Home | Community | Message Board

Magic-Mushrooms-Shop.com
This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Kraken Kratom Shop: Red Vein Kratom

Jump to first unread post Pages: 1
InvisibleveggieM

Registered: 07/25/04
Posts: 17,504
50 pounds of cocaine found in abandoned suitcase [CA]
    #5257531 - 02/02/06 10:38 PM (17 years, 11 months ago)

50 pounds of cocaine found in abandoned suitcase
February 2, 2006 - sanfranciscosentinel.com

SAN FRANCISCO INTERNATIONAL AIRPORT (BCN) - An unusual lost luggage item -- an abandoned suitcase containing close to 50 pounds of cocaine -- represents the largest single seizure of cocaine ever at San Francisco International Airport, Immigration and Customs Enforcement officials reported today.

The suitcase turned up in the international terminal on Jan. 12. Investigators are not commenting on what it looks like, where it might have come from or who might have brought it into the United States, Virginia Kice, an ICE spokeswoman, said.

"We have an open and ongoing investigation so we're not talking a lot about it,'' Kice said.

The Bay Area street value of the 22 kilograms of cocaine would probably be about $2 million, although that figure would vary depending on the drug's purity and country of origin, said Casey McEnry, a spokeswoman for the U.S. Drug Enforcement Agency.

Cocaine brought into the U.S. from overseas is unlikely to have been adulterated, so anyone selling it here could increase their profits and the drug's cost by adding other substances to it, McEnry said.

"I would be quite surprised if someone shows up to claim this piece of lost luggage,'' Kice added.


Extras: Filter Print Post Top
InvisibleRESTLESS
C.M.L.W.

Registered: 06/21/05
Posts: 21,817
Re: 50 pounds of cocaine found in abandoned suitcase [CA] [Re: veggie]
    #5257614 - 02/02/06 11:00 PM (17 years, 11 months ago)

holy fuckshit


--------------------


Extras: Filter Print Post Top
Offlineeris
underground
Male User Gallery

Registered: 11/17/98
Posts: 48,024
Loc: North East, USA
Last seen: 4 months, 18 days
Re: 50 pounds of cocaine found in abandoned suitcase [CA] [Re: veggie]
    #5257644 - 02/02/06 11:14 PM (17 years, 11 months ago)

Man, they just left it there WTF! And of all people to find it, the airport staff (i guess?).


--------------------
Immortal / Temporarily Retired
The OG Thread Killer
My mushroom hunting gallery


Extras: Filter Print Post Top
InvisibleRESTLESS
C.M.L.W.

Registered: 06/21/05
Posts: 21,817
Re: 50 pounds of cocaine found in abandoned suitcase [CA] [Re: eris]
    #5257761 - 02/02/06 11:42 PM (17 years, 11 months ago)

:sad:


--------------------


Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: 50 pounds of cocaine found in abandoned suitcase [CA] [Re: RESTLESS]
    #5258037 - 02/03/06 12:59 AM (17 years, 11 months ago)

So... does this mean it made it through security?


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Extras: Filter Print Post Top
Offlinecoda
Banjo Goiter
Male

Registered: 03/20/01
Posts: 8,750
Last seen: 10 months, 3 days
Re: 50 pounds of cocaine found in abandoned suitcase [CA] [Re: Koala Koolio]
    #5259575 - 02/03/06 02:39 PM (17 years, 11 months ago)

why the fuck cant i find a suitcase with 50 lbs of coke in it.


--------------------
To get really high is to forget yourself. And to forget yourself is to see everything else. And to see everything else is to become an understanding molecule in evolution, a conscious tool of the universe. And I think every human being should be a conscious tool of the universe. . . .

-JG

i really am glad you came back to us instead of taking the other path. *hug*

-A_S (RIP your final words to me will never be forgotten)



Don't fuck with the laughing jesus.


Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: 50 pounds of cocaine found in abandoned suitcase [CA] [Re: coda]
    #5260464 - 02/03/06 07:33 PM (17 years, 11 months ago)

It's the kind the slow old ladies wheel around in the airport, always right in front of you, blocking your path.

You'll recognize it because it looks like a carpet, with flowery patterns on the side.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Extras: Filter Print Post Top
OfflineRemainRandom50
Do You Need ToKnow Me?
Registered: 01/15/06
Posts: 1,695
Last seen: 14 years, 9 months
Re: 50 pounds of cocaine found in abandoned suitcase [CA] [Re: Koala Koolio]
    #5261884 - 02/04/06 08:29 AM (17 years, 11 months ago)

wow, i would shit myself if i found that suitcase.


--------------------
At times I get consumed by my everyday life and will leave the Shroomery. Yet, every time drugs come falling into my life for fun.....I always think about the Shroomery and then I'm back!


Extras: Filter Print Post Top
Jump to top Pages: 1

Kraken Kratom Shop: Red Vein Kratom


Similar ThreadsPosterViewsRepliesLast post
* 800 Pounds of Pot Seized [CA] veggieM 1,468 6 07/18/05 12:06 AM
by CptnGarden
* Regulating wild mushrooms [CA] veggieM 2,513 3 03/16/05 08:48 PM
by Ekstaza
* Public lands are seeing an explosion in pot growing [CA] veggieM 1,429 1 08/09/05 09:50 AM
by Stonerguy
* The 91-Pound Acid Trip veggieM 2,004 5 03/15/05 09:09 PM
by DNKYD
* 81 in 3 countries charged in $50 million drug cartel veggieM 1,296 1 06/15/05 07:49 AM
by SuperD
* U.S. Seizes 30,000 Pounds of Cocaine Locus 3,942 18 10/24/04 09:37 PM
by twonewtz
* River of cocaine [UK] veggieM 1,101 1 11/06/05 01:55 AM
by Jim
* School bus driver charged with selling bricks of cocaine [TN] veggieM 857 0 08/28/05 02:04 AM
by veggie

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: motaman, veggie, Alan Rockefeller, Mostly_Harmless
1,032 topic views. 0 members, 10 guests and 3 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2024 Mind Media. Some rights reserved.

Generated in 0.02 seconds spending 0.007 seconds on 14 queries.