Home | Community | Message Board

MRCA Tyroler Gluckspilze
This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Jump to first unread post Pages: < Back | 1 | 2 | 3  [ show all ]
Invisiblebeavis190
(.Y.)'s
Male User Gallery

Registered: 01/25/06
Posts: 432
Loc: lost in my head
Re: 20 year suicide plan. [Re: mediman0078]
    #5337748 - 02/25/06 11:49 AM (17 years, 11 months ago)

ill probably die from doing something stupid on a massive dose of many drugs...lol and im smoking as we speak


Extras: Filter Print Post Top
OfflineVulture
Pursuer ofWisdom
 User Gallery

Registered: 06/18/02
Posts: 3,546
Loc: SC
Last seen: 8 years, 10 months
Re: 20 year suicide plan. [Re: beavis190]
    #5338271 - 02/25/06 03:14 PM (17 years, 11 months ago)

my favorite death would be at the end of the world...i suppose thats one thing that keeps me from doing myself in


--------------------
Work like you dont need the money.

Love like you never been hurt.

Dance like nobody is watching.


Extras: Filter Print Post Top
OfflineAnimals
Just Danson inthe Dark
 User Gallery

Registered: 10/27/05
Posts: 1,260
Last seen: 13 years, 9 months
Re: 20 year suicide plan. [Re: Vulture]
    #5338448 - 02/25/06 04:25 PM (17 years, 11 months ago)

I'd like to die by spontaneously combusting while hugging a man in a new white suit.

no homo.


Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: 20 year suicide plan. [Re: Animals]
    #5338499 - 02/25/06 05:02 PM (17 years, 11 months ago)

"my favorite death would be at the end of the world...i suppose thats one thing that keeps me from doing myself in"

Conformist.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Extras: Filter Print Post Top
InvisibleJonnyOnTheSpot
Sober Surfer
Male User Gallery

Registered: 01/27/02
Posts: 11,527
Loc: North Carolina
Re: 20 year suicide plan. [Re: Boom]
    #5338647 - 02/25/06 05:56 PM (17 years, 11 months ago)

Quote:

Booooom said:
I never met my Mom's parents (they died of lung cancer when she was around 19).. My grandma (Dad's mom) died of emphysema recently..  Almost all of my great uncles and aunts died of lung cancer..

Damn Irish binge drinkers/chain smokers!!

I do feel bad about smoking..when my parents just shake their heads and remind me of everyone in our family.  Oh well. :sad:




woah..that's weird. you pretty much described my situation exactly.


Extras: Filter Print Post Top
OfflineWeAreAllOne
Opethian

Registered: 06/25/05
Posts: 2,649
Loc: Pennsylvania
Last seen: 17 years, 9 months
Re: 20 year suicide plan. [Re: Vulture]
    #5338846 - 02/25/06 07:00 PM (17 years, 11 months ago)

Quote:

Vulture said:
my favorite death would be at the end of the world...i suppose thats one thing that keeps me from doing myself in




i don't think you'll be around to behold the dying sky...

though, the way things are going... you might...


Extras: Filter Print Post Top
Offlinemediman0078
Stilllooking.....

Registered: 11/14/05
Posts: 1,379
Loc: Here, there, EVERYWHERE
Last seen: 17 years, 10 months
Re: 20 year suicide plan. [Re: WeAreAllOne]
    #5340489 - 02/26/06 10:05 AM (17 years, 10 months ago)

I dunno, maybe we'll get smacked witha big astroid. That would be cool to see. I bet it'd be freaky to feel the earth beneath your feet reverberate with the force of the impact right before your get vaporized or covered in debris.

It's like living on a cosmic billiard ball.... :strokebeard:


--------------------
........someday I'll find it.


Extras: Filter Print Post Top
OfflineKonnrade
↑↑↓↓<--><-->BA
Male User Gallery

Folding@home Statistics
Registered: 09/13/05
Posts: 13,833
Loc: LA Suburbs
Last seen: 8 months, 26 days
Re: 20 year suicide plan. [Re: Brakkie]
    #5340644 - 02/26/06 11:08 AM (17 years, 10 months ago)

Quote:

Brakkie said:
For a 20 minute freefall you'd have to be around 67000 meters high... Wow that would be a big drop... you'd have to be in the mesosphere 50 - 80/85 km I'm not even sure if there are planes that could reach that hight lol




There are planes that can fly that high. There are planes which can reach the ionosphere, which is much higher.


--------------------

I find your lack of faith disturbing


Extras: Filter Print Post Top
OfflineBrakkie
Myself
Registered: 09/26/05
Posts: 813
Loc: Rotterdam... The City of ...
Last seen: 17 years, 1 month
Re: 20 year suicide plan. [Re: Konnrade]
    #5340658 - 02/26/06 11:13 AM (17 years, 10 months ago)

Wow didn't knew that


--------------------
"This combines the good sides of every other drug with none of the bad. This is the ultimate luxury, the flawless wisdom-pleasure hit. More mellow and cozy than heroin, but you don't nod out. I feel more alive and wired and energetic than with speed, but not jangly. Its got the blast of cocaine, but it lasted ten times longer."

"Going to the grave without ever having a psychedelic experience is like going to the grave without ever having sex. That means you will die before even becoming an adolescent." -Terence Mckenna


Extras: Filter Print Post Top
Jump to top Pages: < Back | 1 | 2 | 3  [ show all ]


Similar ThreadsPosterViewsRepliesLast post
* "Thompson probably planned suicide"
( 1 2 all )
Vvellum 2,895 21 02/23/05 08:06 PM
by Learyfan
* Predicition: the rate of emphysema (or something) will increase sharply in the near future
( 1 2 3 all )
the bizzle 3,396 53 12/30/09 04:23 PM
by MuddinPede
* easiest method of suicide?
( 1 2 3 4 all )
Razman 10,222 70 02/24/05 03:38 PM
by Woland
* What are your plans for 4/20
( 1 2 3 all )
ShroomFan 4,713 45 04/19/04 12:15 AM
by Phencyclidine
* April 20 CherryBomM 776 14 04/19/05 03:35 PM
by thepodman
* 20 Questions
( 1 2 3 4 all )
CaRnAgECaNdYS 6,748 75 10/28/05 10:18 PM
by MOTH
* If you chose suicide...
( 1 2 all )
Adden 4,730 35 04/03/05 01:35 PM
by Locus
* Canada suicide hotline to open only from 9 to 5 RandalFlagg 1,021 7 05/27/05 09:41 AM
by In(di)go

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: Entire Staff
2,100 topic views. 5 members, 29 guests and 30 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2024 Mind Media. Some rights reserved.

Generated in 0.021 seconds spending 0.007 seconds on 14 queries.