 14 minutes
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: Boom]
#3740920 - 02/06/05 02:05 PM (18 years, 1 month ago) |
|
|
Quote:
Booooom said: But the bag I got in the mail said it was Incense, and not for human consumption... 
i could wrap marihuana and send you telling it's incense in the label but that wouldn't make the marihuana less marihuana. indeed, the grayness of the area is what takes up the prices and makes this branch of biz so profitable... with much respect to the herbs sponsors, all of it is ridiculous, if it were in my country (i don't wanna compare countries, far away from that... this is also something i don't understand - it must be some kind of economical protencionism policy, there's no excuse for it) the federal police would already be all over it and these 'businessmen' would better have a university degree, otherwise they'll be thrown in overcrowded cells with dealers, rapers and murders...
FH
|
Atma
100% Organic

Registered: 02/05/05
Posts: 111
Loc: All Natural
Last seen: 17 years, 8 months
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: felixhigh]
#3741301 - 02/06/05 03:43 PM (18 years, 1 month ago) |
|
|
This should be emailed to vendors who sell the skins.
|
theocean06
Yeah, I've donefour already...

Registered: 07/10/04
Posts: 1,458
Last seen: 11 years, 8 months
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: theocean06]
#3741499 - 02/06/05 04:30 PM (18 years, 1 month ago) |
|
|
Has anyone heard of the DEA looking into San Pedro and other related cacti? I sure they are aware of what it contains, but have that investigated or put articles up on their website, something like that?
--------------------
The story of life is quicker then the blink of an eye, the story of love is hello, goodbye. - Hendrix
|
canid
irregular meat sprocket



Registered: 02/26/02
Posts: 11,912
Loc: looking for zeebras, n. c...
Last seen: 2 years, 7 months
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: theocean06]
#3741536 - 02/06/05 04:39 PM (18 years, 1 month ago) |
|
|
i'm sure they've been on the ball about it, as must mescaline sold is extracted from these cacti [extremely rarely is is synthesized].
the fact of the matter is that without a lot of trouble, they will not likely make it redundant to specificaly outlaw the plants. on the other hand, shit like this, and some vendors getting busted just may bring it to that head.
as far as what felix said, i agree, except that the analogy he made was fallacious, as Canabis *is* specificaly outlawed as a plant, in adition to tetrahydrocanabinol and it's analouges.
--------------------
Attn PWN hunters: If you should come across a bluing Psilocybe matching P. pellicolusa please smell it.
If you detect a scent reminiscent of Anethole (anise) please preserve a specimen or two for study and please PM me.
|
Deviate
newbie
Registered: 04/20/03
Posts: 4,497
Last seen: 7 years, 6 months
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: canid]
#3741581 - 02/06/05 04:56 PM (18 years, 1 month ago) |
|
|
i dissagree. i don't think the DEA cares much about this because there are so few people using it. i've heard the cactus causes a lot of nausea and most people don't even know about it so it will never become a mainstream thing. it's the same thing with morning glory seeds, they are a psychedelic similar to LSD that has been known in the USA since the 60s but the DEA hasn't scheduled them. why? probably because they cause so much nausea and other side affects that there will never be widespread use. cough syrup is further proof, that hasn't been scheduled even though there is a fairly large user base.
the reason mushrooms are going to be banned in the UK is because mushrooms are a drug with mass market appeal. they attract all sorts of people, not just a selected group of psychedelic enthusiasts. peyote and san pedro are legal in the UK as well but they are not being banned.
Edited by Deviate (02/06/05 04:59 PM)
|
canid
irregular meat sprocket



Registered: 02/26/02
Posts: 11,912
Loc: looking for zeebras, n. c...
Last seen: 2 years, 7 months
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: Deviate]
#3741624 - 02/06/05 05:07 PM (18 years, 1 month ago) |
|
|
actualy, many comunities are moving towards restricting thesales of morning glory and hawaiian baby wood rose seeds and limiting quantities and they are getting alot of media attention in rescent years.
the DEA is not stupid, and they care about all substances they deem to be dangerous and all materials containing them. don't be foolish. it's the reason they exist.
--------------------
Attn PWN hunters: If you should come across a bluing Psilocybe matching P. pellicolusa please smell it.
If you detect a scent reminiscent of Anethole (anise) please preserve a specimen or two for study and please PM me.
|
Deviate
newbie
Registered: 04/20/03
Posts: 4,497
Last seen: 7 years, 6 months
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: canid]
#3741651 - 02/06/05 05:13 PM (18 years, 1 month ago) |
|
|
oh, well thats news to me. i knew the DEA wasnt stupid, i just didn't think they felt it necesssary to schedule every single psychoactive substance if it had a very small user base. i mean the affects of morning glory, amanita muscaria, cacti, dxm, nutmeg, and poppy pods have been known about for decades and they haven't taken any action.
|
canid
irregular meat sprocket



Registered: 02/26/02
Posts: 11,912
Loc: looking for zeebras, n. c...
Last seen: 2 years, 7 months
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: Deviate]
#3744293 - 02/07/05 05:06 AM (18 years, 1 month ago) |
|
|
yes, but things like these have been getting more and more attention as of late. news coverage reporting morning glory seeds to be poisoning middleschool kids, etc. it's the public awareness that has been getting things like these scheduled, as much as the potentialy dangerous nature of some of them [i.e. Datura sp.]
--------------------
Attn PWN hunters: If you should come across a bluing Psilocybe matching P. pellicolusa please smell it.
If you detect a scent reminiscent of Anethole (anise) please preserve a specimen or two for study and please PM me.
|
Vvellum
Stranger

Registered: 05/24/04
Posts: 10,920
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: mjshroomer]
#3745814 - 02/07/05 02:31 PM (18 years, 1 month ago) |
|
|
I think salvia is more in danger of being made illegal. I've been saying this for awhile now - get a few cuttings and get the underground ready.
|
dblaney
Human Being

Registered: 10/03/04
Posts: 7,894
Loc: Here & Now
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: Vvellum]
#3745888 - 02/07/05 02:50 PM (18 years, 1 month ago) |
|
|
Quote:
bi0 said: I've been saying this for awhile now - get a few cuttings and get the underground ready.
-------------------- "What is in us that turns a deaf ear to the cries of human suffering?"
"Belief is a beautiful armor
But makes for the heaviest sword"
- John Mayer
Making the noise "penicillin" is no substitute for actually taking penicillin.
"This country, with its institutions, belongs to the people who inhabit it. Whenever they shall grow weary of the existing government, they can exercise their constitutional right of amending it, or their revolutionary right to dismember or overthrow it." -Abraham Lincoln
|
BorgFace
PEENTASTIC
Registered: 11/30/04
Posts: 515
Loc: Australia
Last seen: 16 years, 2 days
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: dblaney]
#3746705 - 02/07/05 05:24 PM (18 years, 1 month ago) |
|
|
The illegality of salvia in Australia has done nothing to curb the availability of cuttings and even dried material provided you are a switched on individual.
-------------------- Give me an ounce of civet, good apothecary, to sweeten my imagination!
|
Vvellum
Stranger

Registered: 05/24/04
Posts: 10,920
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: BorgFace]
#3748033 - 02/07/05 09:32 PM (18 years, 1 month ago) |
|
|
switched on individual? huh?
|
el_duderino
His Dudeness


Registered: 04/22/04
Posts: 407
Loc: 'stralia
Last seen: 1 year, 8 months
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: BorgFace]
#3749699 - 02/08/05 02:37 AM (18 years, 1 month ago) |
|
|
agreed, It's just like mj i suppose, the illegality has done nothing to reduce availability (on the contrary i reckon) But then there's a much MUCH larger underground market for mj than saliva. Still if you know the right people it's quite easy to still get salvia.
-------------------- Look, let me explain something to you. I'm not Mr. Lebowski. You're Mr. Lebowski. I'm the Dude. So that's what you call me. That, or His Dudeness … Duder … or El Duderino, if, you know, you're not into the whole brevity thing.
|
Psiloman
member

Registered: 04/11/03
Posts: 1,116
Loc: Europe
Last seen: 9 years, 6 months
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: el_duderino]
#3749906 - 02/08/05 04:26 AM (18 years, 1 month ago) |
|
|
Ummmm
So guys,let me get that straight :
Are you proposing that we should do nothing about it and the viable solution is to "yo,keepin it real in the underground"? Do you REALLY want to transfer salvia trade or Trichocereus trade to the arms of fucking dealers ('cause there is where it is going to end up if we vouch for "undergggggggggggggggggggground maaaaaaaaan!"")
Is this apathy we are seeing here?
Hell,no ,we should cause trouble to people selling those skins...Dont forget: Contrary to your goverment they cannnot and should not control our lives to a big extent nor they are "unreachable by mortal folks".A barrage of emails,maybe some well worder threats could make them rethink their stance.
That is of course if you care about san pedro and all of the ethnobotanicals ,or if you choose to leave your fate in the "underground" or on some dealers who will decide for prices,decide for product quality,decide for availability and so on and so forth....
Come on,i expected more "rebelion" from a forum that is supposed to chellenge thought and given laws (isnt that one ofthe action of psychedelics? Arent they thought provoking?)
|
dblaney
Human Being

Registered: 10/03/04
Posts: 7,894
Loc: Here & Now
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: Psiloman]
#3749978 - 02/08/05 05:28 AM (18 years, 1 month ago) |
|
|
Man you've got a lot of energy. You should harness that and become an activist. But anyways, no we aren't saying Salvia and the like should be in the hands of shady dealers. But for the moment, at least with the current administration in the US, petitioning to legalize a certain drug does very little good. It's been done many times in the past and really hasn't yielded much. So far congress HAS tried to ban Salvinorin, but enough scientific evidence was presented to convince them otherwise. Right now it is prudent to focus on prevention and drug LAW reform. There is no way in hell a government which has been so harsh on drugs for more than a half century is going to suddenly change it's mind and legalize various substances just like that :snaps fingers:. It would be gradual. Anyways, just my two cents. Focus on the law reform first.
As for the Pedro, we're saying that vendors should stop selling the flesh in the dried form, because that is illegal in the States. That way there will still be fresh cacti available. If vendors continue to sell the dried form, then the gov. might very well decide to make any form of the cactus illegal, just like peyote.
-------------------- "What is in us that turns a deaf ear to the cries of human suffering?"
"Belief is a beautiful armor
But makes for the heaviest sword"
- John Mayer
Making the noise "penicillin" is no substitute for actually taking penicillin.
"This country, with its institutions, belongs to the people who inhabit it. Whenever they shall grow weary of the existing government, they can exercise their constitutional right of amending it, or their revolutionary right to dismember or overthrow it." -Abraham Lincoln
|
Psiloman
member

Registered: 04/11/03
Posts: 1,116
Loc: Europe
Last seen: 9 years, 6 months
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: dblaney]
#3749996 - 02/08/05 05:47 AM (18 years, 1 month ago) |
|
|
Im kinda of an activist and indeed igot lots of energy...
Thing is,should WE (as a community) act to put this item out of sale before goverment does it?
There are numerous ways,no i dont thing the gov would cooperate but we can scare those people selling the dried material...
|
dblaney
Human Being

Registered: 10/03/04
Posts: 7,894
Loc: Here & Now
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: Psiloman]
#3750001 - 02/08/05 05:50 AM (18 years, 1 month ago) |
|
|
Quote:
Psiloman said: should WE (as a community) act to put this item out of sale before goverment does it?
Yeah, that's exactly what we're saying.
Keep up the good work and fight the good fight
-------------------- "What is in us that turns a deaf ear to the cries of human suffering?"
"Belief is a beautiful armor
But makes for the heaviest sword"
- John Mayer
Making the noise "penicillin" is no substitute for actually taking penicillin.
"This country, with its institutions, belongs to the people who inhabit it. Whenever they shall grow weary of the existing government, they can exercise their constitutional right of amending it, or their revolutionary right to dismember or overthrow it." -Abraham Lincoln
|
gnrm23
Carpal Tunnel
Registered: 08/29/99
Posts: 6,488
Loc: n. e. OH, USSA
Last seen: 11 days, 15 hours
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: dblaney]
#3750051 - 02/08/05 06:51 AM (18 years, 1 month ago) |
|
|
well... the one guy in ummmm peru (who has a name like a song), & sells several other herbs & shipibo artifacts & such (& does sell kilos of very nice dried chips for under $300?) did somehow manage to ummmmmm mislabel the package as Optunia rather than Trichocereus (but it was most definitely a Tricho!!!); i think that i did order some vine & leaf & maybe other stuff... as for the inkatea vendor site that's more like "shopping mall peru" - many peruvian products, including mate de coca, herbs & pisco & native artifacts & whatnot, including powdered Tricho cactus (ummmm 400 g/$49?) - well, we shall soon see what is on the label of that package (along with tea, a nice cedar box (w 300g pwdr coca inside!/$49!) & a maraca, whatever...)
~
"don't touch my bags, if you please, mister customs man...."
((NOTE TO MODS: if this posting is in violation of board rules, feel free to modify or delete...))((& slap me silly if you must... happy fat tuesdy, party on down... ashes tomorrow...)
-------------------- old enough to know better
not old enough to care
Edited by gnrm23 (02/08/05 07:49 AM)
|
el_duderino
His Dudeness


Registered: 04/22/04
Posts: 407
Loc: 'stralia
Last seen: 1 year, 8 months
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: gnrm23]
#3750329 - 02/08/05 09:19 AM (18 years, 1 month ago) |
|
|
I think the situation is somewhat different than in england with the shrooms. There it was LEGAL to sell fresh shrooms. In the US it is ILLEGAL to sell a preparation of the cactus right? I thought that if anything will happen they'd arrest the vendors for selling illegal material.
Im sure u could still sell yer cacti from walmart though. I guess if they look at the records of places with a very suspicious name like 'Dirty Hippy Products that make you see shit co.' and see they sold plenty of fresh cacti then it could be under threat.
Still e-mail these sob's and tell em they're doin illegal shit and you'll report them if they dont stop. Threats are the only way they'll listen. You think they'll care that future generations wont be able to get pedros because they're greedy? fuck no. But they'll care if they're about to go to jail.
-------------------- Look, let me explain something to you. I'm not Mr. Lebowski. You're Mr. Lebowski. I'm the Dude. So that's what you call me. That, or His Dudeness … Duder … or El Duderino, if, you know, you're not into the whole brevity thing.
|
garbage

Registered: 06/17/03
Posts: 316
Last seen: 1 day, 30 minutes
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: el_duderino]
#3751204 - 02/08/05 01:49 PM (18 years, 1 month ago) |
|
|
shouldnt all these ethno/herbal shops be banned then? they sell all these nice things not intended for human consumption, but we all know, including the dea, where they will be going. just because its natural doesnt mean its good. the internet makes accessibility all too easy.
--------------------
Vaporbrothers
|
mjshroomer
Sage
Registered: 07/21/99
Posts: 13,774
Loc: gone with my shrooms
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: garbage]
#3751617 - 02/08/05 04:03 PM (18 years, 1 month ago) |
|
|
HEy Garbage, great avatar.
mj
Love that eye.
|
Baby_Hitler
Errorist



Registered: 03/06/02
Posts: 27,226
Loc: To the limit!
Last seen: 15 minutes, 55 seconds
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: Psiloman]
#3752763 - 02/08/05 08:24 PM (18 years, 1 month ago) |
|
|
What can you do except not buy the dried cactus?
Stick to live plants, and don't just buy to consume. Grow a plant for crying out loud.
-------------------- (•_•) <) )~ ANTIFA / \ \(•_•) ( (> SUPER / \ (•_•) <) )> SOLDIERS / \
|
el_duderino
His Dudeness


Registered: 04/22/04
Posts: 407
Loc: 'stralia
Last seen: 1 year, 8 months
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: garbage]
#3753271 - 02/08/05 09:41 PM (18 years, 1 month ago) |
|
|
Thing is all these ethno-stores sell quasi legal products. If they're selling san pedro skins that's 100% illegal right? Just make threats of calling the police and hopefully they'll shit themselves. I dunno if REALLY calling the police would be a good move though.
-------------------- Look, let me explain something to you. I'm not Mr. Lebowski. You're Mr. Lebowski. I'm the Dude. So that's what you call me. That, or His Dudeness … Duder … or El Duderino, if, you know, you're not into the whole brevity thing.
|
garbage

Registered: 06/17/03
Posts: 316
Last seen: 1 day, 30 minutes
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: el_duderino]
#3753756 - 02/08/05 11:00 PM (18 years, 1 month ago) |
|
|
thanks mj. i think it all comes down to responsibility. my friend told me he passed out doing duster over the weekend. i told him, "thats why drugs are illegal."
--------------------
Vaporbrothers
|
Vvellum
Stranger

Registered: 05/24/04
Posts: 10,920
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: Psiloman]
#3753819 - 02/08/05 11:16 PM (18 years, 1 month ago) |
|
|
Quote:
Psiloman said: Ummmm
So guys,let me get that straight :
Are you proposing that we should do nothing about it and the viable solution is to "yo,keepin it real in the underground"? Do you REALLY want to transfer salvia trade or Trichocereus trade to the arms of fucking dealers ('cause there is where it is going to end up if we vouch for "undergggggggggggggggggggground maaaaaaaaan!"")
Is this apathy we are seeing here?
Hell,no ,we should cause trouble to people selling those skins...Dont forget: Contrary to your goverment they cannnot and should not control our lives to a big extent nor they are "unreachable by mortal folks".A barrage of emails,maybe some well worder threats could make them rethink their stance.
That is of course if you care about san pedro and all of the ethnobotanicals ,or if you choose to leave your fate in the "underground" or on some dealers who will decide for prices,decide for product quality,decide for availability and so on and so forth....
Come on,i expected more "rebelion" from a forum that is supposed to chellenge thought and given laws (isnt that one ofthe action of psychedelics? Arent they thought provoking?)
what exactly do you propose? that the entheo-vendors stop selling salvia and dried cacti? yeah, that would be great and all - but you are forgetting the basic principal of the market: supply and demand. There will be someone else popping up to fill the void and cash in. If there is money to be made and there is a source for such products, someone will engage in the business. They will ignore your calls because they will only care about the cash filling their PO Box and merchant account.
what I meant by my comment "get the underground ready" (speaking of spreading salvia cuttings around) is simply that. I said nothing really of drug dealer syndicates - I can see people trading cuttings on the downlow for the purpose of distributing dry leaves/extracts and, in a broader sense, keeping the plant itself alive North America (keep in mind salvia doesnt propagate through seed like marijuana). I can see people trading cuttings.
I can also see people selling extracts and dry leaf in the black market, but so what? Salvia would never be very popular, and I think it would be less popular if made illegal because fewer people would access to it. I have no problems with illegal drug trade so as long as there isnt violence or other shady activity involved.
so yeah, I wish there were better options than "get the underground ready" but face it - the US government sucks and they can outlaw these plants in a blink of an eye.
If you come up with a viable solution, I'll listen. But until then, please chill with the barking.
|
el_duderino
His Dudeness


Registered: 04/22/04
Posts: 407
Loc: 'stralia
Last seen: 1 year, 8 months
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: Vvellum]
#3755244 - 02/09/05 09:02 AM (18 years, 1 month ago) |
|
|
well put. Better be prepared than be sorry about it later.
-------------------- Look, let me explain something to you. I'm not Mr. Lebowski. You're Mr. Lebowski. I'm the Dude. So that's what you call me. That, or His Dudeness … Duder … or El Duderino, if, you know, you're not into the whole brevity thing.
|
onetime
onetime


Registered: 11/13/03
Posts: 3,609
Last seen: 12 years, 3 months
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: mjshroomer]
#3755411 - 02/09/05 10:01 AM (18 years, 1 month ago) |
|
|
WARNING: SOLD FOR IDENTIFICATION PURPOSES ONLY,OR AS A VISUAL AID TO SHOW WHAT NATIVE PLANTS ARE USED IN SOUTH AMERICAN and MEXICAN CULTURES. IT IS ILLEGAL TO CONSUME OR PREPARE, SO DON'T!. IF WE THINK YOU WILL WE WILL NOT SELL IT TO YOU!!!
they sell it for identification only this is more legal than it sounds there are mj seed companys that sell seeds for the same resons some of the head shops used to till like 2000 they say its still legal to sell if you have a disclaimer and shit my freind that sold mj seeds at the head shop he owned went to court about it too and the courts said it was legal for him to sell if he had a warning i think thats all you need but i dont know any thing
--------------------
See?
Yes, with my own three eyes.
Depression, Misspells , wanting everying thing i cant have haveing nothing i want
|
infamous
LeArnin ThARoPes


Registered: 12/21/04
Posts: 917
Loc: dark side of the moon
Last seen: 17 years, 8 months
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: onetime]
#3755490 - 02/09/05 10:24 AM (18 years, 1 month ago) |
|
|
somone should call acting like a little kids parents who found out he ordered drugs over the internet, say their gonna sue and blah blah and hopefully scare em a little bit.
-------------------- The land of the free on paper looks great!
here I stand head in hand turn my face to the wall
Edited by infamous (02/09/05 10:24 AM)
|
Prisoner#1
Even Dumber ThanAdvertized!


Registered: 01/22/03
Posts: 193,665
Loc: Pvt. Pubfag NutSuck
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: infamous]
#3755680 - 02/09/05 11:11 AM (18 years, 1 month ago) |
|
|
yeah, thats a brilliant idea
|
EonTan
bird

Registered: 08/18/04
Posts: 468
Loc: very south
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: mjshroomer]
#3758133 - 02/09/05 07:15 PM (18 years, 1 month ago) |
|
|
hypocrites
Cactus with mescaline are illegal in any form if they are being bought, sold, or possesed for the intent of consumption.
Stop helping the Government draw rediculous lines in the sand as to what is or isn't ok.
INTENT is everything in the eyes of the law.
If these companies are breaking the law they will get caught. If the governmnet can prove that you collect spores that get sold to vendors who sell spores to individuals who grow them and consume the shrooms you might get arrested too. For conspiracy to manufacture and distibute a controlled substance. GET IT.
So quite preaching and get back to collecting. My boss expects results. J/K
|
mjshroomer
Sage
Registered: 07/21/99
Posts: 13,774
Loc: gone with my shrooms
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: EonTan]
#3759377 - 02/09/05 10:48 PM (18 years, 1 month ago) |
|
|
EonTan said
Quote:
Cactus with mescaline are illegal in any form if they are being bought, sold, or possesed for the intent of consumption.
Wrong. Mescaline is a controlled substance. IT is the mescaline which is illegal. Not the cactus.
Just as it is the psilocine/psilocybine and related compounds that is illegal. But they will bust you for growing shrooms. You cannot however, sell spores with growing instructions. That was what got PF busted , even though the charges were for manufacturing psilocine/psilocybine.
by the way, PF justr authorized me to publish his PF tek in my alredy best selling Mushroomc ultivation History Cd-RoM
and have a shroomy day
And as for the spores. Spores are not illegal. If such was the case thenme, Pul Stamets, and everyone else who wrote a book on picking and identifying psilocybian mushrooms would also be liable to busts and prosecutions.
My book Magic mushrooms of the PNW is the oldest selling mushroom guide for magic mushrooms on the market. It was pubished in 1976 and has been sold every year since. Close to 19 years. If it were not for me and many others who wrote these guides, you would not be able to know what the frig they looked like.
You need to lighten up and not be negative about a real warning about something that could be happening real soon and then maybe not according to you. Adn I am sure they monitor these sites regularly although they do not hassle anyone except when they feel i like it.
Alan Shumaker is a good example. He had DEA permits to import Psychotria viridis leaves and the bark of Banisteriopsis caapi (Ayahuasca, yage, Caapi). He made many shipments to the USA and sold them all over. Then two years ago, the DEA confiscated a whole shipload and charged him with importing schedule one drugs into the USA.
They can do what ever they want.
mj.
I sent letters of this to over 2 dozen sites which sell skins and such amd some ogf trhem wrote me back abotu the matter. Some ogf those letters are posted at thenook.org.
If you need to go there and read them.
mj
|
el_duderino
His Dudeness


Registered: 04/22/04
Posts: 407
Loc: 'stralia
Last seen: 1 year, 8 months
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: mjshroomer]
#3760236 - 02/10/05 02:26 AM (18 years, 1 month ago) |
|
|
just curious.. SAn Pedro legal, Peyote -?? Is it legal or illegal? Hehe another thing i find funny is that the chemical itself is illegal to posess. Wouldnt posessing cacti that possess mescaline then also be illegal? Obviously not in the case of San Pedro.
BTW everyone drill a hole into your brain to get that little small gland called the pineal out or else your breaking the law! Im not sure if the Dimitry just sits there though(??). Your whole body might be in possession of a controlled substance.
-------------------- Look, let me explain something to you. I'm not Mr. Lebowski. You're Mr. Lebowski. I'm the Dude. So that's what you call me. That, or His Dudeness … Duder … or El Duderino, if, you know, you're not into the whole brevity thing.
|
Psiloman
member

Registered: 04/11/03
Posts: 1,116
Loc: Europe
Last seen: 9 years, 6 months
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: el_duderino]
#3760802 - 02/10/05 08:06 AM (18 years, 1 month ago) |
|
|
well ,i am all up for salvia being given "hand by hand" as cuttings.Unluckyly i am not too fond of "dealers" in the sense that there are a lot of shady characters in the..."dealerhood".Most of them are not known for they knowledge or the quality of their product.They are known just because they sell something illegal,thus unobtainable by other means...
A viable solution: Lets start scaring the Dried Skin guys. They dont want to end up in jail,do they?
As for as the salvia thing oges ,i am mainly ok with it since salvinorin is not a controlled substance at this time.Unfortunatelly though some websityes take advantage of it and are simply asking for trouble (i am speaking about a certain vendor making videos of people smoking salvia as a promotional tool...)
|
Prisoner#1
Even Dumber ThanAdvertized!


Registered: 01/22/03
Posts: 193,665
Loc: Pvt. Pubfag NutSuck
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: el_duderino]
#3761054 - 02/10/05 09:39 AM (18 years, 1 month ago) |
|
|
Quote:
el_duderino said: just curious.. SAn Pedro legal, Peyote -?? Is it legal or illegal? Hehe another thing i find funny is that the chemical itself is illegal to posess. Wouldnt posessing cacti that possess mescaline then also be illegal?
therein is where peyote is the exception to the rule, peyote it's self was outlawed with the help of the BIA (Bureau of Indian Affairs, Dept. of the Interior) it was done as yet another means to control the indians after they were herded to the reservations, since peyote was a religious sacrament for some of the tribes of the southern plains it made sense to them to outlaw it along with their religious rites
|
UnenlightenedOne
Two Spirited

Registered: 08/11/04
Posts: 612
Last seen: 17 years, 3 months
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: Prisoner#1]
#3761350 - 02/10/05 11:10 AM (18 years, 1 month ago) |
|
|
In wisconsin the native american church is allowed to use peyote for religious purposes and rites.
-------------------- Do not desire to reach a high level.Rather work without thought of reward to iron out flaws and impurities in one's self for the sake of one's self.When one has done this one needs not to desire anymore. http://www.lifeforceonlinestore.com/yc/
|
EonTan
bird

Registered: 08/18/04
Posts: 468
Loc: very south
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: mjshroomer]
#3761503 - 02/10/05 11:42 AM (18 years, 1 month ago) |
|
|
Get over yourself. You did not bring Magic mushrooms to the awarness of interested minds in the modern world. I know who you are and what you have written and contributed, I just don't like the hypocrisy I am seeing here in this thread.
A cactus, a cactus cutting, a cactus bud, a cactus skin, a cactus root, is still just a cactus. If the cactus itself is not illegal, then none of it's parts are except the mescaline itself. Unless these sites are selling extracted mescaline, they are not doing anything really different from the nursery selling cuttings, or seeds. Only if you can prove that there INTENT was to Sell the Drug inside the skins. Since their disclaimer is they are for incense and not consumption, I don't see how there is a difference.
You are making the differentiation. You are implying that dried skins are mescaline, and cactus plants are not. You are. Both contain mescaline, both are intended for uses other then drug consumption, yet you are making the assumption one is and one is not going to lead to the illegality of San pedro cactus.
There is a big difference between selling mescaline tea for consumptiopn and selling cactus skins for incense.
As far as the feds go you are right, they will do what ever they want. They will arrest the guy selling grafted san pedro rootstocks if they want, but guess what you aren't here preaching the dangers of doing that. You have focused on dried skins as the end all to legal cactus possesion, when in reality it is not the form it takes or is sold in that will make the cactus illegal, it is the desires of the powers at be that will determine when they want to make it illegal.
There are alternative rootstocks for grafting onto. Herbariums can get permits to house specimens if they decide to make it illegal at any time. They don't bust herbariums now for housing specimens of Illegal mushrooms, do they? INTENT!!!
Paul stamets was working under a license if he was growing mushrooms, other wise he would have gone to jail if they chose to bust him. Picking mushrooms for depositing in herbariums is not illegal, it only becomes illegal if they choose to prosecute you for possesion of a controlled substance. Spores are not the only determining factor for mushroom taxonomy, and you have to posses the mushrooms to do the rest of the taxonomic characteristics. Which is illegal without a license, in theory.
If you are working with Psilocybin containing mushrooms without a license you can be busted, regardless of wether you are picking them for taxonomic reasons, or for consumption. Convicted is another story.
You have idiots in this thread threatening to call the cops. If you can't see something wrong with that, then I just don't know about you or the saftey of this site and it's members.
PF made it possible for KIDS to grow shrooms without any real expense in money or time, or knowledge accumulation. He is looked at, at this site, and throughout the OMC as a GOD. No one says damn what kind of heat is that going to bring on those that were quietly going about there mushroom picking, cultivation before the PF TEK. What about the shroomery itself and like sites on the internet? What effect can they have on the spore industry in the long run. Besides creating a market for spore sales NOW, they could potentially shine to much light on the whole game, and casue the spores to be illegal. Then you would need a license to even posses the spores.
Are you broadcasting WARNINGS on that?
I am not negative I have been nothing but positive since coming to this community years ago. I just get tired of the DRAMA sometimes. I really get tired of the HYPOCRISY.
This entire site is walking a fine line, and all parties associated with it, so for respected members here to start pointing fingers just doesn't make sense to me.
Sorry Have a shroomy day.
|
mjshroomer
Sage
Registered: 07/21/99
Posts: 13,774
Loc: gone with my shrooms
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: EonTan]
#3762945 - 02/10/05 04:42 PM (18 years, 1 month ago) |
|
|
EonTan said
Quote:
You did not bring Magic mushrooms to the awarness of interested minds in the modern world.
No, R. Gordon Wasson, Richard Schultes, Blas Pablo Reko, Albert Hofmann and Roger Heim did and then that was followed by Timothy Leary, Andrew Weil, Steven Pollock and Jonathan Ott in their writings of the shrooms in the early 1970s, and then it was Andrew Weil, who, through his writings for the Harvard Crimson, alerted the board of regents at harvard to become aware of Leary's drug activities, eventually leading to the firing of Leary and Richard Alpert from Harvard for their failure to attend their classes and for failing to stop giving drugs to undergraduate students.
Leonard Enos wrote the first major pamphlet (1000 Copies) in the early 1970s for identifying psilocybe species in the PNW of the USA, using information taken from Rolf Singer and Alexander H. Smith's short psilocybe monograph published in Mycologia vol 50 in 1958. Enos 1973 book sold one thousand copies in the PNW in the early 1970s.
My first edition of magic mushrooms (2,000 books) sold out in less than months in 1976 and was distributed by Homestead Book Co. And it was my spores and those fo bob harris which made Homestead the longest seller of spores in High Times wiht a full page ad. They are still selling spores.
And then the 2nd edition of MMOTPNW sold ten thousand copies by the fall of 1978.
Then published the Safe-Pik shroom id Poster seen in the image here with me and R. Gordon Wason In San Francisco in 1978:
 After the poster (1,000 copies), Cards (1,000 sets) and the book (3,000 copies sold)
And as I noted my nagic Mushrooms of the PNW is still in print and selling well.
In fact It has sold mroe than 100,000 copies in less than 29 years. It has out sold more copies than Paul's Psilocybe mushrooms and their Allies (20,000 copies), and his Psilocybine Mushrooms of the World (10,000 copies) of his first printing and first editions are still for a sale at amazon and have not sold out the first printing run yet.
As for PF, Billy is a friend of mine and just gave me exclusive rights to post his PF tek in my Mushroom Cultivation History CD-ROM. Of course his methords were all improvements of: Kneebone, L. R. 1960. Methods for Production of Certain Hallucinogenic Agarics. Abstracts Dev. Ind. Micro. Vol. 1: 109. Kneebones paper on agaricus cultivation was incorporated into the PF tek and PF created spore syringes which were already in use for years by commercial shroom growers. PF also expounded on the cultivation works of Steven H. Pollock's cultivation methods and those of Jeremy Bigwood and Jonathan Ott who in their 1978 book published an artickle with step-by-step photos of simple cultivation using a syringe. This appeared in the book, "Teonan?catl; hHllucinogenic Mushrooms of North America (The proceedings of the Hallucinogens and Shamanism in Native American Life Conference)".
 Who published the method before PF published the spore syringe method in his tek which became the signiture of the PF tek.
Here is a picture from that publication"e

And I have known PF since the mid 1970s. He visited my home on a few ocassions.
And I also have been one who has provided more than a million spore prints to the worldwide-spore market during the last 30 years.
Paul Stamets once introduced me at a conference as the man who picked more mushrooms than anyone he has ever known.
I have always, all of my shrooming life, always talked openly everywhere about the mushrooms and other drugts. and sometimes people get paranoid of the way i talk about openly about such things. Well this is me and who I am and I have been that way and am not about to change. What I do has never gotten anyone in trouble and other peoples paranoia is not my paranoia. I have none. I am not ashamed of what i do or what i say And I would die for my right to do what I do. I believe in myself and I will stick up for those rights unitl i am dead and gone.
If something makes you feel good, hiding it is very hypocritical to a point.
Caution is fine, but no pearanoia for something that makes me feel good and shrooms are something I have enjoyed doing all of my life and being myself is me.
This cacti thing is for real. They are looking at many plant substances right now. AS you knon, every year someone creates a new drug or every decade a new drug becomes popular.
Salvia is slowly be made illegtal in many states.
Adn while most police do not know what cacti may look like. That does not mean they won't bust you for them.
mj mj
|
Psiloman
member

Registered: 04/11/03
Posts: 1,116
Loc: Europe
Last seen: 9 years, 6 months
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: mjshroomer]
#3763362 - 02/10/05 05:56 PM (18 years, 1 month ago) |
|
|
It was said :
"A cactus, a cactus cutting, a cactus bud, a cactus skin, a cactus root, is still just a cactus. If the cactus itself is not illegal, then none of it's parts are except the mescaline itself. Unless these sites are selling extracted mescaline, they are not doing anything really different from the nursery selling cuttings, or seeds. Only if you can prove that there INTENT was to Sell the Drug inside the skins. Since their disclaimer is they are for incense and not consumption, I don't see how there is a difference."
Yes,from a point of view this is right. How come though all those "incenses" in the ethnobotanic stores are psychoactive if ingested or smoked? Well, if indeed the shroomery community and teenagers in here know that those incenses are..."incenses" that ARE psychoactive ,then i cant help but mention the obvious : DEA also knows about it. This whole "intent" and "incense" thing is just a "window" in the legislation that DEA is aware of and if this agency wants it they can close it once and forall by passing a simple law such as "Any plant,funghi,biological material,extract or preperation that contains any controlled susbtance is deemed illegal no matter what the intent of supply or possesion is and the penalty is the same that the controlled substance carries"
Finito la Musica ,Passato la Fiesta! (Well at least we can TRY not to taunt the DEA by making san pedro available in a more "ready to use" form...Maybe what keeps san pedro popularity relatively low is all this goo and peeling that one has to go through...)
but as you said
"As far as the feds go you are right, they will do what ever they want. "
Personally i do not condone calling the cops on these vendors.JUst scaring them a bit if they do not listen to reason....
Guys,many plants are going to get banned and deemed explicitly illegal.At least we can try to slow it down.While slowing it down try to plant those beauties in our garden and keep a viable stock arounde because...
NEWSFLASH!!!!!
Your favorite "ethnovendor"/smartshop/"incence seller" is not going to be around for ever....Guess who is plotting their downfall
(tip: It starts with a D ,the second letter could be E, and the last is A)
|
ShroomOmatic
Ethno Apprentice

Registered: 10/14/04
Posts: 2,373
Loc: Sailing the Seas of Chees...
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: spores]
#3763483 - 02/10/05 06:16 PM (18 years, 1 month ago) |
|
|
Not to much longer before the gov takes away all of your stuff..
--------------------
|
Psilocybeingzz


Registered: 12/15/02
Posts: 14,463
Loc: International waters
Last seen: 10 years, 4 months
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: biglo]
#3764958 - 02/11/05 12:47 AM (18 years, 1 month ago) |
|
|
"It's not like the police can identify every "illegal" plant on the planet, we just need to privately cultivate and spread such plants to preserve them. The Indians of South America and Mexico preserved this information for generations under Spanish rule, and so must we, and hope for a time when people become more sensible. Till then we must preserve and fight for change."
 A very good point(hell your whole post was good )
|
Fluxburn
.


Registered: 10/22/04
Posts: 2,216
Loc: Oakland, CA, USA
Last seen: 12 years, 4 months
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: Psilocybeingzz]
#4605919 - 08/31/05 09:23 PM (17 years, 6 months ago) |
|
|
eBay is located in CA. I remember when the search word LOPHORIA would bring up tons of stuff on ebay. I guess ebay found out the LOPHORIA was illegal in CA so they banned the word LOPHORIA. This happened last year sometime, the removal of the search in the US at least. Someone could easily bring it to ebays attention that people are selling a prepared form of a schedule one drug, since many idiots are selling cactus powder on ebay.
-------------------- ABSTRACT ART (Mine) http://nathanbelomy.com
|
wang_chung00
Stranger


Registered: 03/13/04
Posts: 222
Loc: almost nyc
Last seen: 7 years, 12 days
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: Fluxburn]
#4605924 - 08/31/05 09:24 PM (17 years, 6 months ago) |
|
|
lophophora?
-------------------- "The Edge... there is no honest way to explain it because the only people who really know where it is are the ones who have gone over." ~HST
|
Psychoslut
The Mother Fucking Bear-o-dactyl

Registered: 12/10/02
Posts: 20,914
Loc: all up in ya
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: mjshroomer]
#4606028 - 08/31/05 09:43 PM (17 years, 6 months ago) |
|
|
I uderstand your point mj. But since when did laws stop any of us from doing anything ?
--------------------
[quote]KristiMidocean said: Good now thats clear.WHO FUCKING CARES. If I am fat u all keep pointing it out like its suppose to be a secret.LIke u really have nothing better to do then make fat jokes. If o know its like I do I know yall can come up with NEW AND BETTER SHIT . This shit is old and boring . I left in the first place cause this shit got boring not because of the fat jokes . Fat jokes dont bother me but seriously its old[/quote]
|
Koala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: Psychoslut]
#4606231 - 08/31/05 10:18 PM (17 years, 6 months ago) |
|
|
True, but why escalate it so quickly?
"The Indians of South America and Mexico preserved this information for generations under Spanish rule, and so must we, and hope for a time when people become more sensible. Till then we must preserve and fight for change."
We'll be better able to preserve it as we all begin to grow it, whatever your purpose. Ordering dried stuff from peru, where it's harvested from the wild in bulk, will surely turn people on, but not spread the plant for when the dreaded day comes.
-------------------- You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!
|
Asante
cat door for divine love


Registered: 02/06/02
Posts: 84,095
Loc: Omnicyclion
Last seen: 4 hours, 8 minutes
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: mjshroomer]
#4607228 - 09/01/05 06:41 AM (17 years, 6 months ago) |
|
|
Quote:
provided more than a million spore prints to the worldwide-spore market during the last 30 years.
I think barely 1 in 100 who read that realized what this means to the movement. Perhaps you yourself don't even fully realize it. Bless you 
About the cacti, you're absolutely right.
You are legally allowed to own and walk a dog. The moment that dog dies it becomes a cadaver, legally. You are not allowed to drag a cadaver through the streets. Legally it is not a dog anymore when it has died.
You might get away with growing beautiful poppies. The moment the poppyheads are harvested and put in a vase they become a substance containing morphine. That is contraversial but if you harvest Opium you are definately and to all courts crossing the line.
A cactus is a cactus. But if you dry it and crumble it up you have got "a substance containing mescaline".
Damn, people A San Pedro grows easily from seed. It doubles in mass every year. You can get away with neglecting it for MONTHS and it will probably be OK. In a few years every trip you make can be a kosher dose of this fine entheogen, grown in your livingroom. How hard can it be?
But then again this is the Garden Forum, so I'm preaching to the choir
-------------------- YE OLDE CLICK-O-RAMA FEST ASANTE'S PREPAREDNESS 101 Get 1 month's supplies in case of illness or calamity and help loved ones.
Strengthen your friendship ties - and exchange more favors and advice ! OMNICYCLION SUPPORT TICKETS STORE SPONSORS/VENDORS TREES OMNICALCULATOR CULTIVATE!! DISCORD REDDIT FACEBOOK please help the teachings of The Omnicyclion reach a wider audience
thank you for volunteering your efforts towards this mind (r)evolution PAXG: 0x52e54ca2780894ea3f839ca0904be2c319c813e9 what's paxg?
|
Young_but_cool
Stranger


Registered: 08/16/02
Posts: 1,726
Loc: Old Europe
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: Asante]
#4607317 - 09/01/05 08:12 AM (17 years, 6 months ago) |
|
|
Quote:
You are legally allowed to own and walk a dog. The moment that dog dies it becomes a cadaver, legally. You are not allowed to drag a cadaver through the streets.
Haha, wonderful analogy!
|
stvip
Strange stranger
Registered: 03/21/05
Posts: 195
Loc: Israel
Last seen: 16 years, 2 months
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: Young_but_cool]
#4612715 - 09/02/05 02:07 PM (17 years, 6 months ago) |
|
|
The issue isn't so clear-cut. Morning Glories and Sen Pedro are also popular as ornamental plants. Outlawing the plants themselves is likely to cause much public backlash, and would be frought with difficulties in execution. Even enforcement of the illegality of the most notorious P. somniferum isn't enacted, except in extreme and obvious cases of large-scale operation. Lastly, outlawing organisms which contain illegal substances is inherently illogical. That the US and UK justice system have allowed this to occur with psilocybin bearing mushrooms is testimony to their myopia, for if this law were applied in earnest and equally, a great percentage of the animal kingdom, with the notable inclusion of possibly all mammals (including H. sapiens) would have to be illegalized. It is not a tenable general policy. A counterargument would run that neither is the rest of the current drug policies of most nations. This is true, but it has a lot to do with public aquiescence due to passionate, mendacious and effective propaganda. The public at large will view illegalization of an exotic, inedible mushroom quite differently than that of one of their more popular vine and cactus.
Ultimately, it is the media which will decide the fate of these preparations, as well as that of currently unscheduled ethnobotanicals. The DEA, even in its recent mention of kratom, seems very lenient and unalarmed about the "ethnobotanical" phenomenon (whose popularity has risen sharply due to the Internet), even in the face of an addictive mu opioid agonist. Kratom, for example, will be outlawed shortly after a major newspaper runs horror stories, preferably concerning a celebrity; probably not before that.
Lastly, I do not view it kindly that people are considering threatening international vendors over grievances of laws specific to their own country.
|
Koala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: stvip]
#4613042 - 09/02/05 03:33 PM (17 years, 6 months ago) |
|
|
I don't believe any cacti should be illegal. Nor do I believe many other plants and fungi should be. But I think if the dried skins were made illegal, it would clean things up a bit. Obviously I don't want anyone getting in trouble, but it's too easy for a kid to order a kilo or two of dried skin from the internet. (And stvip who mentioned the media: Kilo, mescaline, minors, and internet are *very* bad buzz words for the media)
I think the "cracking down" of dried skin before things escalate any more could save the plant it self. So would just not selling the skins, but business is business. (believe me, I'd like nothing more than a ton of the stuff to save me a few years of killing any green friends, if I choose to participate in the substance).
It's not easy to have a cacti farm capable of producing enough to be a drug dealer. Most people wouldn't be interested. Especially with the slow growth rate. The stuff sold as incense mostly comes from 'wild' cacti in peru. It's a major source. Probably one of the only ones capable of moderatly large enthogen sales. I doubt even the larger US live pedro dealers have what icaro has access to.
-------------------- You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!
|
Psiloman
member

Registered: 04/11/03
Posts: 1,116
Loc: Europe
Last seen: 9 years, 6 months
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: Koala Koolio]
#4613205 - 09/02/05 04:20 PM (17 years, 6 months ago) |
|
|
Quote:
I don't believe any cacti should be illegal. Nor do I believe many other plants and fungi should be.
I believe everyone agrees with you my friend,hence we are members of the Ethnobotanical Garden. Growing plants is a passion.Growing "special" plants that possess CNS affecting qualities of the highest caliber (and allow me to say of the most interesting quality) such as those containing entheogens,is more of a passion a fixation.And to say that they arent beautifull? Such beauty in those plants,im eagerly waiting my Pachanoi to flower and then take text book quality pictures of its blossoms!
Personally,i believe that each grower of those plants ,each person interested in them should try to put its pebble against the criminalisation of those lifeforms (well could one techically propose homo sapiens as a DMT containing species and watch legislation chaos unfold?). I grow lots of legal plants (due to law threatening to take my life away in many ways if i do otherwise) and urge other people to do so.
My thought is : One must have a source to start cultivating those plants. Pachanoi,anandenanthera species,argyreia nervosa, all have to come from somewhere,they dont magically appear in our hands. But how can we balance the availability of such sources ,such as a ethnobotanical supplier that quite upfront all the species he sells are psychoactive (and thus can be in legal danger), with an ethical ethnobotanical market that will have a viable future so people will continue growing these plants (and why not experiencing them,if they choose so taking into account the responsibility arising from such use)?
That is the trick question! Of course, vendors must make some money they are not doing it "just because" ,although there are many of them which with their offers make you understand that they want you to spread those plants and grow them (such as a lot of gifts in every order,and much more of the product that you initially asked for).And of course,some people will ask to experience those plants,hence the popularity of dried,even powdered speciments which almost approach the "just add water" principle.
What can we ,as concerned growers or afficionados of those plants, do to ensure the best propable future for those plants?
Any viable ideas ,anyone?
|
InjectTruth
Wasting my Time,Waiting for theEnd


Registered: 10/05/03
Posts: 778
Loc: New Jerusalem
Last seen: 1 month, 19 days
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: Psiloman]
#4635916 - 09/08/05 10:09 PM (17 years, 6 months ago) |
|
|
To: comments@salviasupply.com Subject: Are you serious? Date: Thu 09/08/05 08:41 PM Attachments Name Type Save View Message text/html Save
Let me say thank you in advance for your help getting Salvia placed on Schedule I of the Controlled Substances Act.
I have seldom seen a more deplorable showing of greed and ignorance. Are you not aware that Salvia is being watched by the DEA, and is mentioned in their periodical, The Microgram? Are you not aware that selling Hawaiian Woodrose seeds AS DRUGS is as illegal as selling certain prescriptions on the black market, and selling Peruvian Torch is as illegal as selling HEROIN? The "Dealer" Package? I can't believe I even have to explain this to anyone.
If you had half as much respect for these plants as your "Mexican of proper bloodline", you wouldnt be hocking them in "mind bender" or "party package" assortments for 100x the cost. Do you really think Amanita Muscaria is a cure for "boredom"? "Recently, Salvia d. has become very popular in the modernized world as a psychedelic to replace more dangerous and illegal substances such as DMT and LSD." LSD and DMT, dangerous? Who's side are you on? DMT is already in every human being, and LSD is one of the most NON TOXIC substances known to man. And if DMT is so dangerous, why do you sell it in the form of ayahuasca?
I am aware that many other sites sell these same items, however they dont sell them TO CONSUME!!! Not only do you EXPLICITLY advertise them as for consumption, you have VIDEOS OF STUPID COLLEGE KIDS GOING , "OH MY GOD! I CANT FUCKING BELIEVE IT, IM FUCKING TRIPPIN DEWD!"
Way to go, chief.
-------------------- On a personal level, Freaking Out is a process whereby an
individual casts off outmoded and restricting standars of
thinking, dress, and social etiquette in order to express
CREATIVELY his relationship to his immediate environment and
the social structure as a whole.
http://www.OrganicPharming.com - Ethno Shopping Portal
|
stvip
Strange stranger
Registered: 03/21/05
Posts: 195
Loc: Israel
Last seen: 16 years, 2 months
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: InjectTruth]
#4636451 - 09/09/05 12:05 AM (17 years, 6 months ago) |
|
|
In the case of divinorum, I don't believe it matters much how it is marketed, and whether or not human consumption is implied, except that products intended for human consumption are supposed to be regulated by the FDA. But that's a different topic, and I would actually welcome FDA inspections of the plant material sold by various vendors. The DEA is fully aware that every divinorum product sold is sold for human consumption; if it were illegal, that disclaimer would not fool them (it would make a difference if prosecutions were pressed, but then the risk lies with the vendor for such labeling and advertisements). Since it is legal, there's no reason, except the FDA liability (in the US, anyhow - probably similar laws with equivalent agencies worldwide), for vendors not to suggest human consumption. I highly doubt it makes a difference for lawmakers. This is quite distinct from the case of mescaline bearing cacti "incense". Labeling issue aside, the method of advertisement does do a disservice to the legality of divinorum, as it is likely to attract negative media attention, as well as encourage improper use.
Anyhow, a dire, disgusting update: there are rumors that "research chemicals" suppliers are about to make 7-hydroxymitragynine commercially available. This would be the first MOR agonist easily available since the Analogue Law, and a rather potent one at that (several times the potency of morphine, with far better oral bioavailability). Whereas the DEA Microgram mentioned kratom almost favorably, this will surely rapidly lead to Mitragyna speciosa and its alkaloids being outlawed.
|
Psiloman
member

Registered: 04/11/03
Posts: 1,116
Loc: Europe
Last seen: 9 years, 6 months
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: stvip]
#4637971 - 09/09/05 01:16 PM (17 years, 6 months ago) |
|
|
Quote:
Since it is legal, there's no reason, except the FDA liability (in the US, anyhow - probably similar laws with equivalent agencies worldwide), for vendors not to suggest human consumption.
Quote:
Anyhow, a dire, disgusting update: there are rumors that "research chemicals" suppliers are about to make 7-hydroxymitragynine commercially available. This would be the first MOR agonist easily available since the Analogue Law, and a rather potent one at that (several times the potency of morphine, with far better oral bioavailability). Whereas the DEA Microgram mentioned kratom almost favorably, this will surely rapidly lead to Mitragyna speciosa and its alkaloids being outlawed.
I hear you and what you say is true.I always though am intrigued by how many people/vendors like to push it to the limits.
Let me bring out the Dog and Fence analogy.
We have a dog (users/vendors) on a field with a fence (law) at 5 meters from the doghouse and its 1 metre tall. This is done to contain to dog ad to secure it in this space.It certainly is up to the person putting the fence (Law Agencies) how close to the dog he/she is gonna put it and how tall its gonna be.BUT...the silly dog keeps trying to use all the 5 metres of radius ,not only that its climbing ON the fence up to its one metre and sticking its paws out of the fence. Yes,this could be a Good reason for the Fence putter to put it to 3 metres space and raise it to 2 metres high.And i betcha the dog will try AGAIN climbing the fence not learning from past mistakes and the fence putter is gonna move the fence to 1 metre from the dog and make it 5 metres tall.And the dog,if given the chance will continue its mistake ,as if asking to be put on a cage for a maximum confinment.
Thats more or less what happens...Sometimes vendors are given 3 metres of freedom and they manicly try to exploit it down to the last,furthest picometer! Give em free ephedra and they will pull out all kinds of party pills with it! Give em whatever loose laws and they wont just try to go through the "legislation window" they will tear it down trying to fit an elephant through it!
So...What could one done? If we say that the dog is the vendors wouldnt it be wise in the first case to put a leash around it so it naturally confines it to 4 metres ,to be sure that it wont go jumping up and down on the fence provoking the fence putter?
We have the money they are after,we are the ones that have the leash,now lets put an end to this rabbies(ish).
|
Psilostylin
Captain Save Em'
Registered: 03/13/04
Posts: 678
Loc: New Orleans!
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: Psiloman]
#4638807 - 09/09/05 04:41 PM (17 years, 6 months ago) |
|
|
it's only a matter of time before all sacred ethnogens are a jailed memory. and yes it is the childish and the greedy that are paving this road. the pimping of these substances needs to be significantly reduced. do you really need a video to show you how to light a bowl? and what makes you think you respond the same as the morons in these videos? what i saw when i watched these videos was a very disrespectful marketing technique.... "this stuff really does Fuck you up! lokk how crazy it is!! whoa!" this is flat out disgusting. people are using these sacred treasures with the mentality of a cocaine junky. research and take a look at how the native americans used these substances. there is a great difference. if you can't comprehend this difference, you have no buisness even considering using such substances. take peyote for example, the natives considered this to be the most magnificent of all the world's gifts. they regarded the buttons of the peyote cactus as 'The Flesh of God.' they held these tiny cactus buttons with the same respect a catholic would the Eucarist (sp.?). that is a massive difference to a young white boy looking to get stoned on a saturday night. i have always shook my head at the filthy representation of these beautiful substances... wheter it be mimosa hostilis, psilocybin mushrooms, san pedro cactus and even marijuana. if you really have an interest in using san pedro cactus, read some books. do some research as to how it should be used to better you're life, not as a means to escape it. the beauty of the san pedro cactus needs to stop being raped by the ignorent, the childish, and the greedy. it was not put here for this reason. if you can't even make the sacrafice of offering your time in a proper preparation and need a quick form of "fuck me up" then you are in no way mature enough to experience such greatness. you will gain no enlightenment from your Creator if you endanger one of the greatest gifts He has ever bestowed upon you. cut out the bratty behavior and check the situation... if you keep up the abuse then this gift will no longer be.
|
Openminded
Dicotyledon

Registered: 08/28/03
Posts: 657
Loc: England.
Last seen: 5 years, 2 months
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: Psilostylin]
#4639126 - 09/09/05 06:05 PM (17 years, 6 months ago) |
|
|
I really think that anyone who possibly can should plan a few years in advance and grow their own. This means everyone in CA and other nice sunny places. Even if you don't have a garden of your own that you can use, you can get two feet of pedro, cut it into 2-3" sections, let them heal and form roots at home, and then plant them out somewhere. I'm sure everyone with the right climate could find somewhere suitable if they looked around for a bit. In a few years you could have MASSES growing, more than enough for personal use. And if you have your own place and are willing to risk it, it would be easy to become self-sufficient in peyote in three years. I know this isn't going to do any good about bad vendors, but at least you won't have to use them .
|
Koala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: Openminded]
#4639190 - 09/09/05 06:22 PM (17 years, 6 months ago) |
|
|
I can't imagine just planting it "somewhere" would work too well.
That'd likely just get it snatched by some kid, for a quick snack. As one kid just demonstrated in the psychedellic experience forum (or whatever it is, the top sub-section), many people have no shame in stealing it right out of someone's yard even.
As far as "A cactus, a cactus cutting, a cactus bud, a cactus skin, a cactus root, is still just a cactus. "
Yes, this is true. But I've seen dried skins in microgram at least twice. I've seen live plants zero times. Perhaps they're in there somewhere, but I've never seen them.
-------------------- You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!
|
Ekstaza
stranger than most


Registered: 04/10/03
Posts: 4,324
Loc: Around the corner
Last seen: 1 hour, 5 minutes
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: Psilostylin]
#4648717 - 09/12/05 12:03 AM (17 years, 6 months ago) |
|
|
Quote:
Psilostylin said: it's only a matter of time before all sacred ethnogens are a jailed memory. and yes it is the childish and the greedy that are paving this road. the pimping of these substances needs to be significantly reduced. do you really need a video to show you how to light a bowl? and what makes you think you respond the same as the morons in these videos? what i saw when i watched these videos was a very disrespectful marketing technique.... "this stuff really does Fuck you up! lokk how crazy it is!! whoa!" this is flat out disgusting. people are using these sacred treasures with the mentality of a cocaine junky. research and take a look at how the native americans used these substances. there is a great difference. if you can't comprehend this difference, you have no buisness even considering using such substances. take peyote for example, the natives considered this to be the most magnificent of all the world's gifts. they regarded the buttons of the peyote cactus as 'The Flesh of God.' they held these tiny cactus buttons with the same respect a catholic would the Eucarist (sp.?). that is a massive difference to a young white boy looking to get stoned on a saturday night. i have always shook my head at the filthy representation of these beautiful substances... wheter it be mimosa hostilis, psilocybin mushrooms, san pedro cactus and even marijuana. if you really have an interest in using san pedro cactus, read some books. do some research as to how it should be used to better you're life, not as a means to escape it. the beauty of the san pedro cactus needs to stop being raped by the ignorent, the childish, and the greedy. it was not put here for this reason. if you can't even make the sacrafice of offering your time in a proper preparation and need a quick form of "fuck me up" then you are in no way mature enough to experience such greatness. you will gain no enlightenment from your Creator if you endanger one of the greatest gifts He has ever bestowed upon you. cut out the bratty behavior and check the situation... if you keep up the abuse then this gift will no longer be.
Even here at a place of supposedly open mindedness we have people insisting that everyone have the same views and spiritual beliefs.
-------------------- YOUR EXPERIENCE WITH ANY GIVEN DRUG ISN'T THE DEFINITIVE MEASURE OF THE DRUGS EFFECTS.
|
Psiloman
member

Registered: 04/11/03
Posts: 1,116
Loc: Europe
Last seen: 9 years, 6 months
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: Ekstaza]
#4649208 - 09/12/05 03:38 AM (17 years, 6 months ago) |
|
|
Let aside spiritual beliefs for a moment.
Do you think that the majority of the "i wanna be continuously fucked up,weekends is a drug fuckfest for me" crowd would ,if having knowledge of those e-shops, use them all the time compared to the majority of the people that think that spiritual and/or psychological work is capable with them?
Its not a prerequisite having the same beliefs,or forcing one to use the spiritually. Logical thought though with a "view on the future of now semilegal psychoactives" is something easily blinded by the passion of "lets get high" .That is not to mean that some "spiritual" or "self analysis" people might not abuse the ease of finding those items online.Its just a matter of perspective.
For example if i ,for whatever reasons (spiritual,psychological whatever) utilise psychoactives rarely because thats how i taught myself to be ,i am going to cause less of an "order havoc" on those shops,attract less custom attention,attract less post office attention and receive significantly less "suspicious packages" that lets say DEA could intercept than someone that HAS TO trip every weekend,or someone that HAS TO smoke,eat,snort,drink anything psychoactive for the day to be worth while. And SIMPLY BY RULE OF PROPABILITY and NOTHING ELSE ,chances are far less that someone is going to pull me over and find X amounts of Y types of drug in my car if i do it once a year than someone whose car/house/everything is "full of drugs".
So we may bring it down to having to do nothing with "gettingfuckedup" use,nothing with "spiritual" use,nothing with ala Stanislav Groff "Self psychoanalysis" use but with mentality of use and/or shortsightness of some individuals.
Dont get me wrong,but isnt a "recreational user" that lives a "drug lifestyle" more prone to continuous orders from those shops,especially preffering "easy forms" (he just wants the drug,and cactus powder is super easy!) that other kind of users?
No offence to anyone,but apparently DEA has noticed the trend ,and the shops...well...they dont seem to give a fuck
|
stvip
Strange stranger
Registered: 03/21/05
Posts: 195
Loc: Israel
Last seen: 16 years, 2 months
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: Psiloman]
#4649311 - 09/12/05 07:26 AM (17 years, 6 months ago) |
|
|
Everytime you take a walk (with your dog on leash, alive or as a carcass), there's a chance a car will have to swerve to avoid hitting you, causing an accident. By the simple law of probability, the more you ambulate outside, the more you endanger innocent drivers. Conclusion: avoid walking. People have the intrinsic right to ingest mescaline, despite the laws of the moment in most countries (which usually contradict these same countries' various charters). There's no reason to believe selling "incense" will lead to legislation against the plants themselves. At most, measures will be taken against the vendors, possibly (but not probably) against customers. (comparisons to Psilocybe mushrooms in the UK are frivolous, the situation is very different) Such action, if it will occur, will probably be the result of someone doing something stupid while under the influence of mescaline (and all the other alkaloids and non-alkaloidal compounds present in cacti), in a manner that catches media attention. Lastly, if a vendor is operating outside the US, what right do US citizens have to tell them how to run their business due to their own single country's drug laws? All that said, I still dislike the practice, since the "ethnobotanical" community should attract as little attention as possible to itself right now. Later, when there are more diversity, sources, organization (the item most direly lacking right now) and potency of substances, we can make more noise.
|
crusher101
member

Registered: 08/05/04
Posts: 158
Last seen: 16 years, 11 months
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: stvip]
#4654638 - 09/13/05 11:30 AM (17 years, 6 months ago) |
|
|
im... kinda confused here. if you dont like vendors doing that then why does shroomery support them. psycoactive herbs sells torch and most other cacti dried...
|
Psiloman
member

Registered: 04/11/03
Posts: 1,116
Loc: Europe
Last seen: 9 years, 6 months
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: crusher101]
#4656153 - 09/13/05 05:15 PM (17 years, 6 months ago) |
|
|

Exaxtly 
Short answer : Noone is immune to monetary benefits.
Long answer: I will let a mod fill this in
|
veda_sticks
Cultivator




Registered: 07/29/07
Posts: 14,191
Loc: UK
Last seen: 3 years, 2 months
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: InjectTruth]
#7448182 - 09/24/07 03:53 PM (15 years, 6 months ago) |
|
|
"LSD is one of the most NON TOXIC substances known to man."
I have to disagree with this, well atleast in wot u regard as in toxic. If u mean as in it could kill u, then maybe. But on how it could affect u.
There are lots of "casualties" of psychedelics and other drugs.
1 majour thing i heard of where i live, that a dealer of lsd realised that he was about to be busted, rather than get cought with his sheets his blotters consumed the entire lot before he had his door busted down.
Ever since he has been permantly tripping. This was several years ago.
there is not enough research into alot of drugs to really determine exactly wot toxic properties they may or maynot possess.
I really believe that drugs that are proved to have no physical dependance be legilised, but under strict control.
However this could be very hard, as even with alcohol and nicotine. Its still proving very hard to enforce.
As a first step, i would still thing that taking drugs of the black market would a great step, even if it cost just a little bit more.
I occasionaly like E, but hate how sometimes u get some that give wot u expect of E, (general well being, ephoria, everything great) then u can get something similar but more wired (last time i new i had definatly had some form m) but it was very wired and at some point i thoiught i was so high i would pass out and i dint sleep for over 24 hours after4 taking them.
If u got them from a manufacturer that was under strict control then atleast u were guarenteed that u got the same everytime and it wasnt something that mimiced wot the real thing was.
On a side note i tried to legal version (bzp tmtfp) and they were horrible, felt ill for 2 hours, then got mild effects and had the worst hangover ever the next day. (1 produced almost no effects, 2 produced ilness for 2 hours and a few hours of miled real pill and horrible next day)
-------------------- PF TEK - writeup by EvilMushroom666
Lets Grow Mushrooms - RogerRabbit & RoadKills website with sample videos plus the full PF TEK video series. Alot of great information - BUY THE DVD
Cakes can and will pin! - So you think cakes suck for pins. Your wrong
Franks Simple Coir/Verm Tek Franks Proper Pasturisation Tek Franks Spawning To Bulk - Monotub Professor Pinheads RTV Injection Port Tek Foo Mans No Soak WBS Prep Tek
|
royer
±±±±±±±±±±


Registered: 05/15/06
Posts: 4,801
Loc: anywhere but here
Last seen: 4 years, 1 month
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: veda_sticks]
#7448301 - 09/24/07 04:36 PM (15 years, 6 months ago) |
|
|
you just brought back a thread that has been dead for 2 years to say you disagree
-------------------- =================================================
if you have any questions please feel free to pm me , thx :-)
|
Dr. uarewotueat
Peyote Farmer


Registered: 09/02/06
Posts: 16,545
Loc: Uk / Philippines
Last seen: 9 years, 8 months
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: royer]
#7448330 - 09/24/07 04:48 PM (15 years, 6 months ago) |
|
|
lol and wot the hell does it have to do with vendors who sell dried pedro skins...
-------------------- View My Gallery
|
blazed123
Bing

Registered: 10/21/04
Posts: 831
Last seen: 12 years, 5 months
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: Dr. uarewotueat]
#7448411 - 09/24/07 05:17 PM (15 years, 6 months ago) |
|
|
Lol. I remember when this thread was new. You found this at the bottom where it says "related threads," didn't you?
|
2859558484
Growery is Better



Registered: 01/10/06
Posts: 8,752
Last seen: 2 years, 6 months
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: blazed123]
#7448771 - 09/24/07 07:00 PM (15 years, 6 months ago) |
|
|
mj was such a douchebag
--------------------
|
implee
Cyber Hippie


Registered: 07/27/06
Posts: 5,833
Loc: Houston, Texas.
Last seen: 4 months, 13 days
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: 2859558484]
#7450067 - 09/25/07 12:08 AM (15 years, 6 months ago) |
|
|
|
Psilobuds
₪


Registered: 03/23/07
Posts: 1,775
Loc:
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: veda_sticks]
#7450129 - 09/25/07 12:35 AM (15 years, 6 months ago) |
|
|
Quote:
veda_sticks said:
1 majour thing i heard of where i live, that a dealer of lsd realised that he was about to be busted, rather than get cought with his sheets his blotters consumed the entire lot before he had his door busted down.
*cough cough* Bullshit *cough cough*
|
TurntableJunky
Ethno Grower



Registered: 04/26/07
Posts: 4,742
Loc: Sydney
Last seen: 14 years, 11 months
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: stvip]
#7450132 - 09/25/07 12:36 AM (15 years, 6 months ago) |
|
|
Do you know you just bumped a 2 year old thread?
--------------------
|
Locus



Registered: 03/11/04
Posts: 6,112
Last seen: 2 years, 4 days
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: TurntableJunky]
#7450172 - 09/25/07 12:53 AM (15 years, 6 months ago) |
|
|
--------------------
The important thing is not to stop questioning. Curiosity has its own reason for existing. One cannot help but be in awe when he contemplates the mysteries of eternity, of life, of the marvelous structure of reality. It is enough if one tries merely to comprehend a little of this mystery every day. Never lose a holy curiosity. ~ Albert Einstein
"Fear is the great barrier to human growth." ~ Dr. Robert Monroe
~~~*Dosis sola facit venenum*~~~
*Check my profile to listen to my music*
|
thedudenj
Man of the Woods

Registered: 08/18/04
Posts: 14,684
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: canid]
#7450271 - 09/25/07 01:42 AM (15 years, 6 months ago) |
|
|
yeah those are drug dealers straight up
--------------------
  "You all are just puppets... You have no heart...and cannot feel any pain...""
you may think thats pain you feel but you must have a heart to feel true pain and that pain wont be yours
|
Pledge2Educate
Der Pilzkönig



Registered: 09/13/07
Posts: 369
Loc: Central Florida
Last seen: 15 years, 5 months
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: mjshroomer]
#7450317 - 09/25/07 02:05 AM (15 years, 6 months ago) |
|
|
Straight up hustlers, eh?
-------------------- Enjoy my Posts? Rate Me
GGreatOne234 said: I've never come across a cow pasture in Florida that did not have No Trespassing signs. Those signs mean stay the f away.
|
thedudenj
Man of the Woods

Registered: 08/18/04
Posts: 14,684
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: Pledge2Educate]
#7450397 - 09/25/07 02:42 AM (15 years, 6 months ago) |
|
|
aye drug peddles they are probally gona get raided soon
--------------------
  "You all are just puppets... You have no heart...and cannot feel any pain...""
you may think thats pain you feel but you must have a heart to feel true pain and that pain wont be yours
|
Nalim
OTD Kelly Girl


Registered: 01/13/06
Posts: 15,033
Last seen: 5 months, 20 days
|
Re: WARNING: To Vendors who Peddle Dried San Pedro Skins [Re: mjshroomer]
#7450434 - 09/25/07 03:09 AM (15 years, 6 months ago) |
|
|
This thread has been closed.
Reason: Derailed and long dead thread.
|
|