Home | Community | Message Board


This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Jump to first unread post Pages: 1 | 2 | 3 | Next >  [ show all ]
Invisiblesui
I love you.
Male User Gallery

Registered: 08/20/04
Posts: 31,853
Loc: Cali, Contra Costa Co. Flag
20 year suicide plan.
    #5336433 - 02/24/06 11:02 PM (17 years, 11 months ago)

Anyone else know they are probobly going to die of cancer, and you just dont give a flying fuck?





/me lights up cancer stick.


--------------------

"There is never a wrong note, bend it."
Jimi Hendrix



Extras: Filter Print Post Top
Offlinewhatever123
Whatever I did, I'm sorry
Male User Gallery

Registered: 04/07/05
Posts: 2,613
Loc: San Diego, CA
Last seen: 5 years, 6 months
Re: 20 year suicide plan. [Re: sui]
    #5336443 - 02/24/06 11:04 PM (17 years, 11 months ago)

my dad died of [skin] cancer.
both of my grandparents on his side smoked, and died because of it! one of lung cancer, the other of emphysema! dont be so insensitive!

...

oh, and the answer is yes, i also smoke and don't give a fuck. Not a bad idea, may go light one up now, go tagging or something, peace.


--------------------
Koala Koolio said:
there should be a 3 month waiting period between registration and posting. :wink:


Extras: Filter Print Post Top
Invisiblesui
I love you.
Male User Gallery

Registered: 08/20/04
Posts: 31,853
Loc: Cali, Contra Costa Co. Flag
Re: 20 year suicide plan. [Re: whatever123]
    #5336449 - 02/24/06 11:07 PM (17 years, 11 months ago)

5 of my reletives have died of cancer so it aint like ive never seen it before.

i guess it was kinda a stupid post, but thats probobly how im gonna die.


--------------------

"There is never a wrong note, bend it."
Jimi Hendrix



Extras: Filter Print Post Top
OfflinePhanTomCat
Teh Cat....
Male User Gallery

Registered: 09/07/04
Posts: 5,908
Loc: My Youniverse....
Last seen: 14 years, 11 months
Re: 20 year suicide plan. [Re: sui]
    #5336454 - 02/24/06 11:08 PM (17 years, 11 months ago)

Actually, yes.....    I much rather prefer that over drooling in bed year after year, forgetting, EVERYTHING while some nasty nurse changes your diaper....

****lights up another one****

:smoker:

Aaaaaahhhhhh.....


--------------------
I'll be your midnight French Fry....  :naughty:

"The most important things in life that are often ignored, are the things that one cannot see...."

>^;;^<


Extras: Filter Print Post Top
InvisibleSilversoul
Rhizome
Male User Gallery

Registered: 01/01/05
Posts: 23,576
Loc: The Barricades
Re: 20 year suicide plan. [Re: sui]
    #5336462 - 02/24/06 11:09 PM (17 years, 11 months ago)

My great-grandmother lived to be 102 years old. I'm not a heavy enough smoker to fight off genes like that. If I die early, it'll be an assassination.


--------------------


Extras: Filter Print Post Top
InvisibleJim
 User Gallery

Registered: 04/07/04
Posts: 20,922
Re: 20 year suicide plan. [Re: sui]
    #5336484 - 02/24/06 11:15 PM (17 years, 11 months ago)

I'm hoping I die in the next 10 years.


--------------------
Use the Fucking Reply To Feature You Lazy Pieces of Shit!

afoaf said:
Jim, if you were in my city, I would let you fuck my wife.


Extras: Filter Print Post Top
Invisiblesui
I love you.
Male User Gallery

Registered: 08/20/04
Posts: 31,853
Loc: Cali, Contra Costa Co. Flag
Re: 20 year suicide plan. [Re: Jim]
    #5336530 - 02/24/06 11:36 PM (17 years, 11 months ago)

jeez, i just re-read this thread, im pessimistic tonight :crazy:


--------------------

"There is never a wrong note, bend it."
Jimi Hendrix



Extras: Filter Print Post Top
OfflineKaptKid
Spaced Pirate
Male User Gallery

Registered: 12/11/03
Posts: 6,252
Loc: Bright Side of the Sun
Last seen: 3 years, 11 months
Re: 20 year suicide plan. [Re: sui]
    #5336572 - 02/24/06 11:57 PM (17 years, 11 months ago)

I don't afraid of dying. I just don't want to be there when it happens.


:sun:


--------------------
Child of the 60's, Tripping ever since.


:sun:


Extras: Filter Print Post Top
InvisibleTYL3R
I'm a teapot User Gallery

Registered: 11/19/04
Posts: 17,493
Re: 20 year suicide plan. [Re: sui]
    #5336577 - 02/24/06 11:59 PM (17 years, 11 months ago)

I'll light one up to that.


Extras: Filter Print Post Top
InvisibleBoom
just a tester
Male
Registered: 06/16/04
Posts: 11,252
Loc: Cypress Creek
Re: 20 year suicide plan. [Re: sui]
    #5336581 - 02/25/06 12:01 AM (17 years, 11 months ago)

I never met my Mom's parents (they died of lung cancer when she was around 19).. My grandma (Dad's mom) died of emphysema recently..  Almost all of my great uncles and aunts died of lung cancer..

Damn Irish binge drinkers/chain smokers!!

I do feel bad about smoking..when my parents just shake their heads and remind me of everyone in our family.  Oh well. :sad:


Extras: Filter Print Post Top
InvisibleJim
 User Gallery

Registered: 04/07/04
Posts: 20,922
Re: 20 year suicide plan. [Re: sui]
    #5336684 - 02/25/06 12:33 AM (17 years, 11 months ago)

The more I think about it, the closer the end should be for me  :crazy:


--------------------
Use the Fucking Reply To Feature You Lazy Pieces of Shit!

afoaf said:
Jim, if you were in my city, I would let you fuck my wife.


Extras: Filter Print Post Top
OfflineVulture
Pursuer ofWisdom
 User Gallery

Registered: 06/18/02
Posts: 3,546
Loc: SC
Last seen: 8 years, 10 months
Re: 20 year suicide plan. [Re: Jim]
    #5336687 - 02/25/06 12:35 AM (17 years, 11 months ago)

/me lights one up


im sure ill put a bullet through my head before it gets to cancer


--------------------
Work like you dont need the money.

Love like you never been hurt.

Dance like nobody is watching.


Extras: Filter Print Post Top
Offlinerelativexistance
"beads, bees!?!?beads ....BEADS!!!"
 User Gallery

Registered: 01/08/04
Posts: 1,778
Last seen: 11 years, 7 months
Re: 20 year suicide plan. [Re: sui]
    #5336688 - 02/25/06 12:35 AM (17 years, 11 months ago)

i'm banking on some sort of organ failure man, most likely the liver at this point. but as the new york lottery says "hey you never know"


Extras: Filter Print Post Top
InvisibleJim
 User Gallery

Registered: 04/07/04
Posts: 20,922
Re: 20 year suicide plan. [Re: Vulture]
    #5336690 - 02/25/06 12:36 AM (17 years, 11 months ago)

I would join the army in hopes of dying, but they won't take me.


--------------------
Use the Fucking Reply To Feature You Lazy Pieces of Shit!

afoaf said:
Jim, if you were in my city, I would let you fuck my wife.


Extras: Filter Print Post Top
Invisiblesui
I love you.
Male User Gallery

Registered: 08/20/04
Posts: 31,853
Loc: Cali, Contra Costa Co. Flag
Re: 20 year suicide plan. [Re: Jim]
    #5336696 - 02/25/06 12:38 AM (17 years, 11 months ago)

Quote:

GratefulJim said:
I would join the army in hopes of dying, but they won't take me.




skydiving accident? If i die in some freak way thats how id like to go.



SPLATT. :grin:


--------------------

"There is never a wrong note, bend it."
Jimi Hendrix



Extras: Filter Print Post Top
InvisibleJim
 User Gallery

Registered: 04/07/04
Posts: 20,922
Re: 20 year suicide plan. [Re: sui]
    #5336699 - 02/25/06 12:39 AM (17 years, 11 months ago)

no way.

that would be too intense for me.

i could never jump out of a plane.


--------------------
Use the Fucking Reply To Feature You Lazy Pieces of Shit!

afoaf said:
Jim, if you were in my city, I would let you fuck my wife.


Extras: Filter Print Post Top
Invisiblesui
I love you.
Male User Gallery

Registered: 08/20/04
Posts: 31,853
Loc: Cali, Contra Costa Co. Flag
Re: 20 year suicide plan. [Re: Jim]
    #5336705 - 02/25/06 12:42 AM (17 years, 11 months ago)

no plane, Halo jump. Hot air balloon, 20m in the stratuphere.

20minute freefall going the speed of sound.


:cool:


--------------------

"There is never a wrong note, bend it."
Jimi Hendrix



Extras: Filter Print Post Top
InvisibleJim
 User Gallery

Registered: 04/07/04
Posts: 20,922
Re: 20 year suicide plan. [Re: sui]
    #5336729 - 02/25/06 12:50 AM (17 years, 11 months ago)

mauled by a bear would be fun.


--------------------
Use the Fucking Reply To Feature You Lazy Pieces of Shit!

afoaf said:
Jim, if you were in my city, I would let you fuck my wife.


Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: 20 year suicide plan. [Re: Jim]
    #5336967 - 02/25/06 02:06 AM (17 years, 11 months ago)

I plan on walking by a fence covered in vines, and the vines will reach out and grab me, pulling me in towards the chain link fence. I'll be all, "What the fuck? No!!!!" and everyone will stand around, not helping as usual.

Then, I'll be pulled through and come out the other side in 2"x2" elgr cubes, diagonal style. It'd be like that resident evil movie, but crappier and without laser precision.

Everyone standing around would have to spend the rest of their lives regretting that they didn't help me, and weren't man enough to fight some plants.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Extras: Filter Print Post Top
Invisiblesui
I love you.
Male User Gallery

Registered: 08/20/04
Posts: 31,853
Loc: Cali, Contra Costa Co. Flag
Re: 20 year suicide plan. [Re: Koala Koolio]
    #5336979 - 02/25/06 02:09 AM (17 years, 11 months ago)

Quote:

elgr said:
I plan on walking by a fence covered in vines, and the vines will reach out and grab me, pulling me in towards the chain link fence. I'll be all, "What the fuck? No!!!!" and everyone will stand around, not helping as usual.

Then, I'll be pulled through and come out the other side in 2"x2" elgr cubes, diagonal style. It'd be like that resident evil movie, but crappier and without laser precision.

Everyone standing around would have to spend the rest of their lives regretting that they didn't help me, and weren't man enough to fight some plants.





:grin:  :thumbup:


--------------------

"There is never a wrong note, bend it."
Jimi Hendrix



Extras: Filter Print Post Top
Jump to top Pages: 1 | 2 | 3 | Next >  [ show all ]


Similar ThreadsPosterViewsRepliesLast post
* "Thompson probably planned suicide"
( 1 2 all )
Vvellum 2,895 21 02/23/05 08:06 PM
by Learyfan
* Predicition: the rate of emphysema (or something) will increase sharply in the near future
( 1 2 3 all )
the bizzle 3,396 53 12/30/09 04:23 PM
by MuddinPede
* easiest method of suicide?
( 1 2 3 4 all )
Razman 10,222 70 02/24/05 03:38 PM
by Woland
* What are your plans for 4/20
( 1 2 3 all )
ShroomFan 4,713 45 04/19/04 12:15 AM
by Phencyclidine
* April 20 CherryBomM 776 14 04/19/05 03:35 PM
by thepodman
* 20 Questions
( 1 2 3 4 all )
CaRnAgECaNdYS 6,748 75 10/28/05 10:18 PM
by MOTH
* If you chose suicide...
( 1 2 all )
Adden 4,730 35 04/03/05 01:35 PM
by Locus
* Canada suicide hotline to open only from 9 to 5 RandalFlagg 1,021 7 05/27/05 09:41 AM
by In(di)go

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: Entire Staff
2,100 topic views. 2 members, 53 guests and 58 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2024 Mind Media. Some rights reserved.

Generated in 0.026 seconds spending 0.008 seconds on 16 queries.