Home | Community | Message Board

MagicBag Grow Bags
This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Shop: Myyco.com Isolated Cubensis Liquid Culture For Sale   Mushroom-Hut Liquid Cultures   Original Sensible Seeds Autoflowering Cannabis Seeds   MagicBag.co All-In-One Bags That Don't Suck   Sporeworks.EU Spores for European Microscopy   North Spore Injection Grain Bag

Jump to first unread post Pages: 1 | 2 | 3 | 4 |  [ show all ]
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
More SF pans (cints?)
    #26016732 -



Finding them as we speak in grass at ggp... pan foe is non toxic so safe to eat even if

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: tacodude]
    #26016741 -

tacodude said:


Finding them as we speak in grass at ggp... pan foe is non toxic so safe to eat even if



I don’t know about the rest but the one with the gills facing up is a cinct.


--------------------
Amanita86 said:
Sui is trying to mod right now.  Kinda like a newborn calf tryin ta stand fer the first time ain’t it..

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: lowbrow]
    #26016755 -

How can you tell?  They're looking really promising


Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: tacodude]
    #26016757 -

Print them all, regardless of what I said.  I’m not a trusted identifier and if you want to get better at this you’re going to have to get your hands dirty.


--------------------
Amanita86 said:
Sui is trying to mod right now.  Kinda like a newborn calf tryin ta stand fer the first time ain’t it..

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: lowbrow]
    #26016777 -

Look legit to me, can even see some bluing on some.


--------------------
Psychedelics are a human rights of exploration, Just like sex and thinking.

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: SemiHunter]
    #26016790 -

Niiiice! I just came out here for my friends birthday. Hopefully I can print some to grow on poo

Edit :



Today's haul it looks... They were growing around the tree on the right missing half its leaves. I found them in our a befor circle around it in the mowed grass that must have some relation as there's none elsewhere throughout the feild

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: lowbrow]
    #26016808 -

lowbrow said:
Print them all, regardless of what I said.  I’m not a trusted identifier and if you want to get better at this you’re going to have to get your hands dirty.



I know brown vs black print, but they never drop. I also look for the band, but I don't think that identifies it necessarily. I know how to ID psilocybins so I know what things to look at to identify, but need advice on what to look for

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: tacodude]
    #26016819 -

They all look like Panaeolina foenisecii to me, you can spore print them if you like, but I think they'll all be brown.

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: Duggstar]
    #26016841 -

Yeah... One picked that was other another looked like it had a brown steak that was either spores or bruising... It was really hard to tell. Pan foe is edible though right so I can eat them either way and be okay?

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: tacodude]
    #26016843 -

Panaeolus foenisecii, edible.


Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: tacodude]
    #26016978 -

tacodude said:
Yeah... One picked that was other another looked like it had a brown steak that was either spores or bruising... It was really hard to tell. Pan foe is edible though right so I can eat them either way and be okay?



You have to have experience printing them before you can even think about eying them.  Printing allows you to train your eyes to spot those subtle differences then you can start to eye them.

But like I said, if you don’t get your hands dirty you will not learn.

I’m going to double down on the mushroom facing up in the first pic, if you print that one successfully it will be black.


--------------------
Amanita86 said:
Sui is trying to mod right now.  Kinda like a newborn calf tryin ta stand fer the first time ain’t it..

Edited by lowbrow (05/27/19 07:28 PM)

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: lowbrow]
    #26017019 -

Again why is the one facing up a cint to you? I believe they are all the same kind as they were all in the same location spread apart with only 2 or 3 at most growing near eachother. I honestly think they are all the same culture spread out over the area I looked as theres no fruits in the area so if ones a cint they all likely are just as if they aren't. I think I saw some spores, but I'm outside at a friends birthday where everything seems to keep knocking over the bowl so I cant even get enough of a print to check the color. Although I do believe I saw a faint bit of black spores, but still waiting

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: tacodude] * 1
    #26017023 -

tacodude said:
Again why is the one facing up a cint to you?




Panaeolus cinctulus is a lot more robust and doesn't grow in grass.

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: tacodude]
    #26017061 -

tacodude said:
Again why is the one facing up a cint to you? I believe they are all the same kind as they were all in the same location spread apart with only 2 or 3 at most growing near eachother. I honestly think they are all the same culture spread out over the area I looked as theres no fruits in the area so if ones a cint they all likely are just as if they aren't. I think I saw some spores, but I'm outside at a friends birthday where everything seems to keep knocking over the bowl so I cant even get enough of a print to check the color. Although I do believe I saw a faint bit of black spores, but still waiting




First it takes about 12 to 24 hours to get a print.  The reason I think it’s a cinct. Is because the gills have the right color.


--------------------
Amanita86 said:
Sui is trying to mod right now.  Kinda like a newborn calf tryin ta stand fer the first time ain’t it..

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: Alan Rockefeller]
    #26017073 -

Alan Rockefeller said:
tacodude said:
Again why is the one facing up a cint to you?




Panaeolus cinctulus is a lot more robust and doesn't grow in grass.



You’re really going against the scientific grain on this one.  Can we see this evidence instead of ‘because I said so’.


--------------------
Amanita86 said:
Sui is trying to mod right now.  Kinda like a newborn calf tryin ta stand fer the first time ain’t it..

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: lowbrow] * 1
    #26017114 -

I agree, these look like pan foe too me

And also imo, Alan Rockefeller IS the scientific grain!

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: Katz 206]
    #26017146 -

Yeah Alan is pretty legit, but honestly I think rules out pan cint too easy (for being in grass in this case as one specific member I trust more on it faster it grows in both, but much more developed in poo


Edit: Found another area with a bunch


Edited by tacodude (05/27/19 08:56 PM)

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: Katz 206]
    #26017177 -

Katz 206 said:
I agree, these look like pan foe too me

And also imo, Alan Rockefeller IS the scientific grain!



No, he’s not.
tacodude said:
Yeah Alan is pretty legit, but honestly I think rules out pan cint too easy (for being in grass in this case as one specific member I trust more on it faster it grows in both, but much more developed in poo


As far as the mushroom community(at large) knows, pan cincts. have always grown in well manured lawns.  That’s why they consider it the weed of mushrooms.

tacodude said:
Edit: Found another area with a bunch



. Right on. Take prints this time.






--------------------
Amanita86 said:
Sui is trying to mod right now.  Kinda like a newborn calf tryin ta stand fer the first time ain’t it..

Edited by lowbrow (05/27/19 09:11 PM)

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: lowbrow]
    #26017197 -

lowbrow said:
You’re really going against the scientific grain on this one.  Can we see this evidence instead of ‘because I said so’.




Here's a sequence from a grass "cinct"

AGGGTTCCGTAGTGACCTGCGGAGGATCATTATCGAATAAACTAGGTGGGTTGTTGCTGTCCCTCTCGGG
GGAATTGTGCACACCTTACCTTTTTTGTTTTTCCACCTGTGCACACACTGTAGGTCTGAAGGAGGGGAAG
GGGGGGGAAGTAACACTCTCCCCCTGAAACACTTTCAGGTCCTATGTATTTTACACATACACTATTAAAA
GTAACAGAACGATTCAATGGGCTTCCAAGCCTATAAACTATATACAACTTTCAGCAACGGATCTCTTGGC
TCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGA
ATCTTTGAACGCACCTTGCGCTCGTTGGTATTCCGACAAGCATGCCTGTTTGAGTGTCATTAAATTCTCA
ACCTCAACACTTTTGTGATTGATGGCTTGGATGTGGAGGTTTTTCTGCAGGCTGTTAAAGTCTGCTCCTC
TCAAATGAATTAGTGGGTGCCCCGCGCAAACCTATCTATTGGTGTGATAATTATCTACGCCGTGGATTAT
AGGATTGCTGTAAAAAGGTGTTTGCCCTGCTTCTAACCGTCCCCTCTGTTGGGACAACTTGAACCATTTG
ACCTCAGATCAAGTAGGACTACCCCCTGAACTTAACCATATCCATAAG

And here is one from a dung Panaeolus cinctulus:

GGGTTGTTGCTGTCCCTCTCGGGGGAATTGTGCACACCTTACCTTTTTTGTTTTTCCACCTGTGCACACA
CTGTAGGTCTGAAGGAGGGGAAGGGGGGGGATTAACACTCTCCGCCTGAAACACTTTCAGGTCCTATGTA
TTTTACACATACACTATTAAAAGTAACAGAACGATTCAATGGGCTTCCAAGCCTATAAACTATATACAAC
TTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATT
GCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCGTTGGTATTCCGACGAGCATGCCTG
TTTGAGTGTCATTAAATTCTCAACCTCAACACTTTTGTGATTGATGGCTTGGATGTGGAGGTTTTTCTGC
AGGCTGTTAAAGTCTGCTCCTCTCAAATGAATTAGTGGGTGCCCCGCGCAAACCTATCTATTGGTGTGAT
AATTATCTACGCCGTGGATTATAGGATTGCTGTAAAAAGGTGTTTGCCCTGCTTCTAACCGTCCCCTTTG
TTGGGACAACTTGAACCATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATA


Tacodude, it is best to photograph these things on a dark background.  The white plate is making the camera turn down the exposure, making the gills look blacker than they are.  Also try both with and without flash, often the flash can bring out dark colors that are otherwise hard to see.

Extras: Filter Print Post Top
Re: More SF pans (cints?) [Re: Alan Rockefeller]
    #26017252 -

Been discussing it with another local member who is pretty knowledgeable and helped me conclude they're likely foe... Also what Alan said about clusters. Here's a few more shots to clarify

Edit: Alan just working with what I got while out, but you're likely right that they are inactive foe I now have tons of.  I'd submit it for gene bank of that would be useful, but it would have to be where I can bring it in person


Edit 2: Also what to do with a bunch of foe? I might as well make them into a meal. What window of time do I have to cook them fresh where if I'm cooking lanter I'll need to dry and hydrate them to eat

Edited by tacodude (05/27/19 10:13 PM)

Extras: Filter Print Post Top
Jump to top Pages: 1 | 2 | 3 | 4 |  [ show all ]

Shop: Myyco.com Isolated Cubensis Liquid Culture For Sale   Mushroom-Hut Liquid Cultures   Original Sensible Seeds Autoflowering Cannabis Seeds   MagicBag.co All-In-One Bags That Don't Suck   Sporeworks.EU Spores for European Microscopy   North Spore Injection Grain Bag


Similar ThreadsPosterViewsRepliesLast post
* pan cincts and edibles
( 1 2 all )
trigger 3,015 25 07/15/10 11:06 PM
by SomeGuy
* help identifing mushrooms
( 1 2 all )
codyrcollier14 7,572 24 09/28/14 09:02 AM
by ambc
* is it Panaeolus cinctulu? choomanfoo 5,712 11 05/26/13 08:20 PM
by choomanfoo
* Foes or Cints ID [Update for prints] MushroomPantheon 430 3 09/22/13 06:34 PM
by MushroomPantheon
* I think i finally found a Pann cint. Pics. underfliptown 1,201 19 07/10/13 08:29 PM
by Gravija
* Pann cints/ foes. Spectacle 609 5 10/23/12 03:07 AM
by Spectacle
* Pan Cint Preservation noluckhunterr 569 1 05/08/09 08:32 PM
by Engelsblut6
* need ID on shrooms found in SF area
( 1 2 all )
adamlivesinCA 1,836 21 04/04/08 03:03 PM
by landsnorkler

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: ToxicMan, karode13, inski, Alan Rockefeller, Duggstar, TimmiT, Anglerfish, Tmethyl, Lucis, Doc9151, Land Trout
1,574 topic views. 1 members, 70 guests and 40 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2026 Mind Media. Some rights reserved.

Generated in 0.027 seconds spending 0.007 seconds on 16 queries.