Home | Community | Message Board


Out-Grow.com - Mushroom Growing Kits & Supplies
Please support our sponsors.

Mushrooms, Mycology and Psychedelics >> The Ethnobotanical Garden

Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Amazon Shop: Peruvian Torch

Jump to first unread post. Pages: 1
Offlinemusicisgood
student ofexperience

Registered: 02/01/04
Posts: 41
Last seen: 12 years, 2 months
peruvian torch?
    #2356399 - 02/19/04 09:01 PM (14 years, 2 months ago)

i saw dried peruvian torch going for 50$ for 50 grams online. how many trips will this give me (about)? ive never done it before, and i have no idea. thanks


--------------------
im really just curious... i promise as soon as all the secrets of the universe are whispered in my ear by a jewish midget, riding a blue elephant, that i will discontinue my use of drugs. but not a second before the midget.


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: peruvian torch? [Re: musicisgood]
    #2356506 - 02/19/04 09:22 PM (14 years, 2 months ago)

around 2 trips.. although doses vary


Post Extras: Print Post  Remind Me! Notify Moderator
Offlinefelixhigh
KIA
Male User Gallery

Registered: 06/24/01
Posts: 7,543
Loc: Ly
Last seen: 4 years, 10 months
Re: peruvian torch? [Re: musicisgood]
    #2360612 - 02/20/04 08:09 PM (14 years, 2 months ago)

too expensive. a rip off.


FH


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineEkstaza
stranger thanmost
 User Gallery

Registered: 04/11/03
Posts: 4,317
Loc: Around the corner
Last seen: 4 months, 5 days
Re: peruvian torch? [Re: musicisgood]
    #2360730 - 02/20/04 08:33 PM (14 years, 2 months ago)

I have found it at 250 grams for $150 + s/h. The place even sells it by the kilo for $500.

I believe that there is another site that sells for even cheaper but I can't remember which one and I can't vouch for it since I have never ordered from them.


--------------------
YOUR EXPERIENCE WITH ANY GIVEN DRUG ISN'T THE DEFINITIVE MEASURE OF THE DRUGS EFFECTS.


Post Extras: Print Post  Remind Me! Notify Moderator
Offlinemonkeyking
Stranger
Registered: 01/06/05
Posts: 23
Last seen: 13 years, 23 hours
Re: peruvian torch? [Re: Ekstaza]
    #3683223 - 01/26/05 03:25 PM (13 years, 3 months ago)

felix where do you usually get it from?


--------------------
"My Fear Is My Only Courage" Bob Marley


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleBoom
Supervisor
Male

Folding@home Statistics
Registered: 06/16/04
Posts: 11,245
Loc: Cypress Creek
Re: peruvian torch? [Re: monkeyking]
    #3683325 - 01/26/05 03:47 PM (13 years, 3 months ago)

I got 4 oz from Shaman's Palace for $70.


Post Extras: Print Post  Remind Me! Notify Moderator
Jump to top. Pages: 1

Amazon Shop: Peruvian Torch

Mushrooms, Mycology and Psychedelics >> The Ethnobotanical Garden

Similar ThreadsPosterViewsRepliesLast post
* Dried Peruvian Torch Cactus theocean06 920 4 11/17/04 03:48 PM
by thegnomeking
* Peruvian Torch Seedling Color badreligion2good 1,587 4 10/04/06 03:53 PM
by Mr420
* Growth Rate of Peruvian Torch EnCHaNTeDHoBBiT 9,998 9 10/14/03 09:33 PM
by Ahab McBathsalts
* San Pedro & Peruvian Torch: Larger Seed grown collection. SalviaEngland 1,779 2 05/26/04 11:30 AM
by felixhigh
* Possible Peruvian Torch Cuctus? Please help!
( 1 2 3 all )
m1984 5,011 44 10/13/08 05:18 AM
by Dr. uarewotueat
* Peruvian Torch
( 1 2 all )
MushroomTrip 5,502 38 02/25/06 03:55 AM
by Koala Koolio
* Icaros Dna Peruvian Torch
( 1 2 all )
Majoses 5,621 23 06/25/10 06:37 PM
by cpw1971
* Peruvian Torch Find! Moodion 1,803 19 10/01/08 07:16 AM
by Moodion

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: Magash, karode13, naum, Mostly_Harmless
755 topic views. 3 members, 9 guests and 1 web crawlers are browsing this forum.
[ Toggle Favorite | Print Topic | Stats ]
Search this thread:
Edabea
Please support our sponsors.

Copyright 1997-2018 Mind Media. Some rights reserved.

Generated in 0.03 seconds spending 0.006 seconds on 19 queries.