Home | Community | Message Board


This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Shop: Unfolding Nature Unfolding Nature: Being in the Implicate Order   Sporeworks.EU Spores for European Microscopy   MagicBag.co All-In-One Bags That Don't Suck   Myyco.com Isolated Cubensis Liquid Culture For Sale   North Spore Bulk Substrate

Jump to first unread post Pages: | 1 | 2 | 3 | 4  [ show all ]
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
Re: More SF pans (cints?) [Re: Alan Rockefeller] * 1
    #26024133 -

Alan Rockefeller said:
lowbrow said:
You’re really going against the scientific grain on this one.  Can we see this evidence instead of ‘because I said so’.




Here's a sequence from a grass "cinct"

AGGGTTCCGTAGTGACCTGCGGAGGATCATTATCGAATAAACTAGGTGGGTTGTTGCTGTCCCTCTCGGG
GGAATTGTGCACACCTTACCTTTTTTGTTTTTCCACCTGTGCACACACTGTAGGTCTGAAGGAGGGGAAG
GGGGGGGAAGTAACACTCTCCCCCTGAAACACTTTCAGGTCCTATGTATTTTACACATACACTATTAAAA
GTAACAGAACGATTCAATGGGCTTCCAAGCCTATAAACTATATACAACTTTCAGCAACGGATCTCTTGGC
TCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGA
ATCTTTGAACGCACCTTGCGCTCGTTGGTATTCCGACAAGCATGCCTGTTTGAGTGTCATTAAATTCTCA
ACCTCAACACTTTTGTGATTGATGGCTTGGATGTGGAGGTTTTTCTGCAGGCTGTTAAAGTCTGCTCCTC
TCAAATGAATTAGTGGGTGCCCCGCGCAAACCTATCTATTGGTGTGATAATTATCTACGCCGTGGATTAT
AGGATTGCTGTAAAAAGGTGTTTGCCCTGCTTCTAACCGTCCCCTCTGTTGGGACAACTTGAACCATTTG
ACCTCAGATCAAGTAGGACTACCCCCTGAACTTAACCATATCCATAAG

And here is one from a dung Panaeolus cinctulus:

GGGTTGTTGCTGTCCCTCTCGGGGGAATTGTGCACACCTTACCTTTTTTGTTTTTCCACCTGTGCACACA
CTGTAGGTCTGAAGGAGGGGAAGGGGGGGGATTAACACTCTCCGCCTGAAACACTTTCAGGTCCTATGTA
TTTTACACATACACTATTAAAAGTAACAGAACGATTCAATGGGCTTCCAAGCCTATAAACTATATACAAC
TTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATT
GCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCGTTGGTATTCCGACGAGCATGCCTG
TTTGAGTGTCATTAAATTCTCAACCTCAACACTTTTGTGATTGATGGCTTGGATGTGGAGGTTTTTCTGC
AGGCTGTTAAAGTCTGCTCCTCTCAAATGAATTAGTGGGTGCCCCGCGCAAACCTATCTATTGGTGTGAT
AATTATCTACGCCGTGGATTATAGGATTGCTGTAAAAAGGTGTTTGCCCTGCTTCTAACCGTCCCCTTTG
TTGGGACAACTTGAACCATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATA





Hey Alan, is the sequence above for "grass cinct" the accession MK394183.1? It matches it 100%, but that one is titled for Panaeolus fimicola, the collection of which was made in Maryland, USA, found in grass sports field.

Also, is the sequence above for "dung" variety the accession MH590045.1, the one that was found growing in garden soil in Los Angeles? It matches 100%. If so, Garden soil, dung, I guess they are similar enough eh? Although seems not too many garden soils use horse dung, it seems more often cow dung.

From what I am seeing in blast, then, the grass cincts are certainly a heck of lot closer to the dung/garden soil cincts then they are to foes, 98.41% identical compared to 92.36% identical. Maybe a subspecies not new species? Just wondering.

Cheers!

D

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: tacodude]
    #26024257 -

Are those psychedelic?

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: Doug295]
    #26024357 -

Doug295 said:
Hey Alan, is the sequence above for "grass cinct" the accession MK394183.1? It matches it 100%, but that one is titled for Panaeolus fimicola, the collection of which was made in Maryland, USA, found in grass sports field.



Yes.  It also matches 100% with a microscopically confirmed P. fimicola from Georgia which is not in Genbank.

Quote:
Also, is the sequence above for "dung" variety the accession MH590045.1, the one that was found growing in garden soil in Los Angeles? It matches 100%. If so, Garden soil, dung, I guess they are similar enough eh? Although seems not too many garden soils use horse dung, it seems more often cow dung.



Yes, pretty sure she was using garden soil which included manure.  It's pretty common to see these beefy P. cinctulus in houseplants with commercial potting soil.

Sure is nice when people reference Mushroom Observer #'s in their DNA sequences so you can see photos and other information about the collection.

Quote:
From what I am seeing in blast, then, the grass cincts are certainly a heck of lot closer to the dung/garden soil cincts then they are to foes, 98.41% identical compared to 92.36% identical. Maybe a subspecies not new species? Just wondering.




98.41% is enough to say it's a different species in the ITS gene - some recent papers have suggested a cutoff of 99.8% for ITS, however there really isn't and can never be an exact cutoff number.

I have a few more sequences which also point in this direction which I can't share publicly because they were given to me in confidence.    More sequences are very much needed.  I am about to go on the road for several months so I can't take additional collections now, but anyone who finds grass or dung P. cinctulus should take good photos and send dried material to http://alvalab.es and ask for an ITS sequence.  It will run about $20.  Then send the data to me and I'll help make sense of it.


Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: 96Romeo]
    #26024394 -

96Romeo said:
Are those psychedelic?



Not sure... Haven't cared to figure out. I tried to throw caps and stem butts in a jar with soil and dried mowed grass from the park to see if it will become a viable culture for the hell of it.... I doubt it 1k colonize at least without contam

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: tacodude]
    #26024476 -

@Alan

Would you agree with most of the points made in this paper?

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5368684/

Looking at the services provided, which is ITS?

http://www.alvalab.es/orders.html


--------------------
The more I see mushrooms, the more I see mushrooms. I swear it gets into you.

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: Dunedinite]
    #26024680 -

Dunedinite said:
Panaeolus lawnboii



:rofl: I like the name


--------------------


Psilocybe cubensis data collection thread. please help with this project if you hunt wild cubensis.
https://www.shroomery.org/forums/showflat.php?Cat=0&Number=26513593&page=0&vc=1#26513593

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: Gilzman]
    #26029181 -

Gilzman said:
Would you agree with most of the points made in this paper?

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5368684/



Yes.

Quote:
Looking at the services provided, which is ITS?

http://www.alvalab.es/orders.html



DNA Extraction, Standard Taq PCR Amplification, Purification and Sequencing.

Extras: Filter Print Post Top
Jump to top Pages: | 1 | 2 | 3 | 4  [ show all ]

Shop: Unfolding Nature Unfolding Nature: Being in the Implicate Order   Sporeworks.EU Spores for European Microscopy   MagicBag.co All-In-One Bags That Don't Suck   Myyco.com Isolated Cubensis Liquid Culture For Sale   North Spore Bulk Substrate


Similar ThreadsPosterViewsRepliesLast post
* pan cincts and edibles
( 1 2 all )
trigger 3,019 25 07/15/10 11:06 PM
by SomeGuy
* help identifing mushrooms
( 1 2 all )
codyrcollier14 7,573 24 09/28/14 09:02 AM
by ambc
* is it Panaeolus cinctulu? choomanfoo 5,714 11 05/26/13 08:20 PM
by choomanfoo
* Foes or Cints ID [Update for prints] MushroomPantheon 430 3 09/22/13 06:34 PM
by MushroomPantheon
* I think i finally found a Pann cint. Pics. underfliptown 1,201 19 07/10/13 08:29 PM
by Gravija
* Pann cints/ foes. Spectacle 610 5 10/23/12 03:07 AM
by Spectacle
* Pan Cint Preservation noluckhunterr 569 1 05/08/09 08:32 PM
by Engelsblut6
* need ID on shrooms found in SF area
( 1 2 all )
adamlivesinCA 1,836 21 04/04/08 03:03 PM
by landsnorkler

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: ToxicMan, karode13, inski, Alan Rockefeller, Duggstar, TimmiT, Anglerfish, Tmethyl, Lucis, Doc9151, Land Trout
1,574 topic views. 0 members, 1,554 guests and 46 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2026 Mind Media. Some rights reserved.

Generated in 0.024 seconds spending 0.006 seconds on 15 queries.