Home | Community | Message Board


Vaposhop
Please support our sponsors.

Mushrooms, Mycology and Psychedelics >> The Ethnobotanical Garden

Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Amazon Shop: San Pedro, Scales

Jump to first unread post. Pages: 1
Offlinenunciate
Cold and Indifferent
Male User Gallery

Registered: 05/23/04
Posts: 904
Loc: Edge of the World
Last seen: 7 months, 8 days
Brief info on the origin of San Pedro sacrament
    #4601669 - 08/31/05 01:07 AM (12 years, 3 months ago)

My finding this article started innocently enough, but I feel I've learned something quite esoteric now.
I've be house-sitting some plants for a friend who is on vacation. In one of her pots she has a rock painted like a rabbit. I thought to myself that it would be cool to have something similar for my Pedros.
Knowing that they were used as a sacrament, I thought it would be good to look into which deity they were associated with and try to get an appropriate statue for my plants. That way I could bore people who don't care with a nice little story when they mistakenly ask "what's with the statue in the plant, dork?"
My first few searches turned up little, as no specific deity seemed to be associated with San Pedro prior to xtian times, but then I came across this. I'll warn you: It's pretty long. So if you're not into the history (and possible origin) of the usage of San Pedro, maybe the bottom half (or none of it at all) is all you need to read. Enjoy.

http://www.fuchsiashockz.co.uk/articles/wonders/the_temple_of_chavin_de_huantar.php

Quote:


Civilization, including pyramid-building, in Peru predates Egypt's Old Kingdom. Mike Jay visits the later mysterious temple complex of Chavin de Huantar, dating from around 900BC, and hazards a guess about its ritual uses.

The monumental ruins of Chav?n de Huantar, 10,000 ft (3,000m) up in the Cordillera Blanca of the Peruvian Andes, are - officially - a mystery. The vast, ruined granite and sandstone structures - cyclopean walls, huge sunken plazas and step pyramids - date from around 1,000BC but, although they were refashioned and augmented for close to 1,000 years, the evidence for the material culture associated with them is fragmentary at best. Chav?n seems to have been neither a city nor a military structure, but a temple complex constructed for unknown ritual purposes by a culture which had vanished long before written sources appeared.

The arch?ological consensus is that Chav?n was some kind of ceremonial focus; some have tentatively located it within a lost tradition of oracles and dream incubation. But the mystery remains profound, and is considerably heightened by the bigger picture that it represents. By most reckonings, and depending on how the term is defined, 'civilization' emerged spontaneously in only a handful of locations around the globe: Mesopotamia, the Indus Valley, China, Mexico, perhaps the Nile. To this short list, especially if civilization is defined in terms of monumental architecture, must now be added Peru. It was only in the 1930s that Chav?n was proposed to be some 3,000 years old, and it's only recently been recognized that huge ceremonial structures of sunken walled plazas, typically set at the foot of raised stone platforms and pyramids, were being constructed in Peru at least 1,000 years earlier. The coastal site of Caral, only now being excavated, turns out to contain the oldest stone pyramid thus far discovered, predating those of Old Kingdom Egypt. So, the mystery of Chav?n is not an isolated one: it was the flowering of a pristine and unique culture, and one which still awaits interpretation.

The emergence of Chav?n as a ceremonial centre, probably around 900BC, represents a far more complex construction than its predecessors, and one that adds to their unadorned ruins a spectacular new dimension of symbolic art. But these symbols were not designed for profane eyes. The only images visible from outside the temple complex would have been those which studded the walls: gargoyle-like, life-size heads, some human, some distinctly feline, with exaggerated jaws and sprouting canine teeth, and some, often covered in swirling patterns, in the process of transforming from one state to the other. This process of transformation is clearly a physical ordeal: the shape-shifting heads grimace, teeth exposed in rictus grins. In a specific and recurrent detail, mucus emanates in streams from their noses.

Inside these walls - now mostly crumbled, and with the majority of the heads housed in the on-site museum - there are still substantial remains of the ceremonial complex which was reworked and expanded for nearly 1,000 years, its last and largest elements dating to around 200BC. The basic arrangement is the traditional one of plaza and step pyramid, but Chav?n's distinctive, hallucinatory visuals seethe across the faced stone surfaces: lintels, columns and stel? are covered with relief carvings, swirling motifs featuring feline jaws, eyes and wings. The initial impression is amorphous and chaotic, but on closer inspection these motifs unfurl into composite images, their interleaved elements in different scales and dimensions, the whole often representing some chimerical entity composed of smaller-scale entities roiling inside it. As the architecture develops through the centuries, it becomes larger in scale, reflecting the increased size of the site as a whole; at the same time, the reliefs gradually become less figurative and more abstract, discrete entities melting into a mosaic of stylized patterns and flourishes.

It was only in 1972 that the most striking of these reliefs were uncovered, on faced slabs which line the oldest of the sunken plazas, running like a frieze around its circle at knee height. These figures are presumably from the site's formative period; the most remarkable is a human figure in a state of feline transformation, bristling with jaws, claws and snakes, and clutching a hallucinogenic San Pedro cactus (Echinopsis/Trichocereus sp.) like a staff or spear. Beneath this figure - the 'Chaman', as he's become informally known - runs a procession of jaguars carved in swirling lines, with other creatures, birds of prey and snakes, sometimes incorporated into the whorls of their tails.

These reliefs are all carved in profile, and all face towards the steps that lead up from the circular plaza to the old pyramid, at the top of which is the traditional altar-like platform. But at the back of this platform is a new element: a pair of stone doorways disappearing into the darkness inside the pyramid itself. Steps lead down into tunnels around 6ft (1.8m) high and constructed, rather like Bronze Age long barrows, from huge granite slabs and lintels. The tunnels take sharp, maze-like, usually right-angled turns, apparently designed to cut out the daylight and disorient, zig-zagging into pitch blackness. Opening out from these subterranean corridors are dozens of rock-hewn side chambers, some large enough for half a dozen people, others for only one. There are niches hacked in some of the chamber walls, which might have housed oil lamps, and lintels which extrude like hammock pegs. Running through the bewildering network of tunnels and chambers are smaller shafts - some of them air vents, others water ducts which allowed the nearby spring to gush and echo through this elaborately constructed underworld.

Right in the heart of the labyrinth is a stela carved in the early Chav?n style, a clawed, fanged and rolling-eyed humanoid form, boxed inside a cramped cruciform chamber which rises to the top of the pyramid. The loose arrangement of stones in the roof above, which form a plug at the crown of the pyramid, has led to speculation that they might have been removable, allowing the Lanzon, as the carved stela is known, to point up like a needle to a gap of exposed sky. Other fragments of evidence from the site, such as a large boulder with seven sunken pits in the configuration of the Pleiades, suggest that an element of the Chav?n ritual - perhaps, given the narrow confines around the Lanzon, a priestly rather than a public one - might have involved aligning the stela with astronomical events.

This plaza and pyramid was Chav?n's original structure, but over the centuries more and grander variants were added. There are several shafts, some still unexcavated, which lead down into larger underground complexes, their stonework more regular than the old pyramid and their side-chambers typically more spacious. There's a far larger sunken plaza, too, square rather than circular and leading up to a new pyramid and surrounding walls on a more massive scale. Whatever happened at Chav?n, the architecture suggests that it carried on happening for centuries, and for an increasing volume of participants.

The term most commonly applied to what went on at Chav?n is 'cult', although elements of meaning might perhaps be imported from other terms like pilgrimage destination, sacred site, oracle or, in its classical sense, temple of mysteries. This is a conclusion partly arising from the lack of any evidence that it represented an empire, or a state power: there are no military structures associated with it, nor centralized labour for major public works like irrigation or housing. During the several centuries of its existence, tribal networks would have risen and fallen, changes in the balance of power apparently leaving its source of authority untouched. Its cultic - or cultural - influence, though, spread far and wide. Throughout the first millennium BC, 'Chav?noid' sites spread across large swathes of northern Peru, and pre-existing natural huacas (sacred sites) began to develop Chav?n-style flourishes: rock surfaces carved with snaky fangs and jaws, standing stones decorated with bug-eyed, fierce-toothed humanoid forms. People were clearly coming to Chav?n from considerable distances, and carrying its influence back to far-flung valleys, mountains and coasts.

Was Chav?n, then, a religion? There's been some speculation that the carvings on the site represent a 'Chav?n cosmology', with eagle, snake and jaguar corresponding to earth and sky and so forth, and the humanoid shapeshifter, as represented on the Lanzon, a 'supreme deity'. But Chav?n was not a power base that could coerce its subjects to replace their religion with its own: the spread of its influence indicates that it drew its devotees from a wide range of tribal belief systems with which it existed in parallel. It's perhaps better understood as a site which offered an experience rather than a cosmology or creed, with its architecture conceived and designed as the locus for a particular ritual journey. In this sense, the Chav?n figures would not have been deities competing with those of the participants, but graphic representations of the process that took place inside its walls.

This process suggests a function for Chav?n's mysterious architecture: as a site where participants could enter a shared otherworld, and also submit themselves to a highly charged individual vision quest. The sunken plaza might, as the reliefs suggest, have harnessed the consciousness-expanding effects of the San Pedro cactus to a mass ritual of dancing and chanting. The participants might subsequently have ascended the temple steps, perhaps to receive a further plant sacrament: site finds include carved bone tubes typically used for taking a snuff of powdered DMT-containing seeds (Anadenanthera sp.), which produce a brief, intense hallucinatory trance accompanied by streams of mucus from the nose. At this point, the priests would lead them into the chambers within the pyramid where they could experience visions in solitary darkness. Here, the amplified rushing of water and the ecstatic sounds of the unseen participants around them would enclose them in a supernatural world, one where ordinary consciousness could be abandoned, the body itself metamorphosed like the shapeshifting heads on the temple walls, and the world seen from an enhanced, superhuman perspective - analogous, perhaps, to the uncanny night vision of the feline predator. The development of the subterranean chambers over centuries would reflect the logistical demands of ever greater numbers of participants willing to submit themselves to a life-changing ordeal that offered a glimpse of the eternal world beyond the human.





--------------------
I am the devil and I am just like you


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: Brief info on the origin of San Pedro sacrament [Re: nunciate]
    #4601859 - 08/31/05 01:56 AM (12 years, 3 months ago)

Excellent find! thanks for sharing


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleToolTroll
tourettic
Male User Gallery

Registered: 08/02/04
Posts: 2,326
Loc: N. Cack
Re: Brief info on the origin of San Pedro sacrament [Re: nunciate]
    #4605698 - 08/31/05 10:41 PM (12 years, 3 months ago)

Very interesting! Thanks. :thumbup:


--------------------
"This whole idea that different is bad, that a change in consciousness is in itself harmful, is really one of the fundamental problems inherent in the drug war.” - Rick Doblin
my cactus collection
You vote with your dollars. Everyday. Vote responsibly.


Post Extras: Print Post  Remind Me! Notify Moderator
Jump to top. Pages: 1

Amazon Shop: San Pedro, Scales

Mushrooms, Mycology and Psychedelics >> The Ethnobotanical Garden

Similar ThreadsPosterViewsRepliesLast post
* drying san pedro iamTheOne 2,169 10 10/20/03 11:07 AM
by Hermes_br
* san pedro outdoors Audi0 1,012 6 04/08/04 12:24 AM
by Psilygirl
* San Pedro Pups Acaterpillar 1,457 15 05/15/09 10:17 PM
by ethnoguy
* Peyote vs. San Pedro
( 1 2 all )
stinkybritches 6,956 33 10/15/08 05:49 PM
by ethnoguy
* San Pedro by the Kilo Kavatar 2,842 12 10/28/04 03:27 PM
by esin
* cultural requirements of san pedro wilshire 1,948 10 11/08/05 04:07 AM
by lIllIIIllIlIIlIlIIllIllIIl
* Is this San Pedro? Shroomeup 1,535 15 09/06/07 02:31 AM
by Dr. uarewotueat
* WARNING: To Vendors who Peddle Dried San Pedro Skins
( 1 2 3 4 5 all )
mjshroomer 21,747 84 09/25/07 05:09 AM
by Nalim

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: Magash, karode13, naum, Mostly_Harmless
1,047 topic views. 1 members, 9 guests and 0 web crawlers are browsing this forum.
[ Toggle Favorite | Print Topic | Stats ]
Search this thread:
Myco Supply
Please support our sponsors.

Copyright 1997-2017 Mind Media. Some rights reserved.

Generated in 0.024 seconds spending 0.002 seconds on 16 queries.