|
 AmericaNightmare
fiend
Registered: 02/24/03
Posts: 1,195
Loc: The Hyacinth House
Last seen: 17 years, 7 months
|
 really bad business... 
#3174817 - 09/24/04 11:59 AM (19 years, 6 months ago) |
|
|
alright, as some of you might know, i play bass in a band that is, as the word on the street has been telling me, "the next big thing".
needless to say, my hands are a vital part of my band.
yesterday my thumb got crushed in a machine.
imagine a machine that was crushing two peices of metal together so they stuck and were like one peice of metal. thats a lot of fucking crush power.
and then my thumb, caught in a malfunction.
all i have in my memory is just the crunching sond, i know i saw it, but i think it got blocked from my memory.
now, im sorry that i didnt get pictures of this, because this was the grossest thing ive seen in real life. real life not being the internet, tv, medical journals, etc.
but this was fucking horrendous. needless to say, i cussed a lot, and i did it very loud.
i walked into the ER and just held my thumb out to some lady, she proceeded to get me back there pretty quick.
after a lot of boring stuff that i wont go into, they xrayed it and told me that fortunately only a little bit of the bone got crushed off, and that my thumb would still have a little bit on it past the joint.
so i was bummed, but i figured i'll just have to get better at playing without a pick.
but, when the orthepedic surgeon decided hed go to work on it, they numbed it, unwrapped the gause, and then he decided that he could put it back together pretty good. i'll have a thumbnail, full dexterity, it'll just be a little short and ugly as hell. (thats what she said...)
but i got to watch him sew it all back together, and that made me sick.
so i'll have pictures of it on monday when they have another look at it, i figured since this has recently become physical health as well as mental health i'd post.
--------------------
Now, if I accept Jesus into my heart, I'll get to walk beside him in the Kingdom of Heaven. Did you hear what I said? Walk beside him in the Kingdom of Heaven. Well, kiss my crippled ass. God is listening. What a crock of shit.
--Lieutenant Dan
|
agr8fulchick
Feed Your Head!
Registered: 08/19/04
Posts: 707
Loc: Stranded in Iowa
Last seen: 12 years, 3 months
|
|
Wow that sucks! Now you get to hear everyone else's injury stories  My advice is to do your physical therapy and you'll be good as new! I ran my left arm through a chop saw, and now (several years later) I have almost everything back except a little dexterity and feeling. My orchestra teacher had a similar accident, only his was on a bike. Now, again, several years later, he can fully play all of his stringed instruments just like before. Hang in there! You'll still be one awesome bass player 
--------------------
Life's a journey. Take the scenic route.
  
|
AmericaNightmare
fiend
Registered: 02/24/03
Posts: 1,195
Loc: The Hyacinth House
Last seen: 17 years, 7 months
|
|
ha, thanks....my neighbor had an accident with a chainsaw involving that one real big artery in his leg, and i was the first person there, and not to toot my own horn, but i saved his life. 
yea, he was real drunk...i havent seen him for a while, but i think aside from his drinking hes alright.
--------------------
Now, if I accept Jesus into my heart, I'll get to walk beside him in the Kingdom of Heaven. Did you hear what I said? Walk beside him in the Kingdom of Heaven. Well, kiss my crippled ass. God is listening. What a crock of shit.
--Lieutenant Dan
|
Skikid16
fungus fan
Registered: 06/27/02
Posts: 5,666
Loc: In the middle of the nort...
Last seen: 19 years, 14 days
|
|
Damn dude, thats fucking crazy. Hey, at least the surgeon said you'll probably be back to almost new with some PT, and like dude above said, just fucking work work work at the PT, and you'll get better.
Good luck, and in time, keep rockin.
--------------------
Re-Defeat Bush in '04
|
Locus
Registered: 03/11/04
Posts: 6,112
Last seen: 3 years, 20 days
|
|
wow. haha, dude I thought you were going to say you fucked up your fingers so you could never play bass again. I would have totally felt for you man. And i did at first, i was like HOLY SHIT! i play many instruments, mainly guitar. and music is my favorite thing in life. so i know what that would be like, at least for me. anyway, im glad you'll be ok man  thumbs up 
--------------------
The important thing is not to stop questioning. Curiosity has its own reason for existing. One cannot help but be in awe when he contemplates the mysteries of eternity, of life, of the marvelous structure of reality. It is enough if one tries merely to comprehend a little of this mystery every day. Never lose a holy curiosity. ~ Albert Einstein
"Fear is the great barrier to human growth." ~ Dr. Robert Monroe
~~~*Dosis sola facit venenum*~~~
*Check my profile to listen to my music*
|
Skikid16
fungus fan
Registered: 06/27/02
Posts: 5,666
Loc: In the middle of the nort...
Last seen: 19 years, 14 days
|
Re: really bad business... [Re: Locus]
#3176999 - 09/24/04 09:50 PM (19 years, 6 months ago) |
|
|
Quote:
thumbs up
Nice man, that's funny as shit.
I really did laugh out loud.
--------------------
Re-Defeat Bush in '04
|
AmericaNightmare
fiend
Registered: 02/24/03
Posts: 1,195
Loc: The Hyacinth House
Last seen: 17 years, 7 months
|
Re: really bad business... [Re: Locus]
#3178706 - 09/25/04 11:27 AM (19 years, 6 months ago) |
|
|
ha, yea, thanks dudes...it was funny, the first thing i thought when i pulled my thumb out of that machine was "oh fuck, i wont be able to play anymore" so of course i scream lots of profanity and start whimpering "i'll still be able to play, hell, i'll be able to play our gig next week"...fact is, my band is probably going to have to cancel some shows, but thats nop big deal. this just gives me proper motivation to start playing with my fingers more than a pick.
and now i'll have good excuse to wear gloves around...if the question ever arises as to why i wear gloves, i can show them my mongoloid thumb. i'll be like darth vader or something. 
--------------------
Now, if I accept Jesus into my heart, I'll get to walk beside him in the Kingdom of Heaven. Did you hear what I said? Walk beside him in the Kingdom of Heaven. Well, kiss my crippled ass. God is listening. What a crock of shit.
--Lieutenant Dan
|
 Koala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG
Registered: 01/07/04
Posts: 7,752
|
|
Alright, but they have to be skeleton gloves.
Tough shit, but I'm impressed at your ability to look at the bright (or humorous) side.
This AmericanNightmare ain't running scared. (punches self in face)
|
|
Threaded
Previous
Index
Next
Kratom Powder For Sale 
Kratom Capsules for Sale 
Golden Teacher Liquid Culture For Sale
Edit 
Reply 
WhiskeyClone
PDU
mr_kite
stero8
Noviseer
renzorenzo
Dgrepo
1 2 all )
RebelSteve33