Home | Community | Message Board


This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Kraken Kratom Shop: Red Vein Kratom

Jump to first unread post Pages: 1
InvisibleArp
roving mycophagist
 User Gallery

Registered: 04/20/98
Posts: 2,191
Loc: in a van by the river
(S)hine on (Y)ou crazy (D)iamond
    #4232514 - 05/29/05 04:04 AM (18 years, 9 months ago)

Shine on You crazy Diamond

Am I onto something? :grin:

Extras: Filter Print Post Top
OfflineCaRnAgECaNdYS
Tool's groupie
Female User Gallery

Registered: 04/09/04
Posts: 11,505
Loc: Billy Howerdel's closet Flag
Last seen: 8 months, 20 days
Re: (S)hine on (Y)ou crazy (D)iamond [Re: Arp]
    #4232661 - 05/29/05 07:10 AM (18 years, 9 months ago)

Hmm, I dunno. That's a damn good song though.


--------------------

The secret to being funny is to say smart things stupidly, or is it stupid things smartly? Whatever..it's not rocket surgery...or something like that.

Extras: Filter Print Post Top
Offlinedemon2091tb
Stranger

Registered: 01/09/05
Posts: 103
Last seen: 15 years, 9 months
Re: (S)hine on (Y)ou crazy (D)iamond [Re: CaRnAgECaNdY]
    #4232689 - 05/29/05 07:32 AM (18 years, 9 months ago)

Hey you could be.....PF's Syd Barrett as the Diamond.  Ended up having a mental breakdown from daily LSD doses.

Wonder if there is anything else to this?

:smile: Hmmmmm Oh well.

Extras: Filter Print Post Top
OfflineVex
Stranger
Registered: 05/04/05
Posts: 1,284
Last seen: 18 years, 5 months
Re: (S)hine on (Y)ou crazy (D)iamond [Re: Arp]
    #4234390 - 05/29/05 07:26 PM (18 years, 9 months ago)

yes...the song is about syd barret. that whole album is.

Extras: Filter Print Post Top
Offlineplexus
holding thelight of athousand candles

Registered: 04/24/03
Posts: 1,291
Loc: texas
Last seen: 4 years, 6 months
Re: (S)hine on (Y)ou crazy (D)iamond [Re: Vex]
    #4234419 - 05/29/05 07:42 PM (18 years, 9 months ago)

wish you were here is all about syd.

a funny note, the band hadnt seen syd for years when he happend to show up to the studio during the recording of their epic, progressive ballad dedicated to their lost bandmat, shine on you crazy diamond.


--------------------
that there, thats not me. :noway:
i go where i please. :yesnod:
im not here.:shake:
this isnt happening.:nonono:

Extras: Filter Print Post Top
OfflineVulture
Pursuer ofWisdom
 User Gallery

Registered: 06/18/02
Posts: 3,546
Loc: SC
Last seen: 9 years, 13 days
Re: (S)hine on (Y)ou crazy (D)iamond [Re: plexus]
    #4235194 - 05/30/05 12:22 AM (18 years, 9 months ago)

didnt he just show up and start jumping up and down while brushing his teeth?


--------------------
Work like you dont need the money.

Love like you never been hurt.

Dance like nobody is watching.

Extras: Filter Print Post Top
Offlineemptywisdom
simple being oflight
 User Gallery

Registered: 03/29/05
Posts: 2,107
Loc: Lemuria
Last seen: 8 years, 6 months
Re: (S)hine on (Y)ou crazy (D)iamond [Re: Vulture]
    #4235305 - 05/30/05 01:02 AM (18 years, 9 months ago)

no man.

They were making this record, and they intentionally wrote the lyrics for Shine on and wish you were here for Syd. After the success of Dark Side and a failed attempt at the "household items" record, they didn't really know where to go, so they made an album for Syd amongst the success and all, Wish you were here.
While they were recording Shine on, an anthem written about and for Syd himself, Syd showed up in the studio, pretty much at random, sat on a couch while they were recording, didn't say much if anything, and eventually got up and left. Didn't come back at all for the rest of the sessions. Strange shit.


--------------------

Extras: Filter Print Post Top
Offlinelilbilski4life
fear andloathing inbozeman

Registered: 03/17/05
Posts: 199
Last seen: 16 years, 11 months
Re: (S)hine on (Y)ou crazy (D)iamond [Re: emptywisdom]
    #4235313 - 05/30/05 01:06 AM (18 years, 9 months ago)

holy fuck, i been wondering wtf the song was about forever, thanks!


--------------------
------------------------------------------------

Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: (S)hine on (Y)ou crazy (D)iamond [Re: lilbilski4life]
    #4239063 - 05/31/05 06:19 AM (18 years, 9 months ago)

Yeah, apparently Syd said if they needed anything, he was there. It was the only time (probably to this day) they'd seen him since back in the day. Apparently he was balding and overweight. Roger Waters admitted that he indeed cried.

As far as the name of the song goes, I don't think it's trying to spell out Syd. Especially on account of the word crazy (on is ignorable, but come on). Maybe thats just me though :smile:

Extras: Filter Print Post Top
Invisibleentheoindole
Seāð Wīdfarend
 User Gallery

Registered: 04/04/04
Posts: 595
Loc: Eormensyll, Vīnland
Re: (S)hine on (Y)ou crazy (D)iamond [Re: CaRnAgECaNdY]
    #4240205 - 05/31/05 01:50 PM (18 years, 9 months ago)

Quote:

Desiree said:
Hmm, I dunno. That's a damn good song though.





My favorite Syd Barett song is Astronomy Domine! Shine on's not bad though. Of course, I've never heard a Pink Floyd song I didn't like...

Extras: Filter Print Post Top
InvisibleArp
roving mycophagist
 User Gallery

Registered: 04/20/98
Posts: 2,191
Loc: in a van by the river
Re: (S)hine on (Y)ou crazy (D)iamond [Re: Koala Koolio]
    #4240455 - 05/31/05 02:47 PM (18 years, 9 months ago)

Quote:

elgr said:Apparently he was balding and overweight. Roger Waters admitted that he indeed cried.




Waters is sooo superficial :grin:

Extras: Filter Print Post Top
InvisibleArp
roving mycophagist
 User Gallery

Registered: 04/20/98
Posts: 2,191
Loc: in a van by the river
Re: (S)hine on (Y)ou crazy (D)iamond [Re: Arp]
    #4240466 - 05/31/05 02:52 PM (18 years, 9 months ago)

:mushroom2:

Edited by Arp (05/31/05 03:06 PM)

Extras: Filter Print Post Top
InvisibleColonel Kurtz Ph.D
What What?
Male User Gallery
Registered: 07/22/04
Posts: 11,113
Loc: Shadow Moses
Re: (S)hine on (Y)ou crazy (D)iamond [Re: emptywisdom]
    #4261498 - 06/05/05 08:52 PM (18 years, 9 months ago)

Yep, and at first they didn't even know who he was!!!

Quote:

They also played a bit of an interview with Roger Waters where he described the day that Syd came to visit. He came in that day and met Dave in the studio, and there was this strange fat bald man in there too. "Who is that?" Roger whispers to Dave. "Hell if I know," Dave whispers back. The strange man doesn't say anything, just gets up occasionally to dance around the room or brush his teeth or other bizarre things. And then after about 45 minutes somebody realizes it's Syd, and that he's come in on the very day they're laying the vocal tracks for "Shine On You Crazy Diamond." Isn't that sad?




Interesting anecdote. It must of been very hard for Dave to cope with it, when they did a show Syd would go there and start shouting at him"that was my band! But that was my band!!" Very sad a creative man like that had such bad luck :sad:


--------------------
:whatwhat:

There's no better way to rock out than with your cock out!!

Extras: Filter Print Post Top
Jump to top Pages: 1

Kraken Kratom Shop: Red Vein Kratom


Similar ThreadsPosterViewsRepliesLast post
* Astronomy Picture of the Day kosmic_charlie 760 6 01/07/03 09:57 AM
by Dilauded
* fookin crazy, but mindbogglingly funny movie Jeroen198 924 10 06/03/03 10:18 PM
by chodamunky
* Strange Days Festival therinds 744 7 07/05/05 12:38 PM
by HuckleBones
* they say the moon makes you crazy adrug 856 12 04/10/04 07:34 PM
by Psilostylin
* Crazy Tap Instruments nanananotehead 1,077 19 10/24/04 10:58 PM
by Locus
* Some crazy drumming Harbinger 729 6 12/14/03 01:28 AM
by StonedShroom
* Crazy Improvisation techniques on guitar marvoman 855 5 06/03/05 01:30 AM
by gbhtrfv
* "he's crazy??.............well sign me up!!!!!!!" Psilocybeingzz 675 4 01/22/04 06:39 PM
by fjbk47985

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: Middleman, automan, DividedQuantum
721 topic views. 0 members, 4 guests and 23 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2024 Mind Media. Some rights reserved.

Generated in 0.028 seconds spending 0.007 seconds on 14 queries.