| Home | Community | Message Board |
|
You are not signed in. |
This site includes paid links. Please support our sponsors.
|
|
|
Workman |
07/12/05 10:06 PM |
|
|
Kalix | 07/12/05 10:15 PM |
|
|
scatmanrav | 07/12/05 10:34 PM |
|
|
Workman |
07/12/05 10:48 PM |
|
|
Cyano | 12/01/05 10:36 AM |
|
|
Workman |
12/01/05 10:48 PM |
|
|
ohmatic | 12/02/05 02:52 AM |
|
|
eatyualive | 12/23/05 01:52 PM |
|
|
GGreatOne234 | 12/24/05 01:38 PM |
|
1999 Spore War Veteran Reged: 03/01/01 Posts: 3598 Loc: Oregon, USA |
|
||
|
ITS sequence of specimen. CAAATTGTCATTTGTATTGTCCAAACGAAGGA -------------------- Research funded by the patrons of The Spore Works Exotic Spore Supply My Instagram Reinvesting 25% of Sales Towards Basic Research and Species Identification
|
|
|
BlimeyGrimey | 01/10/24 04:01 AM |
|
|
inski | 01/10/24 10:45 AM |
|
|
the_chosen_one | 01/10/24 11:03 AM |
|
|
BlimeyGrimey | 01/10/24 04:41 PM |
|
|
Workman |
01/11/24 02:32 PM |
|
|
Workman |
01/13/24 10:33 AM |
|
|
the_chosen_one | 01/13/24 11:20 AM |
|
|
BlimeyGrimey | 01/14/24 01:47 PM |
|
|
Pscientist | 01/27/24 07:49 AM |
|
|
BlimeyGrimey | 01/27/24 03:14 PM |
|
|
Pscientist | 01/27/24 03:59 PM |
|
|
BlimeyGrimey | 01/27/24 05:06 PM |
| Extra information | ||||
|
2 members, 12 guests and 3 web crawlers are browsing this forum.
Moderator: RogerRabbit, Pastywhyte, bodhisatta |
Forum Permissions
You cannot start new topics You cannot reply to topics HTML is disabled BBCode is enabled |
Rating:
Thread views: 21195 |
||
|
|
||||

