Home | Community | Message Board


This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Shop: Kraken Kratom Red Vein Kratom   Bridgetown Botanicals Bridgetown Botanicals

Jump to first unread post Pages: 1
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
Offlinemusicisgood
student ofexperience

Registered: 02/01/04
Posts: 41
Last seen: 18 years, 2 months
peruvian torch?
    #2356399 - 02/19/04 07:01 PM (20 years, 1 month ago)

i saw dried peruvian torch going for 50$ for 50 grams online. how many trips will this give me (about)? ive never done it before, and i have no idea. thanks


--------------------
im really just curious... i promise as soon as all the secrets of the universe are whispered in my ear by a jewish midget, riding a blue elephant, that i will discontinue my use of drugs. but not a second before the midget.

Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: peruvian torch? [Re: musicisgood]
    #2356506 - 02/19/04 07:22 PM (20 years, 1 month ago)

around 2 trips.. although doses vary

Extras: Filter Print Post Top
Offlinefelixhigh
Scientist
Male User Gallery

Registered: 06/24/01
Posts: 7,565
Loc: Ly
Last seen: 29 days, 2 hours
Re: peruvian torch? [Re: musicisgood]
    #2360612 - 02/20/04 06:09 PM (20 years, 1 month ago)

too expensive. a rip off.


FH

Extras: Filter Print Post Top
OfflineEkstaza
stranger than most
 User Gallery

Registered: 04/10/03
Posts: 4,324
Loc: Around the corner
Last seen: 11 months, 21 days
Re: peruvian torch? [Re: musicisgood]
    #2360730 - 02/20/04 06:33 PM (20 years, 1 month ago)

I have found it at 250 grams for $150 + s/h. The place even sells it by the kilo for $500.

I believe that there is another site that sells for even cheaper but I can't remember which one and I can't vouch for it since I have never ordered from them.


--------------------
YOUR EXPERIENCE WITH ANY GIVEN DRUG ISN'T THE DEFINITIVE MEASURE OF THE DRUGS EFFECTS.

Extras: Filter Print Post Top
Offlinemonkeyking
Stranger
Registered: 01/06/05
Posts: 23
Last seen: 18 years, 10 months
Re: peruvian torch? [Re: Ekstaza]
    #3683223 - 01/26/05 01:25 PM (19 years, 2 months ago)

felix where do you usually get it from?


--------------------
"My Fear Is My Only Courage" Bob Marley

Extras: Filter Print Post Top
InvisibleBoom
just a tester
Male
Registered: 06/16/04
Posts: 11,252
Loc: Cypress Creek
Re: peruvian torch? [Re: monkeyking]
    #3683325 - 01/26/05 01:47 PM (19 years, 2 months ago)

I got 4 oz from Shaman's Palace for $70.

Extras: Filter Print Post Top
Jump to top Pages: 1

Shop: Kraken Kratom Red Vein Kratom   Bridgetown Botanicals Bridgetown Botanicals


Similar ThreadsPosterViewsRepliesLast post
* Dried Peruvian Torch Cactus theocean06 1,080 4 11/17/04 01:48 PM
by thegnomeking
* Peruvian Torch Seedling Color badreligion2good 1,771 4 10/04/06 01:53 PM
by Mr420
* Growth Rate of Peruvian Torch EnCHaNTeDHoBBiT 16,514 9 10/14/03 07:33 PM
by Ahab McBathsalts
* San Pedro & Peruvian Torch: Larger Seed grown collection. SalviaEngland 2,483 2 05/26/04 09:30 AM
by felixhigh
* Possible Peruvian Torch Cuctus? Please help!
( 1 2 3 all )
m1984 5,993 44 10/13/08 03:18 AM
by Dr. uarewotueat
* Peruvian Torch
( 1 2 all )
MushroomTrip 6,611 38 02/25/06 01:55 AM
by Koala Koolio
* Icaros Dna Peruvian Torch
( 1 2 all )
Majoses 6,476 23 06/25/10 04:37 PM
by cpw1971
* Peruvian Torch Find! Moodion 1,988 19 10/01/08 05:16 AM
by Moodion

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: Mostly_Harmless, A.k.a
806 topic views. 0 members, 10 guests and 17 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2024 Mind Media. Some rights reserved.

Generated in 0.015 seconds spending 0.005 seconds on 14 queries.