Home | Community | Message Board
You are not signed in.
Sign In New Account
Forum Index Search Posts Trusted Vendors Highlights Galleries FAQ User List Chat Store Random Growery


This site includes paid links. Please support our sponsors.

Mushrooms, Mycology and Psychedelics > Mushroom Hunting and Identification
Threaded Mode Threaded  Previous topic Previous  View all topics Index  Next topic Next 

Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Shop: Original Sensible Seeds Autoflowering Cannabis Seeds   Myyco.com Golden Teacher Liquid Culture For Sale   Unfolding Nature Unfolding Nature: Being in the Implicate Order   Mushroom-Hut Liquid Cultures   MagicBag.co All-In-One Bags That Don't Suck   Sporeworks.EU Spores for European Microscopy   North Spore Bulk Substrate

Jump to first unread post Pages: 1 | 2 | 3 | 4  [ show all ]
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
More SF pans (cints?)
    #26016732 -



Finding them as we speak in grass at ggp... pan foe is non toxic so safe to eat even if

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: tacodude]
    #26016741 -

tacodude said:


Finding them as we speak in grass at ggp... pan foe is non toxic so safe to eat even if


I don’t know about the rest but the one with the gills facing up is a cinct.


--------------------
Amanita86 said:
Sui is trying to mod right now.  Kinda like a newborn calf tryin ta stand fer the first time ain’t it..

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: lowbrow]
    #26016755 -

How can you tell?  They're looking really promising


Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: tacodude]
    #26016757 -

Print them all, regardless of what I said.  I’m not a trusted identifier and if you want to get better at this you’re going to have to get your hands dirty.


--------------------
Amanita86 said:
Sui is trying to mod right now.  Kinda like a newborn calf tryin ta stand fer the first time ain’t it..

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: lowbrow]
    #26016777 -

Look legit to me, can even see some bluing on some.


--------------------
Psychedelics are a human rights of exploration, Just like sex and thinking.

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: SemiHunter]
    #26016790 -

Niiiice! I just came out here for my friends birthday. Hopefully I can print some to grow on poo

Edit :



Today's haul it looks... They were growing around the tree on the right missing half its leaves. I found them in our a befor circle around it in the mowed grass that must have some relation as there's none elsewhere throughout the feild

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: lowbrow]
    #26016808 -

lowbrow said:
Print them all, regardless of what I said.  I’m not a trusted identifier and if you want to get better at this you’re going to have to get your hands dirty.


I know brown vs black print, but they never drop. I also look for the band, but I don't think that identifies it necessarily. I know how to ID psilocybins so I know what things to look at to identify, but need advice on what to look for

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: tacodude]
    #26016819 -

They all look like Panaeolina foenisecii to me, you can spore print them if you like, but I think they'll all be brown.


--------------------
How to add a picture to a post

Sample ID request - READ BEFORE POSTING AN ID REQUEST!

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: Duggstar]
    #26016841 -

Yeah... One picked that was other another looked like it had a brown steak that was either spores or bruising... It was really hard to tell. Pan foe is edible though right so I can eat them either way and be okay?

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: tacodude]
    #26016843 -

Panaeolus foenisecii, edible.


Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: tacodude]
    #26016978 -

tacodude said:
Yeah... One picked that was other another looked like it had a brown steak that was either spores or bruising... It was really hard to tell. Pan foe is edible though right so I can eat them either way and be okay?


You have to have experience printing them before you can even think about eying them.  Printing allows you to train your eyes to spot those subtle differences then you can start to eye them.

But like I said, if you don’t get your hands dirty you will not learn.

I’m going to double down on the mushroom facing up in the first pic, if you print that one successfully it will be black.


--------------------
Amanita86 said:
Sui is trying to mod right now.  Kinda like a newborn calf tryin ta stand fer the first time ain’t it..

Edited by lowbrow (05/27/19 07:28 PM)

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: lowbrow]
    #26017019 -

Again why is the one facing up a cint to you? I believe they are all the same kind as they were all in the same location spread apart with only 2 or 3 at most growing near eachother. I honestly think they are all the same culture spread out over the area I looked as theres no fruits in the area so if ones a cint they all likely are just as if they aren't. I think I saw some spores, but I'm outside at a friends birthday where everything seems to keep knocking over the bowl so I cant even get enough of a print to check the color. Although I do believe I saw a faint bit of black spores, but still waiting

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: tacodude] * 1
    #26017023 -

tacodude said:
Again why is the one facing up a cint to you?



Panaeolus cinctulus is a lot more robust and doesn't grow in grass.

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: tacodude]
    #26017061 -

tacodude said:
Again why is the one facing up a cint to you? I believe they are all the same kind as they were all in the same location spread apart with only 2 or 3 at most growing near eachother. I honestly think they are all the same culture spread out over the area I looked as theres no fruits in the area so if ones a cint they all likely are just as if they aren't. I think I saw some spores, but I'm outside at a friends birthday where everything seems to keep knocking over the bowl so I cant even get enough of a print to check the color. Although I do believe I saw a faint bit of black spores, but still waiting



First it takes about 12 to 24 hours to get a print.  The reason I think it’s a cinct. Is because the gills have the right color.


--------------------
Amanita86 said:
Sui is trying to mod right now.  Kinda like a newborn calf tryin ta stand fer the first time ain’t it..

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: Alan Rockefeller]
    #26017073 -

Alan Rockefeller said:
tacodude said:
Again why is the one facing up a cint to you?



Panaeolus cinctulus is a lot more robust and doesn't grow in grass.


You’re really going against the scientific grain on this one.  Can we see this evidence instead of ‘because I said so’.


--------------------
Amanita86 said:
Sui is trying to mod right now.  Kinda like a newborn calf tryin ta stand fer the first time ain’t it..

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: lowbrow] * 1
    #26017114 -

I agree, these look like pan foe too me

And also imo, Alan Rockefeller IS the scientific grain!

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: Katz 206]
    #26017146 -

Yeah Alan is pretty legit, but honestly I think rules out pan cint too easy (for being in grass in this case as one specific member I trust more on it faster it grows in both, but much more developed in poo


Edit: Found another area with a bunch


Edited by tacodude (05/27/19 08:56 PM)

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: Katz 206]
    #26017177 -

Katz 206 said:
I agree, these look like pan foe too me

And also imo, Alan Rockefeller IS the scientific grain!


No, he’s not.
tacodude said:
Yeah Alan is pretty legit, but honestly I think rules out pan cint too easy (for being in grass in this case as one specific member I trust more on it faster it grows in both, but much more developed in poo

As far as the mushroom community(at large) knows, pan cincts. have always grown in well manured lawns.  That’s why they consider it the weed of mushrooms.

tacodude said:
Edit: Found another area with a bunch


. Right on. Take prints this time.





--------------------
Amanita86 said:
Sui is trying to mod right now.  Kinda like a newborn calf tryin ta stand fer the first time ain’t it..

Edited by lowbrow (05/27/19 09:11 PM)

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: lowbrow]
    #26017197 -

lowbrow said:
You’re really going against the scientific grain on this one.  Can we see this evidence instead of ‘because I said so’.



Here's a sequence from a grass "cinct"

AGGGTTCCGTAGTGACCTGCGGAGGATCATTATCGAATAAACTAGGTGGGTTGTTGCTGTCCCTCTCGGG
GGAATTGTGCACACCTTACCTTTTTTGTTTTTCCACCTGTGCACACACTGTAGGTCTGAAGGAGGGGAAG
GGGGGGGAAGTAACACTCTCCCCCTGAAACACTTTCAGGTCCTATGTATTTTACACATACACTATTAAAA
GTAACAGAACGATTCAATGGGCTTCCAAGCCTATAAACTATATACAACTTTCAGCAACGGATCTCTTGGC
TCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGA
ATCTTTGAACGCACCTTGCGCTCGTTGGTATTCCGACAAGCATGCCTGTTTGAGTGTCATTAAATTCTCA
ACCTCAACACTTTTGTGATTGATGGCTTGGATGTGGAGGTTTTTCTGCAGGCTGTTAAAGTCTGCTCCTC
TCAAATGAATTAGTGGGTGCCCCGCGCAAACCTATCTATTGGTGTGATAATTATCTACGCCGTGGATTAT
AGGATTGCTGTAAAAAGGTGTTTGCCCTGCTTCTAACCGTCCCCTCTGTTGGGACAACTTGAACCATTTG
ACCTCAGATCAAGTAGGACTACCCCCTGAACTTAACCATATCCATAAG

And here is one from a dung Panaeolus cinctulus:

GGGTTGTTGCTGTCCCTCTCGGGGGAATTGTGCACACCTTACCTTTTTTGTTTTTCCACCTGTGCACACA
CTGTAGGTCTGAAGGAGGGGAAGGGGGGGGATTAACACTCTCCGCCTGAAACACTTTCAGGTCCTATGTA
TTTTACACATACACTATTAAAAGTAACAGAACGATTCAATGGGCTTCCAAGCCTATAAACTATATACAAC
TTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATT
GCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCGTTGGTATTCCGACGAGCATGCCTG
TTTGAGTGTCATTAAATTCTCAACCTCAACACTTTTGTGATTGATGGCTTGGATGTGGAGGTTTTTCTGC
AGGCTGTTAAAGTCTGCTCCTCTCAAATGAATTAGTGGGTGCCCCGCGCAAACCTATCTATTGGTGTGAT
AATTATCTACGCCGTGGATTATAGGATTGCTGTAAAAAGGTGTTTGCCCTGCTTCTAACCGTCCCCTTTG
TTGGGACAACTTGAACCATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATA


Tacodude, it is best to photograph these things on a dark background.  The white plate is making the camera turn down the exposure, making the gills look blacker than they are.  Also try both with and without flash, often the flash can bring out dark colors that are otherwise hard to see.

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: Alan Rockefeller]
    #26017252 -

Been discussing it with another local member who is pretty knowledgeable and helped me conclude they're likely foe... Also what Alan said about clusters. Here's a few more shots to clarify

Edit: Alan just working with what I got while out, but you're likely right that they are inactive foe I now have tons of.  I'd submit it for gene bank of that would be useful, but it would have to be where I can bring it in person


Edit 2: Also what to do with a bunch of foe? I might as well make them into a meal. What window of time do I have to cook them fresh where if I'm cooking lanter I'll need to dry and hydrate them to eat

Edited by tacodude (05/27/19 10:13 PM)

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: tacodude]
    #26017257 -

tacodude said:
Again why is the one facing up a cint to you? I believe they are all the same kind as they were all in the same location spread apart with only 2 or 3 at most growing near eachother. I honestly think they are all the same culture spread out over the area I looked as theres no fruits in the area so if ones a cint they all likely are just as if they aren't. I think I saw some spores, but I'm outside at a friends birthday where everything seems to keep knocking over the bowl so I cant even get enough of a print to check the color. Although I do believe I saw a faint bit of black spores, but still waiting


I'd almost guarantee they're all foes. I'm not sure what the motive is but if it's to eat then I'd be almost positive that consuming that whole plate would have no effect. Maybe just a bit sleepy.

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: DdaShroom] * 1
    #26017292 -

In case it might be helpful, here are the key macroscopic differences between cincts and foes according to the old NAS Field Guide (c)1995:

Cap Coloration:
Cincts:  More of a reddish brown (referred to as "Tawny"  in field guide), fading to tan.
Foes:  More regular brown, fading to tan.

Cracks in cap with age/drying:
Cincts: Not noted
Foes:  Yes

Cap width:
Cincts: 3-5mm
Foes:  1-3mm

Stalk width:
Cincts: 3-5mm
Foes: 1.5-3mm

Stalk color and texture:
Cincts: Reddish Brown, covered with whitish hairs
Foes: Pallid, smooth

Gill spacing:
Cincts: "Close"
Foes: "Nearly Distant"

Gills Coloration:
Cincts: Brownish to Blackish
Foes: Dark Brown to Violet Brown

Habitat:
Cincts: "on dung or manured soil; often in gardens"
Foes: "in grass"


So many things point to foes IMO, especially noting some clear violet hues in the gill coloration of the first pic when examining in Photoshop. This is a foes trait not a cinct trait Hope helps. Cheers!

D

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: Doug295]
    #26017318 -

Doug295 THANK YOU! Exactly what I wanted. They're all foe sure, but now that I know about the difference in stem color I'll be able to tell right on the spot

Edit: Add far as wondering if they are active at all is because I don't want to eat them as food and begin to trip... Foe completely inactive then? If so what's a good recipie?

Edited by tacodude (05/27/19 10:55 PM)

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: tacodude]
    #26017350 -

tacodude, you're welcome! The whole cincts vs. foes thing fascinates me. Interestingly, I'm in the bay area as well, I think I've had both species growing in my backyard. The ones I believe were cincts came up where we had an old flower container with old container soil that had spilled and mixed with the native soil. Unfortunately it was a very sparse fruiting, they were small, and I'm doubtful they will pop up again due to lack of substrate. Being in the urban bay area, horse manure compost piles with public access are hard to come by. I'll be keeping my eye on well irrigated maintained garden areas, especially as we get into summer.

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: Alan Rockefeller]
    #26017453 -

Alan Rockefeller said:
lowbrow said:
You’re really going against the scientific grain on this one.  Can we see this evidence instead of ‘because I said so’.



Here's a sequence from a grass "cinct"

AGGGTTCCGTAGTGACCTGCGGAGGATCATTATCGAATAAACTAGGTGGGTTGTTGCTGTCCCTCTCGGG
GGAATTGTGCACACCTTACCTTTTTTGTTTTTCCACCTGTGCACACACTGTAGGTCTGAAGGAGGGGAAG
GGGGGGGAAGTAACACTCTCCCCCTGAAACACTTTCAGGTCCTATGTATTTTACACATACACTATTAAAA
GTAACAGAACGATTCAATGGGCTTCCAAGCCTATAAACTATATACAACTTTCAGCAACGGATCTCTTGGC
TCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGA
ATCTTTGAACGCACCTTGCGCTCGTTGGTATTCCGACAAGCATGCCTGTTTGAGTGTCATTAAATTCTCA
ACCTCAACACTTTTGTGATTGATGGCTTGGATGTGGAGGTTTTTCTGCAGGCTGTTAAAGTCTGCTCCTC
TCAAATGAATTAGTGGGTGCCCCGCGCAAACCTATCTATTGGTGTGATAATTATCTACGCCGTGGATTAT
AGGATTGCTGTAAAAAGGTGTTTGCCCTGCTTCTAACCGTCCCCTCTGTTGGGACAACTTGAACCATTTG
ACCTCAGATCAAGTAGGACTACCCCCTGAACTTAACCATATCCATAAG

And here is one from a dung Panaeolus cinctulus:

GGGTTGTTGCTGTCCCTCTCGGGGGAATTGTGCACACCTTACCTTTTTTGTTTTTCCACCTGTGCACACA
CTGTAGGTCTGAAGGAGGGGAAGGGGGGGGATTAACACTCTCCGCCTGAAACACTTTCAGGTCCTATGTA
TTTTACACATACACTATTAAAAGTAACAGAACGATTCAATGGGCTTCCAAGCCTATAAACTATATACAAC
TTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATT
GCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCGTTGGTATTCCGACGAGCATGCCTG
TTTGAGTGTCATTAAATTCTCAACCTCAACACTTTTGTGATTGATGGCTTGGATGTGGAGGTTTTTCTGC
AGGCTGTTAAAGTCTGCTCCTCTCAAATGAATTAGTGGGTGCCCCGCGCAAACCTATCTATTGGTGTGAT
AATTATCTACGCCGTGGATTATAGGATTGCTGTAAAAAGGTGTTTGCCCTGCTTCTAACCGTCCCCTTTG
TTGGGACAACTTGAACCATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATA


Tacodude, it is best to photograph these things on a dark background.  The white plate is making the camera turn down the exposure, making the gills look blacker than they are.  Also try both with and without flash, often the flash can bring out dark colors that are otherwise hard to see.


There's nothing scientific about what you posted.  After this gaslighting attempt I’m going to assume you know nothing about pan Subbs.


--------------------
Amanita86 said:
Sui is trying to mod right now.  Kinda like a newborn calf tryin ta stand fer the first time ain’t it..

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: lowbrow] * 1
    #26017467 -

All your own evidence for your personal claim thus far ironically is because you said so....

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: Cawtz]
    #26017470 -

Cawtz said:
All your own evidence for your personal claim thus far ironically is because you said so....


So far that’s Rockefeller’s evidence, not mine, and it sucks.


--------------------
Amanita86 said:
Sui is trying to mod right now.  Kinda like a newborn calf tryin ta stand fer the first time ain’t it..

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: tacodude]
    #26017483 -



Left side is first area pictured the right is grassy field (triangle at 42 F south  east side)


The camera food mode turned out pretty good




I'm starting to think they aren't all foe... the 2 stems together in the bottom are not known which they came from, but they're different from the solid ones.  The left side

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: tacodude] * 1
    #26017485 -

lowbrow said:
So far that’s Rockefeller’s evidence, not mine, and it sucks.


Username checks out.

tacodude said:
I'm starting to think they aren't all foe... the 2 stems together in the bottom are not known which they came from, but they're different from the solid ones.  The left side



Check to see if the spores are smooth or ornamented with a microscope at 1000x.

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: tacodude]
    #26017488 -

tacodude said:


Left side is first area pictured the right is grassy field (triangle at 42 F south  east side)
00



I'm starting to think they aren't all foe... the 2 stems together in the bottom are not known which they came from, but they're different from the solid ones.  The left side


This is awesome.  If you want to get into the cinct. game, this is exactly what you got to do.

From what I’m seeing, chances they’re all foes, but so what. Give them 24 hours and see the results.


--------------------
Amanita86 said:
Sui is trying to mod right now.  Kinda like a newborn calf tryin ta stand fer the first time ain’t it..

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: Alan Rockefeller]
    #26017694 -

Alan Rockefeller said:
lowbrow said:
So far that’s Rockefeller’s evidence, not mine, and it sucks.


Username checks out.

tacodude said:
I'm starting to think they aren't all foe... the 2 stems together in the bottom are not known which they came from, but they're different from the solid ones.  The left side



Check to see if the spores are smooth or ornamented with a microscope at 1000x.


Got one for me to use? Want to buy me one?: D I'm pretty sure you know I'm struggling if you remember me out of all those you meet. Anyways they're all foe sure. I'd do a picture, but they look black in picture and without light, but they are a clear light brown with the flashlight on them. Hopefully I can get space to play with agar soon

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: tacodude]
    #26017724 -

So morning update they are all light brown spores so I'll just use them to learn how to do the cardboard method so I can start an alleni and/or cyan culture when I collect some more this season unless there's a way I can do it from the air dried and stored with silica gel packets from various things (fent test, jerky, zofran bottle) that I tried rubbing the spores off attempting to collect them that stain some still.

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: tacodude]
    #26017730 -

Cardboard method won’t work with these as they aren’t woodlovers

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: Doug295]
    #26021613 -

Doug295 said:
tacodude, you're welcome! The whole cincts vs. foes thing fascinates me. Interestingly, I'm in the bay area as well, I think I've had both species growing in my backyard. The ones I believe were cincts came up where we had an old flower container with old container soil that had spilled and mixed with the native soil. Unfortunately it was a very sparse fruiting, they were small, and I'm doubtful they will pop up again due to lack of substrate. Being in the urban bay area, horse manure compost piles with public access are hard to come by. I'll be keeping my eye on well irrigated maintained garden areas, especially as we get into summer.




These things grow like crazy... That's at least a lb fresh.... I have a bunch of alleni so that's not the issue. I did ask the police horse field worker about poop for mushroom farms and she says Saturday and Sunday 7-9 or something they allow the public first come, first serve for some free horse poop. Every other day of the week it goes to the park gardeners who spread it around the parks. That would explain cints popping up in grass here in the city without being some unidentified variety.... Seriously that was all one grassy field near the buffalo pits. These things grow like crazy. It's too bad they aren't even a little active, but could make an excellent food source due to their abunduance. If only they were even a little active. Some do seem like bruised blue color when older, but I'm guessing it's sun burnt


Edit: To the guy being a dick to Alan I know you got a hard on hoping you can tell some online hunter they got active shrooms so you can hopefully circle jerk on how awesome it will be to trip, but that's really not my interest.... The QP of alleni once dried I found during the Berkley group hunt a while back where I was able to even hook some people up with fruits to print and trip I still have a good oz left where at most I've eaten around 20 grams probably with a good 10 being micro doses... Anyways to say the least I got respect for Alan as he actually travels to explore mythology regularly discovering new undiscovered fungus even more than one psilocybin or at least prime specimens of hardly documented mushrooms as well as teaches people in person pretty well, where some things I think aren't the best like passing non edible mushroom clusters for inexperienced mycologist to pass around when there are some foolish enough to think they are active and even more foolish to the point they will eat whatever they see and the chewing anything to taste as long as it is spat out is bad because there is sublingual/buccal absorption that could happen, but in general he's an excellent teacher on top of being an expert. Just saying. Anyways please show some respect where it's deserved in my thread unless you want me to call you out.

Edited by tacodude (05/29/19 09:08 PM)

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: tacodude]
    #26021900 -

tacodude said:
Edit: To the guy being a dick to Alan I know you got a hard on hoping you can tell some online hunter they got active shrooms so you can hopefully circle jerk on how awesome it will be to trip, but that's really not my interest.... The QP of alleni once dried I found during the Berkley group hunt a while back where I was able to even hook some people up with fruits to print and trip I still have a good oz left where at most I've eaten around 20 grams probably with a good 10 being micro doses... Anyways to say the least I got respect for Alan as he actually travels to explore mythology regularly discovering new undiscovered fungus even more than one psilocybin or at least prime specimens of hardly documented mushrooms as well as teaches people in person pretty well, where some things I think aren't the best like passing non edible mushroom clusters for inexperienced mycologist to pass around when there are some foolish enough to think they are active and even more foolish to the point they will eat whatever they see and the chewing anything to taste as long as it is spat out is bad because there is sublingual/buccal absorption that could happen, but in general he's an excellent teacher on top of being an expert. Just saying. Anyways please show some respect where it's deserved in my thread unless you want me to call you out.

If you read the thread he was the one being a dick to me.


--------------------
Amanita86 said:
Sui is trying to mod right now.  Kinda like a newborn calf tryin ta stand fer the first time ain’t it..

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: lowbrow]
    #26021968 -

lowbrow said:
If you read the thread he was the one being a dick to me.



That is not true - I was politely teaching you and you took it poorly.


Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: tacodude] * 1
    #26021971 -

tacodude said:
Alan Rockefeller said:
Check to see if the spores are smooth or ornamented with a microscope at 1000x.


Got one for me to use? Want to buy me one?


I have an old microscope you can have which works and has good optics but comes with some mechanical issues - it needs a light source so you could use a lamp and a mirror or a LED headlamp, and the stage slowly goes down so you need to prop it up with a stack of microscope slides or something. 

There are also working microscopes that you can use at the Oakland lab.

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: lowbrow] * 2
    #26021972 -

lowbrow said:
If you read the thread he was the one being a dick to me.


I've been following this all day man and you just came across as arrogant towards someone who has proven him self a pro in this field. He was just politely expressing his view and you were saying it was trash which imo is a dick move.


--------------------

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: Longwhitecloud9]
    #26021989 -

Longwhitecloud9 said:
lowbrow said:
If you read the thread he was the one being a dick to me.


I've been following this all day man and you just came across as arrogant towards someone who has proven him self a pro in this field. He was just politely expressing his view and you were saying it was trash which imo is a dick move.


No.  I asked for evidence in a formal and fairly polite manner(which I have done before).  He supplied me with a string of letters he knows I have no way of translating.  That is a dick move.  But he’s got plenty of white knights that would take his side even if he stomped a puppy to death and used a pic of it as his avatar.

It’s highly unscientific to post ‘cintinculus don’t grow in grass’ without any evidence.  To say ‘I’m in the process of investigating the possibility of the species we refer to as cinctinculus that grows in well manured lawns being a completely different species’ would be appropriate.


Making a blanket statement without any scientific evidence and when confronted on it you produce a random letter sequence that you know cannot be translated, well defend that if you want, but that’s considered an intellectually dishonest tactic in any book.


--------------------
Amanita86 said:
Sui is trying to mod right now.  Kinda like a newborn calf tryin ta stand fer the first time ain’t it..

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: lowbrow] * 2
    #26021994 -

lowbrow said:
Alan Rockefeller said:
lowbrow said:
You’re really going against the scientific grain on this one.  Can we see this evidence instead of ‘because I said so’.


Literal ITS sequences


There's nothing scientific about what you posted.  After this gaslighting attempt I’m going to assume you know nothing about pan Subbs.


TIL that sequencing something isn't "scientific" and doesn't have any ability to show that something isn't a Pan. cinct..


--------------------
The Official Kiwi Cultivators Thread - for those of us looking for New Zealand-specific assistance!

Check my journal for my attempts at growing mushrooms!

"Don't accept that what's happening
Is just a case of others' suffering
Or you'll find that you're joining in
The turning away"

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: lowbrow] * 1
    #26021997 -

lowbrow said:
He supplied me with a string of letters he knows I have no way of translating.


It's two DNA sequences. Google for an alignment tool and plug both of those into it. It's very clear that there's several substitutions and insertions. Thus it's very clear that the Pan. sp. one finds growing in grass is not Pan. cinct..

lowbrow said:
You’re really going against the scientific grain on this one.  Can we see this evidence instead of ‘because I said so’.



Your definition of "polite" is seemingly rather different than everyone else's...


--------------------
The Official Kiwi Cultivators Thread - for those of us looking for New Zealand-specific assistance!

Check my journal for my attempts at growing mushrooms!

"Don't accept that what's happening
Is just a case of others' suffering
Or you'll find that you're joining in
The turning away"

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: Dunedinite]
    #26022003 -

Hey Alan, if no one wants the microscope I'll take it. Don't mind paying for it, I'm struggling to find a cheap one I can use to learn the basics of microscopy

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: chipsandwich]
    #26022023 -

chipsandwich said:
Hey Alan, if no one wants the microscope I'll take it. Don't mind paying for it, I'm struggling to find a cheap one I can use to learn the basics of microscopy


I feel like once cost of shipping over here is factored in you'll almost be at the point of being able to buy one hahaha.


--------------------
The Official Kiwi Cultivators Thread - for those of us looking for New Zealand-specific assistance!

Check my journal for my attempts at growing mushrooms!

"Don't accept that what's happening
Is just a case of others' suffering
Or you'll find that you're joining in
The turning away"

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: lowbrow]
    #26022025 -

lowbrow said:
Longwhitecloud9 said:
lowbrow said:
If you read the thread he was the one being a dick to me.


I've been following this all day man and you just came across as arrogant towards someone who has proven him self a pro in this field. He was just politely expressing his view and you were saying it was trash which imo is a dick move.


No.  I asked for evidence in a formal and fairly polite manner(which I have done before).  He supplied me with a string of letters he knows I have no way of translating.  That is a dick move.  But he’s got plenty of white knights that would take his side even if he stomped a puppy to death and used a pic of it as his avatar.

It’s highly unscientific to post ‘cintinculus don’t grow in grass’ without any evidence.  To say ‘I’m in the process of investigating the possibility of the species we refer to as cinctinculus that grows in well manured lawns being a completely different species’ would be appropriate.


Making a blanket statement without any scientific evidence and when confronted on it you produce a random letter sequence that you know cannot be translated, well defend that if you want, but that’s considered an intellectually dishonest tactic in any book.


If you really want to identify a mushroom and be 100% certain take it to a lab. Give them a DNA sequence and ask them to see if the specimen you gave them matches the sequence. I think he was just trying to make a point because you were already just coming out saying he was blatantly wrong. I'm not saying this because I'm some big Alan fan or some other bs like that. I'm saying this because I think you were being a dick and being rude.


--------------------

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: Dunedinite]
    #26022064 -

Dunedinite said:
chipsandwich said:
Hey Alan, if no one wants the microscope I'll take it. Don't mind paying for it, I'm struggling to find a cheap one I can use to learn the basics of microscopy


I feel like once cost of shipping over here is factored in you'll almost be at the point of being able to buy one hahaha.


Yeah, that's the problem all the ones I can find at a reasonable price become stupidly expensive when international shipping is factored in. Do you know anywhere in NZ I can start? Don't want to jump straight in and purchase good equipment if I find out it's not for me

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: chipsandwich]
    #26022084 -

chipsandwich said:
Dunedinite said:
chipsandwich said:
Hey Alan, if no one wants the microscope I'll take it. Don't mind paying for it, I'm struggling to find a cheap one I can use to learn the basics of microscopy


I feel like once cost of shipping over here is factored in you'll almost be at the point of being able to buy one hahaha.


Yeah, that's the problem all the ones I can find at a reasonable price become stupidly expensive when international shipping is factored in. Do you know anywhere in NZ I can start? Don't want to jump straight in and purchase good equipment if I find out it's not for me


I haven't gotten around to it, but you might be able to email the botany, microbiology or biochemistry departments and ask if you'd be able to use their microscopes. Might even be able to hit up the CELS191 coordinator and ask if you can use the dodgy undergrad scopes they use.


--------------------
The Official Kiwi Cultivators Thread - for those of us looking for New Zealand-specific assistance!

Check my journal for my attempts at growing mushrooms!

"Don't accept that what's happening
Is just a case of others' suffering
Or you'll find that you're joining in
The turning away"

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: Dunedinite]
    #26022133 -

Dunedinite said:
chipsandwich said:
Dunedinite said:
chipsandwich said:
Hey Alan, if no one wants the microscope I'll take it. Don't mind paying for it, I'm struggling to find a cheap one I can use to learn the basics of microscopy


I feel like once cost of shipping over here is factored in you'll almost be at the point of being able to buy one hahaha.


Yeah, that's the problem all the ones I can find at a reasonable price become stupidly expensive when international shipping is factored in. Do you know anywhere in NZ I can start? Don't want to jump straight in and purchase good equipment if I find out it's not for me


I haven't gotten around to it, but you might be able to email the botany, microbiology or biochemistry departments and ask if you'd be able to use their microscopes. Might even be able to hit up the CELS191 coordinator and ask if you can use the dodgy undergrad scopes they use.


Thanks, CELS191 was one of my favorite papers. Would rather play round in the safety of my own home though, I'll keep looking

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: Alan Rockefeller]
    #26022142 -

Alan Rockefeller said:
tacodude said:
Alan Rockefeller said:
Check to see if the spores are smooth or ornamented with a microscope at 1000x.


Got one for me to use? Want to buy me one?


I have an old microscope you can have which works and has good optics but comes with some mechanical issues - it needs a light source so you could use a lamp and a mirror or a LED headlamp, and the stage slowly goes down so you need to prop it up with a stack of microscope slides or something. 

There are also working microscopes that you can use at the Oakland lab.

Well I still want to check the honey fungus... They are growing like crazy right now and easy to find, but no cint.

I saw a couple those wierd red ones and a huge couple inky caps. I'm going try to used dried grass left behind from mowing that's mostly sun dried and some soil from the edge of a redwood basin that I also mixed with redwood in another jar where I put a couple alleni caps I broke then dropped sterile water directly on with the caps and stem bits of the pan in the grass and dirt. Hopefully I see some colonization to play with

Edit: I also half jokingly made the statement as Alan and I are local, but definitely would be down to take the scope as I really want to check the honey mushroom I printed a while back.

Edited by tacodude (05/30/19 04:53 AM)

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: lowbrow] * 2
    #26022182 -

lowbrow said:
No.  I asked for evidence in a formal and fairly polite manner(which I have done before).  He supplied me with a string of letters he knows I have no way of translating.  That is a dick move.


I gave you the DNA sequences of both species!  You could have asked how to interpret them rather than get angry.


Quote:
It’s highly unscientific to post ‘cintinculus don’t grow in grass’ without any evidence.



I gave you the raw data - that's a lot better than pointing to some paper or book.  Most researchers don't share their raw data before it's been published for fear that someone will scoop them.

Quote:
you produce a random letter sequence that you know cannot be translated, well defend that if you want, but that’s considered an intellectually dishonest tactic in any book.


It is not difficult to interpret DNA sequences - you can paste them into the query box at https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome to see what they are related to.  To compare two, you click the "Align two or more sequences" box, put one sequence in each query box and click BLAST.

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: Alan Rockefeller]
    #26022631 -

Really,  you obviously are here to troll, he posted DNA sequencing from the ITS region, it is used to identify to the species level, so, don't be a jerk and try remaing teachable. Alan is trying to show you that they have different DNA sequences and means they are not the same species but something that is undescribed at the moment.


--------------------


Psilocybe cubensis data collection thread. please help with this project if you hunt wild cubensis.
https://www.shroomery.org/forums/showflat.php?Cat=0&Number=26513593&page=0&vc=1#26513593

Edited by Doc9151 (05/30/19 02:34 PM)

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: Doc9151]
    #26022691 -

Doc9151 said:
Really,  you obviously are here to troll, he posted DNA sequencing from the ITS region, it is used to identify to the species level, so, don't be a jerk and try remaking teachable. Alan is trying to show you that they have different DNA sequences and means they are not the same species but something that is undescribed at the moment.


I challenged the voracity of a claim.  Calling that trolling is in error.


--------------------
Amanita86 said:
Sui is trying to mod right now.  Kinda like a newborn calf tryin ta stand fer the first time ain’t it..

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: lowbrow] * 1
    #26023108 -

lowbrow said:
Doc9151 said:
Really,  you obviously are here to troll, he posted DNA sequencing from the ITS region, it is used to identify to the species level, so, don't be a jerk and try remaking teachable. Alan is trying to show you that they have different DNA sequences and means they are not the same species but something that is undescribed at the moment.


I challenged the voracity of a claim.  Calling that trolling is in error.


You mean veracity, and you didn't challenge it in any way, you dismissed it out of ignorance, that's not the same thing. To challenge it you would have had to point out faults in the methodology, which you didn't.


--------------------
How to add a picture to a post

Sample ID request - READ BEFORE POSTING AN ID REQUEST!

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: Duggstar] * 1
    #26023114 -

Duggstar said:
lowbrow said:
Doc9151 said:
Really,  you obviously are here to troll, he posted DNA sequencing from the ITS region, it is used to identify to the species level, so, don't be a jerk and try remaking teachable. Alan is trying to show you that they have different DNA sequences and means they are not the same species but something that is undescribed at the moment.


I challenged the voracity of a claim.  Calling that trolling is in error.


You mean veracity, and you didn't challenge it in any way, you dismissed it out of ignorance, that's not the same thing. To challenge it you would have had to point out faults in the methodology, which you didn't.


I’m done with this conversation.


--------------------
Amanita86 said:
Sui is trying to mod right now.  Kinda like a newborn calf tryin ta stand fer the first time ain’t it..

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: lowbrow] * 1
    #26023263 -

lowbrow said:
Duggstar said:
lowbrow said:
Doc9151 said:
Really,  you obviously are here to troll, he posted DNA sequencing from the ITS region, it is used to identify to the species level, so, don't be a jerk and try remaking teachable. Alan is trying to show you that they have different DNA sequences and means they are not the same species but something that is undescribed at the moment.


I challenged the voracity of a claim.  Calling that trolling is in error.


You mean veracity, and you didn't challenge it in any way, you dismissed it out of ignorance, that's not the same thing. To challenge it you would have had to point out faults in the methodology, which you didn't.


I’m done with this conversation.


Lmao ok.

Gets schooled

Throws a tantrum

Has a cry

Runs away

Man your never gonna learn anything with a attitude like that. Just sit down and be humble. These guys are all still trying to teach you despite your poor attitude and they are still giving you tips on how you can interpret the information they've given you. That's more patience than most teachers I've met...


--------------------

Edited by Longwhitecloud9 (05/30/19 03:46 PM)

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: Longwhitecloud9]
    #26023499 -

Longwhitecloud9 said:
lowbrow said:
If you read the thread he was the one being a dick to me.


I've been following this all day man and you just came across as arrogant towards someone who has proven him self a pro in this field. He was just politely expressing his view and you were saying it was trash which imo is a dick move.


Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: DdaShroom] * 2
    #26023510 -

I truly promise I dont mean to add fuel to the fire but for anyone new to the site who is reading this all, there are two ways of learning and accepting info and education.

Since I have joined the site and asked for IDs I have always been humble to learn and thus in return every single person that has helped me and that I have come in contact with has been truly amazing to me and incredibly helpful so not only thank you all, but also, again to anyone reading, carry on in a respectful manner and it will benefit you in the long run.

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: DdaShroom]
    #26023874 -

Wow.  I haven't checked in here in awhile, and I see this drama.  Too funny.

Anyway, I am actually glad to see some DNA data on the 'Lawn-Cincts' as I used to call them.  I have corresponded briefly with Alan in the past, and would gladly send samples from here if he wants.  I hope that the weather in CO normalizes, and we get the return of these guys.

So, is this going to be a new active species?  Panaeolus Lawnii?????


--------------------
The more I see mushrooms, the more I see mushrooms. I swear it gets into you.

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: Gilzman]
    #26023890 -

Panaeolus lawnboii


--------------------
The Official Kiwi Cultivators Thread - for those of us looking for New Zealand-specific assistance!

Check my journal for my attempts at growing mushrooms!

"Don't accept that what's happening
Is just a case of others' suffering
Or you'll find that you're joining in
The turning away"

Extras: Filter Print Post Top
Re: More SF pans (cints?) *DELETED* [Re: Gilzman]
    #26023902 -

Post deleted by stevo

Reason for deletion: .

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: stevo]
    #26024074 -

stevo said:
Does the lawn "cinctulus" have abnormally oblique germ pores from your observations Alan?


I need to find the one I sequenced and scope it.

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: Alan Rockefeller] * 1
    #26024133 -

Alan Rockefeller said:
lowbrow said:
You’re really going against the scientific grain on this one.  Can we see this evidence instead of ‘because I said so’.



Here's a sequence from a grass "cinct"

AGGGTTCCGTAGTGACCTGCGGAGGATCATTATCGAATAAACTAGGTGGGTTGTTGCTGTCCCTCTCGGG
GGAATTGTGCACACCTTACCTTTTTTGTTTTTCCACCTGTGCACACACTGTAGGTCTGAAGGAGGGGAAG
GGGGGGGAAGTAACACTCTCCCCCTGAAACACTTTCAGGTCCTATGTATTTTACACATACACTATTAAAA
GTAACAGAACGATTCAATGGGCTTCCAAGCCTATAAACTATATACAACTTTCAGCAACGGATCTCTTGGC
TCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGA
ATCTTTGAACGCACCTTGCGCTCGTTGGTATTCCGACAAGCATGCCTGTTTGAGTGTCATTAAATTCTCA
ACCTCAACACTTTTGTGATTGATGGCTTGGATGTGGAGGTTTTTCTGCAGGCTGTTAAAGTCTGCTCCTC
TCAAATGAATTAGTGGGTGCCCCGCGCAAACCTATCTATTGGTGTGATAATTATCTACGCCGTGGATTAT
AGGATTGCTGTAAAAAGGTGTTTGCCCTGCTTCTAACCGTCCCCTCTGTTGGGACAACTTGAACCATTTG
ACCTCAGATCAAGTAGGACTACCCCCTGAACTTAACCATATCCATAAG

And here is one from a dung Panaeolus cinctulus:

GGGTTGTTGCTGTCCCTCTCGGGGGAATTGTGCACACCTTACCTTTTTTGTTTTTCCACCTGTGCACACA
CTGTAGGTCTGAAGGAGGGGAAGGGGGGGGATTAACACTCTCCGCCTGAAACACTTTCAGGTCCTATGTA
TTTTACACATACACTATTAAAAGTAACAGAACGATTCAATGGGCTTCCAAGCCTATAAACTATATACAAC
TTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATT
GCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCGTTGGTATTCCGACGAGCATGCCTG
TTTGAGTGTCATTAAATTCTCAACCTCAACACTTTTGTGATTGATGGCTTGGATGTGGAGGTTTTTCTGC
AGGCTGTTAAAGTCTGCTCCTCTCAAATGAATTAGTGGGTGCCCCGCGCAAACCTATCTATTGGTGTGAT
AATTATCTACGCCGTGGATTATAGGATTGCTGTAAAAAGGTGTTTGCCCTGCTTCTAACCGTCCCCTTTG
TTGGGACAACTTGAACCATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATA




Hey Alan, is the sequence above for "grass cinct" the accession MK394183.1? It matches it 100%, but that one is titled for Panaeolus fimicola, the collection of which was made in Maryland, USA, found in grass sports field.

Also, is the sequence above for "dung" variety the accession MH590045.1, the one that was found growing in garden soil in Los Angeles? It matches 100%. If so, Garden soil, dung, I guess they are similar enough eh? Although seems not too many garden soils use horse dung, it seems more often cow dung.

From what I am seeing in blast, then, the grass cincts are certainly a heck of lot closer to the dung/garden soil cincts then they are to foes, 98.41% identical compared to 92.36% identical. Maybe a subspecies not new species? Just wondering.

Cheers!

D

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: tacodude]
    #26024257 -

Are those psychedelic?

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: Doug295]
    #26024357 -

Doug295 said:
Hey Alan, is the sequence above for "grass cinct" the accession MK394183.1? It matches it 100%, but that one is titled for Panaeolus fimicola, the collection of which was made in Maryland, USA, found in grass sports field.


Yes.  It also matches 100% with a microscopically confirmed P. fimicola from Georgia which is not in Genbank.

Quote:
Also, is the sequence above for "dung" variety the accession MH590045.1, the one that was found growing in garden soil in Los Angeles? It matches 100%. If so, Garden soil, dung, I guess they are similar enough eh? Although seems not too many garden soils use horse dung, it seems more often cow dung.


Yes, pretty sure she was using garden soil which included manure.  It's pretty common to see these beefy P. cinctulus in houseplants with commercial potting soil.

Sure is nice when people reference Mushroom Observer #'s in their DNA sequences so you can see photos and other information about the collection.

Quote:
From what I am seeing in blast, then, the grass cincts are certainly a heck of lot closer to the dung/garden soil cincts then they are to foes, 98.41% identical compared to 92.36% identical. Maybe a subspecies not new species? Just wondering.



98.41% is enough to say it's a different species in the ITS gene - some recent papers have suggested a cutoff of 99.8% for ITS, however there really isn't and can never be an exact cutoff number.

I have a few more sequences which also point in this direction which I can't share publicly because they were given to me in confidence.    More sequences are very much needed.  I am about to go on the road for several months so I can't take additional collections now, but anyone who finds grass or dung P. cinctulus should take good photos and send dried material to http://alvalab.es and ask for an ITS sequence.  It will run about $20.  Then send the data to me and I'll help make sense of it.


Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: 96Romeo]
    #26024394 -

96Romeo said:
Are those psychedelic?


Not sure... Haven't cared to figure out. I tried to throw caps and stem butts in a jar with soil and dried mowed grass from the park to see if it will become a viable culture for the hell of it.... I doubt it 1k colonize at least without contam

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: tacodude]
    #26024476 -

@Alan

Would you agree with most of the points made in this paper?

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5368684/

Looking at the services provided, which is ITS?

http://www.alvalab.es/orders.html


--------------------
The more I see mushrooms, the more I see mushrooms. I swear it gets into you.

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: Dunedinite]
    #26024680 -

Dunedinite said:
Panaeolus lawnboii


:rofl: I like the name


--------------------


Psilocybe cubensis data collection thread. please help with this project if you hunt wild cubensis.
https://www.shroomery.org/forums/showflat.php?Cat=0&Number=26513593&page=0&vc=1#26513593

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: Gilzman]
    #26029181 -

Gilzman said:
Would you agree with most of the points made in this paper?

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5368684/


Yes.

Quote:
Looking at the services provided, which is ITS?

http://www.alvalab.es/orders.html


DNA Extraction, Standard Taq PCR Amplification, Purification and Sequencing.

Extras: Filter Print Post Top
Jump to top Pages: 1 | 2 | 3 | 4  [ show all ]

Shop: Original Sensible Seeds Autoflowering Cannabis Seeds   Myyco.com Golden Teacher Liquid Culture For Sale   Unfolding Nature Unfolding Nature: Being in the Implicate Order   Mushroom-Hut Liquid Cultures   MagicBag.co All-In-One Bags That Don't Suck   Sporeworks.EU Spores for European Microscopy   North Spore Bulk Substrate

Mushrooms, Mycology and Psychedelics > Mushroom Hunting and Identification
Threaded Mode Threaded  Previous topic Previous  View all topics Index  Next topic Next 

Similar ThreadsPosterViewsRepliesLast post
* pan cincts and edibles
( 1 2 all )		 trigger 3,003 25 07/15/10 11:06 PM
by SomeGuy
* help identifing mushrooms
( 1 2 all )		 codyrcollier14 7,557 24 09/28/14 09:02 AM
by ambc
* is it Panaeolus cinctulu? choomanfoo 5,695 11 05/26/13 08:20 PM
by choomanfoo
* Foes or Cints ID [Update for prints] MushroomPantheon 427 3 09/22/13 06:34 PM
by MushroomPantheon
* I think i finally found a Pann cint. Pics. underfliptown 1,200 19 07/10/13 08:29 PM
by Gravija
* Pann cints/ foes. Spectacle 609 5 10/23/12 03:07 AM
by Spectacle
* Pan Cint Preservation noluckhunterr 567 1 05/08/09 08:32 PM
by Engelsblut6
* need ID on shrooms found in SF area
( 1 2 all )		 adamlivesinCA 1,835 21 04/04/08 03:03 PM
by landsnorkler

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: ToxicMan, karode13, inski, Alan Rockefeller, Duggstar, TimmiT, Anglerfish, Tmethyl, Lucis, Doc9151, Land Trout
1,570 topic views. 0 members, 32 guests and 37 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2026 Mind Media. Some rights reserved.

Generated in 0.052 seconds spending 0.008 seconds on 14 queries.