Home | Community | Message Board

MagicBag Grow Bags
This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Shop: Mushroom-Hut Liquid Cultures   MagicBag.co All-In-One Bags That Don't Suck   Sporeworks.EU Spores for European Microscopy   Myyco.com Golden Teacher Liquid Culture For Sale   North Spore Bulk Substrate   Original Sensible Seeds Bulk Cannabis Seeds

Jump to first unread post Pages: | 1 | 2 | 3 | 4 |  [ show all ]
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
Re: More SF pans (cints?) [Re: tacodude]
    #26017257 -

tacodude said:
Again why is the one facing up a cint to you? I believe they are all the same kind as they were all in the same location spread apart with only 2 or 3 at most growing near eachother. I honestly think they are all the same culture spread out over the area I looked as theres no fruits in the area so if ones a cint they all likely are just as if they aren't. I think I saw some spores, but I'm outside at a friends birthday where everything seems to keep knocking over the bowl so I cant even get enough of a print to check the color. Although I do believe I saw a faint bit of black spores, but still waiting



I'd almost guarantee they're all foes. I'm not sure what the motive is but if it's to eat then I'd be almost positive that consuming that whole plate would have no effect. Maybe just a bit sleepy.

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: DdaShroom] * 1
    #26017292 -

In case it might be helpful, here are the key macroscopic differences between cincts and foes according to the old NAS Field Guide (c)1995:

Cap Coloration:
Cincts:  More of a reddish brown (referred to as "Tawny"  in field guide), fading to tan.
Foes:  More regular brown, fading to tan.

Cracks in cap with age/drying:
Cincts: Not noted
Foes:  Yes

Cap width:
Cincts: 3-5mm
Foes:  1-3mm

Stalk width:
Cincts: 3-5mm
Foes: 1.5-3mm

Stalk color and texture:
Cincts: Reddish Brown, covered with whitish hairs
Foes: Pallid, smooth

Gill spacing:
Cincts: "Close"
Foes: "Nearly Distant"

Gills Coloration:
Cincts: Brownish to Blackish
Foes: Dark Brown to Violet Brown

Habitat:
Cincts: "on dung or manured soil; often in gardens"
Foes: "in grass"


So many things point to foes IMO, especially noting some clear violet hues in the gill coloration of the first pic when examining in Photoshop. This is a foes trait not a cinct trait Hope helps. Cheers!

D

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: Doug295]
    #26017318 -

Doug295 THANK YOU! Exactly what I wanted. They're all foe sure, but now that I know about the difference in stem color I'll be able to tell right on the spot

Edit: Add far as wondering if they are active at all is because I don't want to eat them as food and begin to trip... Foe completely inactive then? If so what's a good recipie?

Edited by tacodude (05/27/19 10:55 PM)

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: tacodude]
    #26017350 -

tacodude, you're welcome! The whole cincts vs. foes thing fascinates me. Interestingly, I'm in the bay area as well, I think I've had both species growing in my backyard. The ones I believe were cincts came up where we had an old flower container with old container soil that had spilled and mixed with the native soil. Unfortunately it was a very sparse fruiting, they were small, and I'm doubtful they will pop up again due to lack of substrate. Being in the urban bay area, horse manure compost piles with public access are hard to come by. I'll be keeping my eye on well irrigated maintained garden areas, especially as we get into summer.

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: Alan Rockefeller]
    #26017453 -

Alan Rockefeller said:
lowbrow said:
You’re really going against the scientific grain on this one.  Can we see this evidence instead of ‘because I said so’.




Here's a sequence from a grass "cinct"

AGGGTTCCGTAGTGACCTGCGGAGGATCATTATCGAATAAACTAGGTGGGTTGTTGCTGTCCCTCTCGGG
GGAATTGTGCACACCTTACCTTTTTTGTTTTTCCACCTGTGCACACACTGTAGGTCTGAAGGAGGGGAAG
GGGGGGGAAGTAACACTCTCCCCCTGAAACACTTTCAGGTCCTATGTATTTTACACATACACTATTAAAA
GTAACAGAACGATTCAATGGGCTTCCAAGCCTATAAACTATATACAACTTTCAGCAACGGATCTCTTGGC
TCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGA
ATCTTTGAACGCACCTTGCGCTCGTTGGTATTCCGACAAGCATGCCTGTTTGAGTGTCATTAAATTCTCA
ACCTCAACACTTTTGTGATTGATGGCTTGGATGTGGAGGTTTTTCTGCAGGCTGTTAAAGTCTGCTCCTC
TCAAATGAATTAGTGGGTGCCCCGCGCAAACCTATCTATTGGTGTGATAATTATCTACGCCGTGGATTAT
AGGATTGCTGTAAAAAGGTGTTTGCCCTGCTTCTAACCGTCCCCTCTGTTGGGACAACTTGAACCATTTG
ACCTCAGATCAAGTAGGACTACCCCCTGAACTTAACCATATCCATAAG

And here is one from a dung Panaeolus cinctulus:

GGGTTGTTGCTGTCCCTCTCGGGGGAATTGTGCACACCTTACCTTTTTTGTTTTTCCACCTGTGCACACA
CTGTAGGTCTGAAGGAGGGGAAGGGGGGGGATTAACACTCTCCGCCTGAAACACTTTCAGGTCCTATGTA
TTTTACACATACACTATTAAAAGTAACAGAACGATTCAATGGGCTTCCAAGCCTATAAACTATATACAAC
TTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATT
GCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCGTTGGTATTCCGACGAGCATGCCTG
TTTGAGTGTCATTAAATTCTCAACCTCAACACTTTTGTGATTGATGGCTTGGATGTGGAGGTTTTTCTGC
AGGCTGTTAAAGTCTGCTCCTCTCAAATGAATTAGTGGGTGCCCCGCGCAAACCTATCTATTGGTGTGAT
AATTATCTACGCCGTGGATTATAGGATTGCTGTAAAAAGGTGTTTGCCCTGCTTCTAACCGTCCCCTTTG
TTGGGACAACTTGAACCATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATA


Tacodude, it is best to photograph these things on a dark background.  The white plate is making the camera turn down the exposure, making the gills look blacker than they are.  Also try both with and without flash, often the flash can bring out dark colors that are otherwise hard to see.



There's nothing scientific about what you posted.  After this gaslighting attempt I’m going to assume you know nothing about pan Subbs.


--------------------
Amanita86 said:
Sui is trying to mod right now.  Kinda like a newborn calf tryin ta stand fer the first time ain’t it..

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: lowbrow] * 1
    #26017467 -

All your own evidence for your personal claim thus far ironically is because you said so....

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: Cawtz]
    #26017470 -

Cawtz said:
All your own evidence for your personal claim thus far ironically is because you said so....



So far that’s Rockefeller’s evidence, not mine, and it sucks.


--------------------
Amanita86 said:
Sui is trying to mod right now.  Kinda like a newborn calf tryin ta stand fer the first time ain’t it..

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: tacodude]
    #26017483 -



Left side is first area pictured the right is grassy field (triangle at 42 F south  east side)


The camera food mode turned out pretty good




I'm starting to think they aren't all foe... the 2 stems together in the bottom are not known which they came from, but they're different from the solid ones.  The left side

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: tacodude] * 1
    #26017485 -

lowbrow said:
So far that’s Rockefeller’s evidence, not mine, and it sucks.



Username checks out.

tacodude said:
I'm starting to think they aren't all foe... the 2 stems together in the bottom are not known which they came from, but they're different from the solid ones.  The left side




Check to see if the spores are smooth or ornamented with a microscope at 1000x.

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: tacodude]
    #26017488 -

tacodude said:


Left side is first area pictured the right is grassy field (triangle at 42 F south  east side)
00



I'm starting to think they aren't all foe... the 2 stems together in the bottom are not known which they came from, but they're different from the solid ones.  The left side



This is awesome.  If you want to get into the cinct. game, this is exactly what you got to do.

From what I’m seeing, chances they’re all foes, but so what. Give them 24 hours and see the results.


--------------------
Amanita86 said:
Sui is trying to mod right now.  Kinda like a newborn calf tryin ta stand fer the first time ain’t it..

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: Alan Rockefeller]
    #26017694 -

Alan Rockefeller said:
lowbrow said:
So far that’s Rockefeller’s evidence, not mine, and it sucks.



Username checks out.

tacodude said:
I'm starting to think they aren't all foe... the 2 stems together in the bottom are not known which they came from, but they're different from the solid ones.  The left side




Check to see if the spores are smooth or ornamented with a microscope at 1000x.



Got one for me to use? Want to buy me one?: D I'm pretty sure you know I'm struggling if you remember me out of all those you meet. Anyways they're all foe sure. I'd do a picture, but they look black in picture and without light, but they are a clear light brown with the flashlight on them. Hopefully I can get space to play with agar soon

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: tacodude]
    #26017724 -

So morning update they are all light brown spores so I'll just use them to learn how to do the cardboard method so I can start an alleni and/or cyan culture when I collect some more this season unless there's a way I can do it from the air dried and stored with silica gel packets from various things (fent test, jerky, zofran bottle) that I tried rubbing the spores off attempting to collect them that stain some still.

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: tacodude]
    #26017730 -

Cardboard method won’t work with these as they aren’t woodlovers

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: Doug295]
    #26021613 -

Doug295 said:
tacodude, you're welcome! The whole cincts vs. foes thing fascinates me. Interestingly, I'm in the bay area as well, I think I've had both species growing in my backyard. The ones I believe were cincts came up where we had an old flower container with old container soil that had spilled and mixed with the native soil. Unfortunately it was a very sparse fruiting, they were small, and I'm doubtful they will pop up again due to lack of substrate. Being in the urban bay area, horse manure compost piles with public access are hard to come by. I'll be keeping my eye on well irrigated maintained garden areas, especially as we get into summer.





These things grow like crazy... That's at least a lb fresh.... I have a bunch of alleni so that's not the issue. I did ask the police horse field worker about poop for mushroom farms and she says Saturday and Sunday 7-9 or something they allow the public first come, first serve for some free horse poop. Every other day of the week it goes to the park gardeners who spread it around the parks. That would explain cints popping up in grass here in the city without being some unidentified variety.... Seriously that was all one grassy field near the buffalo pits. These things grow like crazy. It's too bad they aren't even a little active, but could make an excellent food source due to their abunduance. If only they were even a little active. Some do seem like bruised blue color when older, but I'm guessing it's sun burnt


Edit: To the guy being a dick to Alan I know you got a hard on hoping you can tell some online hunter they got active shrooms so you can hopefully circle jerk on how awesome it will be to trip, but that's really not my interest.... The QP of alleni once dried I found during the Berkley group hunt a while back where I was able to even hook some people up with fruits to print and trip I still have a good oz left where at most I've eaten around 20 grams probably with a good 10 being micro doses... Anyways to say the least I got respect for Alan as he actually travels to explore mythology regularly discovering new undiscovered fungus even more than one psilocybin or at least prime specimens of hardly documented mushrooms as well as teaches people in person pretty well, where some things I think aren't the best like passing non edible mushroom clusters for inexperienced mycologist to pass around when there are some foolish enough to think they are active and even more foolish to the point they will eat whatever they see and the chewing anything to taste as long as it is spat out is bad because there is sublingual/buccal absorption that could happen, but in general he's an excellent teacher on top of being an expert. Just saying. Anyways please show some respect where it's deserved in my thread unless you want me to call you out.

Edited by tacodude (05/29/19 09:08 PM)

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: tacodude]
    #26021900 -

tacodude said:
Edit: To the guy being a dick to Alan I know you got a hard on hoping you can tell some online hunter they got active shrooms so you can hopefully circle jerk on how awesome it will be to trip, but that's really not my interest.... The QP of alleni once dried I found during the Berkley group hunt a while back where I was able to even hook some people up with fruits to print and trip I still have a good oz left where at most I've eaten around 20 grams probably with a good 10 being micro doses... Anyways to say the least I got respect for Alan as he actually travels to explore mythology regularly discovering new undiscovered fungus even more than one psilocybin or at least prime specimens of hardly documented mushrooms as well as teaches people in person pretty well, where some things I think aren't the best like passing non edible mushroom clusters for inexperienced mycologist to pass around when there are some foolish enough to think they are active and even more foolish to the point they will eat whatever they see and the chewing anything to taste as long as it is spat out is bad because there is sublingual/buccal absorption that could happen, but in general he's an excellent teacher on top of being an expert. Just saying. Anyways please show some respect where it's deserved in my thread unless you want me to call you out.


If you read the thread he was the one being a dick to me.


--------------------
Amanita86 said:
Sui is trying to mod right now.  Kinda like a newborn calf tryin ta stand fer the first time ain’t it..

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: lowbrow]
    #26021968 -

lowbrow said:
If you read the thread he was the one being a dick to me.




That is not true - I was politely teaching you and you took it poorly.


Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: tacodude] * 1
    #26021971 -

tacodude said:
Alan Rockefeller said:
Check to see if the spores are smooth or ornamented with a microscope at 1000x.



Got one for me to use? Want to buy me one?



I have an old microscope you can have which works and has good optics but comes with some mechanical issues - it needs a light source so you could use a lamp and a mirror or a LED headlamp, and the stage slowly goes down so you need to prop it up with a stack of microscope slides or something. 

There are also working microscopes that you can use at the Oakland lab.

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: lowbrow] * 2
    #26021972 -

lowbrow said:
If you read the thread he was the one being a dick to me.



I've been following this all day man and you just came across as arrogant towards someone who has proven him self a pro in this field. He was just politely expressing his view and you were saying it was trash which imo is a dick move.


--------------------

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: Longwhitecloud9]
    #26021989 -

Longwhitecloud9 said:
lowbrow said:
If you read the thread he was the one being a dick to me.



I've been following this all day man and you just came across as arrogant towards someone who has proven him self a pro in this field. He was just politely expressing his view and you were saying it was trash which imo is a dick move.



No.  I asked for evidence in a formal and fairly polite manner(which I have done before).  He supplied me with a string of letters he knows I have no way of translating.  That is a dick move.  But he’s got plenty of white knights that would take his side even if he stomped a puppy to death and used a pic of it as his avatar.

It’s highly unscientific to post ‘cintinculus don’t grow in grass’ without any evidence.  To say ‘I’m in the process of investigating the possibility of the species we refer to as cinctinculus that grows in well manured lawns being a completely different species’ would be appropriate.


Making a blanket statement without any scientific evidence and when confronted on it you produce a random letter sequence that you know cannot be translated, well defend that if you want, but that’s considered an intellectually dishonest tactic in any book.


--------------------
Amanita86 said:
Sui is trying to mod right now.  Kinda like a newborn calf tryin ta stand fer the first time ain’t it..

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: lowbrow] * 2
    #26021994 -

lowbrow said:
Alan Rockefeller said:
lowbrow said:
You’re really going against the scientific grain on this one.  Can we see this evidence instead of ‘because I said so’.



Literal ITS sequences



There's nothing scientific about what you posted.  After this gaslighting attempt I’m going to assume you know nothing about pan Subbs.



TIL that sequencing something isn't "scientific" and doesn't have any ability to show that something isn't a Pan. cinct..


--------------------
The Official Kiwi Cultivators Thread - for those of us looking for New Zealand-specific assistance!

Check my journal for my attempts at growing mushrooms!

"Don't accept that what's happening
Is just a case of others' suffering
Or you'll find that you're joining in
The turning away"

Extras: Filter Print Post Top
Jump to top Pages: | 1 | 2 | 3 | 4 |  [ show all ]

Shop: Mushroom-Hut Liquid Cultures   MagicBag.co All-In-One Bags That Don't Suck   Sporeworks.EU Spores for European Microscopy   Myyco.com Golden Teacher Liquid Culture For Sale   North Spore Bulk Substrate   Original Sensible Seeds Bulk Cannabis Seeds


Similar ThreadsPosterViewsRepliesLast post
* pan cincts and edibles
( 1 2 all )
trigger 3,016 25 07/15/10 11:06 PM
by SomeGuy
* help identifing mushrooms
( 1 2 all )
codyrcollier14 7,573 24 09/28/14 09:02 AM
by ambc
* is it Panaeolus cinctulu? choomanfoo 5,712 11 05/26/13 08:20 PM
by choomanfoo
* Foes or Cints ID [Update for prints] MushroomPantheon 430 3 09/22/13 06:34 PM
by MushroomPantheon
* I think i finally found a Pann cint. Pics. underfliptown 1,201 19 07/10/13 08:29 PM
by Gravija
* Pann cints/ foes. Spectacle 610 5 10/23/12 03:07 AM
by Spectacle
* Pan Cint Preservation noluckhunterr 569 1 05/08/09 08:32 PM
by Engelsblut6
* need ID on shrooms found in SF area
( 1 2 all )
adamlivesinCA 1,836 21 04/04/08 03:03 PM
by landsnorkler

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: ToxicMan, karode13, inski, Alan Rockefeller, Duggstar, TimmiT, Anglerfish, Tmethyl, Lucis, Doc9151, Land Trout
1,574 topic views. 0 members, 629 guests and 45 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2026 Mind Media. Some rights reserved.

Generated in 0.028 seconds spending 0.006 seconds on 16 queries.