Home | Community | Message Board


Avalon Magic Plants
Please support our sponsors.

General Interest >> Music, Art, and Media

Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Amazon Shop: Pink Floyd

Jump to first unread post. Pages: 1
InvisibleArp
roving mycophagist
 User Gallery

Registered: 04/20/98
Posts: 2,191
Loc: in a van by the river
(S)hine on (Y)ou crazy (D)iamond
    #4232514 - 05/29/05 06:04 AM (12 years, 4 months ago)

Shine on You crazy Diamond

Am I onto something? :grin:


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineCaRnAgECaNdYS
Tool's groupie
Female User Gallery

Registered: 04/09/04
Posts: 11,505
Loc: Billy Howerdel's closet Flag
Last seen: 11 months, 15 days
Re: (S)hine on (Y)ou crazy (D)iamond [Re: Arp]
    #4232661 - 05/29/05 09:10 AM (12 years, 4 months ago)

Hmm, I dunno. That's a damn good song though.


--------------------

The secret to being funny is to say smart things stupidly, or is it stupid things smartly? Whatever..it's not rocket surgery...or something like that.


Post Extras: Print Post  Remind Me! Notify Moderator
Offlinedemon2091tb
Stranger

Registered: 01/10/05
Posts: 103
Last seen: 9 years, 4 months
Re: (S)hine on (Y)ou crazy (D)iamond [Re: CaRnAgECaNdY]
    #4232689 - 05/29/05 09:32 AM (12 years, 4 months ago)

Hey you could be.....PF's Syd Barrett as the Diamond.  Ended up having a mental breakdown from daily LSD doses.

Wonder if there is anything else to this?

:smile: Hmmmmm Oh well.


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineVex
Stranger
Registered: 05/04/05
Posts: 1,284
Last seen: 12 years, 13 days
Re: (S)hine on (Y)ou crazy (D)iamond [Re: Arp]
    #4234390 - 05/29/05 09:26 PM (12 years, 4 months ago)

yes...the song is about syd barret. that whole album is.


Post Extras: Print Post  Remind Me! Notify Moderator
Offlineplexus
holding thelight of athousand candles

Registered: 04/24/03
Posts: 1,290
Loc: texas
Last seen: 6 years, 11 months
Re: (S)hine on (Y)ou crazy (D)iamond [Re: Vex]
    #4234419 - 05/29/05 09:42 PM (12 years, 4 months ago)

wish you were here is all about syd.

a funny note, the band hadnt seen syd for years when he happend to show up to the studio during the recording of their epic, progressive ballad dedicated to their lost bandmat, shine on you crazy diamond.


--------------------
that there, thats not me. :noway:
i go where i please. :yesnod:
im not here.:shake:
this isnt happening.:nonono:


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineVulture
Pursuer ofWisdom
 User Gallery

Registered: 06/18/02
Posts: 3,546
Loc: SC
Last seen: 2 years, 6 months
Re: (S)hine on (Y)ou crazy (D)iamond [Re: plexus]
    #4235194 - 05/30/05 02:22 AM (12 years, 4 months ago)

didnt he just show up and start jumping up and down while brushing his teeth?


--------------------
Work like you dont need the money.

Love like you never been hurt.

Dance like nobody is watching.


Post Extras: Print Post  Remind Me! Notify Moderator
Offlineemptywisdom
simple being oflight
 User Gallery

Registered: 03/29/05
Posts: 2,107
Loc: Lemuria
Last seen: 2 years, 27 days
Re: (S)hine on (Y)ou crazy (D)iamond [Re: Vulture]
    #4235305 - 05/30/05 03:02 AM (12 years, 4 months ago)

no man.

They were making this record, and they intentionally wrote the lyrics for Shine on and wish you were here for Syd. After the success of Dark Side and a failed attempt at the "household items" record, they didn't really know where to go, so they made an album for Syd amongst the success and all, Wish you were here.
While they were recording Shine on, an anthem written about and for Syd himself, Syd showed up in the studio, pretty much at random, sat on a couch while they were recording, didn't say much if anything, and eventually got up and left. Didn't come back at all for the rest of the sessions. Strange shit.


--------------------


Post Extras: Print Post  Remind Me! Notify Moderator
Offlinelilbilski4life
fear andloathing inbozeman

Registered: 03/18/05
Posts: 199
Last seen: 10 years, 6 months
Re: (S)hine on (Y)ou crazy (D)iamond [Re: emptywisdom]
    #4235313 - 05/30/05 03:06 AM (12 years, 4 months ago)

holy fuck, i been wondering wtf the song was about forever, thanks!


--------------------
------------------------------------------------


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: (S)hine on (Y)ou crazy (D)iamond [Re: lilbilski4life]
    #4239063 - 05/31/05 08:19 AM (12 years, 4 months ago)

Yeah, apparently Syd said if they needed anything, he was there. It was the only time (probably to this day) they'd seen him since back in the day. Apparently he was balding and overweight. Roger Waters admitted that he indeed cried.

As far as the name of the song goes, I don't think it's trying to spell out Syd. Especially on account of the word crazy (on is ignorable, but come on). Maybe thats just me though :smile:


Post Extras: Print Post  Remind Me! Notify Moderator
Invisibleentheoindole
Seāð Wīdfarend
 User Gallery

Registered: 04/04/04
Posts: 595
Loc: Eormensyll, Vīnland
Re: (S)hine on (Y)ou crazy (D)iamond [Re: CaRnAgECaNdY]
    #4240205 - 05/31/05 03:50 PM (12 years, 4 months ago)

Quote:

Desiree said:
Hmm, I dunno. That's a damn good song though.





My favorite Syd Barett song is Astronomy Domine! Shine on's not bad though. Of course, I've never heard a Pink Floyd song I didn't like...


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleArp
roving mycophagist
 User Gallery

Registered: 04/20/98
Posts: 2,191
Loc: in a van by the river
Re: (S)hine on (Y)ou crazy (D)iamond [Re: Koala Koolio]
    #4240455 - 05/31/05 04:47 PM (12 years, 4 months ago)

Quote:

elgr said:Apparently he was balding and overweight. Roger Waters admitted that he indeed cried.




Waters is sooo superficial :grin:


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleArp
roving mycophagist
 User Gallery

Registered: 04/20/98
Posts: 2,191
Loc: in a van by the river
Re: (S)hine on (Y)ou crazy (D)iamond [Re: Arp]
    #4240466 - 05/31/05 04:52 PM (12 years, 4 months ago)

:mushroom2:


Edited by Arp (05/31/05 05:06 PM)


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleColonel Kurtz Ph.D
What What?
Male User Gallery
Registered: 07/22/04
Posts: 11,113
Loc: Shadow Moses
Re: (S)hine on (Y)ou crazy (D)iamond [Re: emptywisdom]
    #4261498 - 06/05/05 10:52 PM (12 years, 4 months ago)

Yep, and at first they didn't even know who he was!!!

Quote:

They also played a bit of an interview with Roger Waters where he described the day that Syd came to visit. He came in that day and met Dave in the studio, and there was this strange fat bald man in there too. "Who is that?" Roger whispers to Dave. "Hell if I know," Dave whispers back. The strange man doesn't say anything, just gets up occasionally to dance around the room or brush his teeth or other bizarre things. And then after about 45 minutes somebody realizes it's Syd, and that he's come in on the very day they're laying the vocal tracks for "Shine On You Crazy Diamond." Isn't that sad?




Interesting anecdote. It must of been very hard for Dave to cope with it, when they did a show Syd would go there and start shouting at him"that was my band! But that was my band!!" Very sad a creative man like that had such bad luck :sad:


--------------------
:whatwhat:

There's no better way to rock out than with your cock out!!


Post Extras: Print Post  Remind Me! Notify Moderator
Jump to top. Pages: 1

Amazon Shop: Pink Floyd

General Interest >> Music, Art, and Media

Similar ThreadsPosterViewsRepliesLast post
* "Sweet Caroline"-Neil Diamond lsdandfrisbee 413 1 05/30/06 11:26 AM
by MLBjammer
* gnarles barkley: "crazy" EternalCowabunga 652 12 06/09/06 12:51 AM
by FleaAccela
* they say the moon makes you crazy adrug 718 12 04/10/04 09:34 PM
by Psilostylin
* Crazy fucked up metal MUST LISTEN
( 1 2 3 all )
Jufin 2,152 41 03/23/09 01:57 AM
by MilkdudTitties
* Crazy Tap Instruments nanananotehead 849 19 10/25/04 12:58 AM
by Locus
* Some crazy drumming Harbinger 607 6 12/14/03 03:28 AM
by StonedShroom
* Crazy Improvisation techniques on guitar
marvoman
692 5 06/03/05 03:30 AM
by gbhtrfv
* "he's crazy??.............well sign me up!!!!!!!" Psilocybeingzz 538 4 01/22/04 08:39 PM
by fjbk47985

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: Middleman, automan, sui, DividedQuantum
630 topic views. 1 members, 10 guests and 0 web crawlers are browsing this forum.
[ Toggle Favorite | Print Topic | Stats ]
Search this thread:
High Mountain Compost
Please support our sponsors.

Copyright 1997-2017 Mind Media. Some rights reserved.

Generated in 0.034 seconds spending 0.007 seconds on 19 queries.