Home | Community | Message Board

Out-Grow.com - Mushroom Growing Kits & Supplies
This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Shop: Original Sensible Seeds Bulk Cannabis Seeds   Mushroom-Hut Substrate Bags   Left Coast Kratom Buy Kratom Extract   North Spore Bulk Substrate   Kraken Kratom Red Vein Kratom   PhytoExtractum Kratom Powder for Sale

Jump to first unread post Pages: 1 | 2 | 3 | 4  [ show all ]
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
Offlinecasgoodie
weedwright
Male User Gallery

Registered: 10/31/06
Posts: 770
Loc: terra
Last seen: 10 years, 3 months
Psilocybe pellicullosa/silvatica
    #7738819 - 12/09/07 11:31 PM (16 years, 1 month ago)

These were found in literally ugly cutouts in coniferous forests and at few different locations, but all similar habitats and all very proximate to trash (from old refrigerators, mops, buckets to bottles and cans). Don't have a microscope so can't tell which species they are but because they were found at different locations, could possibly have a mixed collection. There is not much accurate information on potency for these, does anyone have any experience?







a nice almost hemispheric looking chanterelle, not sure what exact species


--------------------
TRAPPED IN LINGUISTIC CONCEPTS


Extras: Filter Print Post Top
Invisiblelandsnorkler


Registered: 09/26/06
Posts: 3,047
Loc: Montana
Trusted Identifier
Re: Psilocybe pellicullosa/silvatica [Re: casgoodie]
    #7738850 - 12/09/07 11:47 PM (16 years, 1 month ago)

Wow, those are fucking awesome!!! Maybe silvatica? Good find, those seem pretty rare and awesome.


--------------------


Edited by landsnorkler (12/09/07 11:48 PM)


Extras: Filter Print Post Top
Offlineadrian7812
Stranger
Male


Registered: 09/26/07
Posts: 262
Loc: Sydney, Australia
Last seen: 14 years, 6 months
Re: Psilocybe pellicullosa/silvatica [Re: landsnorkler]
    #7738950 - 12/10/07 12:57 AM (16 years, 1 month ago)

Nice. :laugh:


--------------------
Nothing I say is true. It is entirely fictional. In fact, my life is entirely fictional. I do not exist.


Extras: Filter Print Post Top
Invisiblecactu
culture and magic
Male

Registered: 03/06/06
Posts: 3,913
Loc: mexicoelcentrodelconocimi...
Trusted Identifier
Re: Psilocybe pellicullosa/silvatica [Re: adrian7812]
    #7739745 - 12/10/07 09:38 AM (16 years, 1 month ago)

good finds casgodie¡
maybe a mix collections as you said , but look some like pellicullosa and some like sylvatica.i´m really a fan only . nice specimens, maybe both,
hope you find more they used to grow in gret number in clear cuts , hope you find one, ha ha
all my best vibration.......


--------------------

cuando una rafaga del pensamiento nos pasa  al lado se puede sentir  que valio  la pena  haber vivido, y cuando ese pensamiento se  convierte en sueño no paramos de soñar hasta realizarlo


Extras: Filter Print Post Top
OfflinemyCo_psyCo
a mycologist inthe making
Male User Gallery


Registered: 06/11/05
Posts: 969
Loc: own private hell
Last seen: 10 years, 8 months
Re: Psilocybe pellicullosa/silvatica [Re: casgoodie]
    #7740871 - 12/10/07 02:17 PM (16 years, 1 month ago)

Quote:

casgoodie said:
(from old refrigerators, mops, buckets to bottles and cans).







dont forget the shotgun blasted lawnmower and tv lol :redneck:


--------------------



Extras: Filter Print Post Top
Offlinecasgoodie
weedwright
Male User Gallery

Registered: 10/31/06
Posts: 770
Loc: terra
Last seen: 10 years, 3 months
Re: Psilocybe pellicullosa/silvatica [Re: myCo_psyCo]
    #7741066 - 12/10/07 02:53 PM (16 years, 1 month ago)

right on, also much thanks to myco psycho for having a good eye for these little, hard to spot mushrooms


--------------------
TRAPPED IN LINGUISTIC CONCEPTS


Extras: Filter Print Post Top
OfflineAlan RockefellerM
Mycologist
Male User Gallery

Registered: 03/10/07
Posts: 48,276
Last seen: 3 hours, 49 minutes
Trusted Identifier
Re: Psilocybe pellicullosa/silvatica [Re: casgoodie]
    #7743528 - 12/11/07 12:38 AM (16 years, 1 month ago)





The above pictures are spores under 1000x magnification. The first picture is plain and the second has some color level adjustments.

The spores are about 12 microns long and are definitely too large to be Psilocybe silvatica. The spore size and shape is a good match for Psilocybe pelliculosa.


Extras: Filter Print Post Top
Offlinerainlover
Stranger


Registered: 11/27/04
Posts: 129
Last seen: 15 years, 2 months
Re: Psilocybe pellicullosa/silvatica [Re: Alan Rockefeller]
    #7743534 - 12/11/07 12:40 AM (16 years, 1 month ago)

Alan, did casgoodie send you spore prints?


Extras: Filter Print Post Top
Offlineelflord420
bringer of thedawn
Male User Gallery


Registered: 10/02/07
Posts: 281
Loc: washington
Last seen: 10 years, 3 months
Re: Psilocybe pellicullosa/silvatica [Re: rainlover]
    #7743543 - 12/11/07 12:44 AM (16 years, 1 month ago)

deleted


--------------------
Dont ever eat mushrooms and watch Total Recall


Edited by elflord420 (12/11/07 12:45 AM)


Extras: Filter Print Post Top
Offlineelflord420
bringer of thedawn
Male User Gallery


Registered: 10/02/07
Posts: 281
Loc: washington
Last seen: 10 years, 3 months
Re: Psilocybe pellicullosa/silvatica [Re: rainlover]
    #7743547 - 12/11/07 12:44 AM (16 years, 1 month ago)

dude nice find on such a rare one! where did you find this area wise??

are they very potent?


--------------------
Dont ever eat mushrooms and watch Total Recall


Edited by elflord420 (12/11/07 12:45 AM)


Extras: Filter Print Post Top
OfflineAlan RockefellerM
Mycologist
Male User Gallery

Registered: 03/10/07
Posts: 48,276
Last seen: 3 hours, 49 minutes
Trusted Identifier
Re: Psilocybe pellicullosa/silvatica [Re: rainlover]
    #7743554 - 12/11/07 12:46 AM (16 years, 1 month ago)

> Alan, did casgoodie send you spore prints?

Yes.


Extras: Filter Print Post Top
Invisiblelandsnorkler


Registered: 09/26/06
Posts: 3,047
Loc: Montana
Trusted Identifier
Re: Psilocybe pellicullosa/silvatica [Re: Alan Rockefeller]
    #7743561 - 12/11/07 12:48 AM (16 years, 1 month ago)

So they're pelliculosas then?


--------------------


Extras: Filter Print Post Top
OfflineAlan RockefellerM
Mycologist
Male User Gallery

Registered: 03/10/07
Posts: 48,276
Last seen: 3 hours, 49 minutes
Trusted Identifier
Re: Psilocybe pellicullosa/silvatica [Re: landsnorkler]
    #7743631 - 12/11/07 01:19 AM (16 years, 1 month ago)

> So they're pelliculosas then?

The spores match and the description / habitat matches.

I would need to see part of the gill to be sure.

I am going to call them that for now.



Extras: Filter Print Post Top
Offlinecasgoodie
weedwright
Male User Gallery

Registered: 10/31/06
Posts: 770
Loc: terra
Last seen: 10 years, 3 months
Re: Psilocybe pellicullosa/silvatica [Re: landsnorkler]
    #7743644 - 12/11/07 01:27 AM (16 years, 1 month ago)

alan:
thanks for the microscope work. really appreciate it. makes me wonder about the not so well known psilocybe washingtonensis also

elflord:
logging areas and woods where the not so educated dump their waste. they're not supposed to be very potent, but i havent tried them myself.

landsnorkler:
i guess from alan's analysis. those spore magnifications are not from the mushrooms in this thread though. the specimen that was analysed can be seen in this thread:
http://www.shroomery.org/forums/showflat.php/Number/7648679#7648679


--------------------
TRAPPED IN LINGUISTIC CONCEPTS


Extras: Filter Print Post Top
Invisiblecactu
culture and magic
Male

Registered: 03/06/06
Posts: 3,913
Loc: mexicoelcentrodelconocimi...
Trusted Identifier
Re: Psilocybe pellicullosa/silvatica [Re: casgoodie]
    #7744162 - 12/11/07 08:40 AM (16 years, 1 month ago)

radical ¡
lovely¡
can´t wait¡
please god help me ..
all my best vibration ..


--------------------

cuando una rafaga del pensamiento nos pasa  al lado se puede sentir  que valio  la pena  haber vivido, y cuando ese pensamiento se  convierte en sueño no paramos de soñar hasta realizarlo


Extras: Filter Print Post Top
Offlineelflord420
bringer of thedawn
Male User Gallery


Registered: 10/02/07
Posts: 281
Loc: washington
Last seen: 10 years, 3 months
Re: Psilocybe pellicullosa/silvatica [Re: cactu]
    #7744390 - 12/11/07 10:05 AM (16 years, 1 month ago)

no, lol sorry i ment did you find them in what area like Pacific North West, Oregon ect?


--------------------
Dont ever eat mushrooms and watch Total Recall


Extras: Filter Print Post Top
Offlinecasgoodie
weedwright
Male User Gallery

Registered: 10/31/06
Posts: 770
Loc: terra
Last seen: 10 years, 3 months
Re: Psilocybe pellicullosa/silvatica [Re: elflord420]
    #7744573 - 12/11/07 11:20 AM (16 years, 1 month ago)



--------------------
TRAPPED IN LINGUISTIC CONCEPTS


Edited by casgoodie (12/11/07 11:21 AM)


Extras: Filter Print Post Top
Offlineelflord420
bringer of thedawn
Male User Gallery


Registered: 10/02/07
Posts: 281
Loc: washington
Last seen: 10 years, 3 months
Re: Psilocybe pellicullosa/silvatica [Re: casgoodie]
    #7744610 - 12/11/07 11:33 AM (16 years, 1 month ago)

haha the republic of cascadia? Thats a magnificent idea! we need to reclaim our lands.. when WILL we say enough is enough? People still think they are living better under the American government, which it may seem on the surface...


--------------------
Dont ever eat mushrooms and watch Total Recall


Extras: Filter Print Post Top
Offlinecasgoodie
weedwright
Male User Gallery

Registered: 10/31/06
Posts: 770
Loc: terra
Last seen: 10 years, 3 months
Re: Psilocybe pellicullosa/silvatica [Re: elflord420]
    #7744834 - 12/11/07 12:30 PM (16 years, 1 month ago)

i wish it were true. the best country ever!


--------------------
TRAPPED IN LINGUISTIC CONCEPTS


Extras: Filter Print Post Top
Invisiblelandsnorkler


Registered: 09/26/06
Posts: 3,047
Loc: Montana
Trusted Identifier
Re: Psilocybe pellicullosa/silvatica [Re: casgoodie]
    #7745182 - 12/11/07 01:53 PM (16 years, 1 month ago)

hmmm cool. Are you gonna send any of the specimens from this post to Alan? I'm interested in seeing what they are. They're so cool looking-like semilanceatish, and they arouse me!!!


--------------------


Extras: Filter Print Post Top
Offlinecasgoodie
weedwright
Male User Gallery

Registered: 10/31/06
Posts: 770
Loc: terra
Last seen: 10 years, 3 months
Re: Psilocybe pellicullosa/silvatica [Re: landsnorkler]
    #7745220 - 12/11/07 02:03 PM (16 years, 1 month ago)

yep. i am curious as well. i guess it could be potentially pelliculosa, silvatica and washingtonensis (maybe?). they were collected from 2 different locations so maybe more than one species could show up.


--------------------
TRAPPED IN LINGUISTIC CONCEPTS


Extras: Filter Print Post Top
InvisibleMontanahunter420
Mushroom Hunter
Male User Gallery


Registered: 05/10/06
Posts: 1,188
Re: Psilocybe pellicullosa/silvatica [Re: landsnorkler]
    #7745445 - 12/11/07 03:15 PM (16 years, 1 month ago)

casgoodie I am adding this picture to the shroomery Psychoactive Species document, along with credit. If you would like me to remove it please pm me.


--------------------
All of my posts are purely fictional and for hypothetical purposes.


Extras: Filter Print Post Top
InvisibleBlimeyGrimey
Collector of Spores
Male


Folding@home Statistics
Registered: 08/24/05
Posts: 3,788
Loc: Puget Sound
Trusted Identifier
Re: Psilocybe pellicullosa/silvatica [Re: casgoodie]
    #7745621 - 12/11/07 03:55 PM (16 years, 1 month ago)

Wow good find casgoodie! Seems alot of people are finding rare stuff this season. I've found some cyanifibrillosa which seem to be a different species according to Workman. Him and Alan have both been sent samples. Dried mushrooms to Workman and a spore print to Alan.

Here's the info on washingtonensis incase its needed.

Microscopic:
Spores purplish brown in deposit, ellipsoid to slightly ovoid, 6-7.5 (8) by 4-4.5u.

Seems the spores Alan received are too big to be washingtonensis.


--------------------
Message me for free microscopy services on Psilocybe, Panaeolus, and Gymnopilus species.

Looking for wild Panaeolus cinctulus and Panaeolus olivaceus prints.


Extras: Filter Print Post Top
Offlinecasgoodie
weedwright
Male User Gallery

Registered: 10/31/06
Posts: 770
Loc: terra
Last seen: 10 years, 3 months
Re: Psilocybe pellicullosa/silvatica [Re: BlimeyGrimey]
    #7745967 - 12/11/07 05:07 PM (16 years, 1 month ago)

jeverden: no problem, please send me a link to this document so i can see it.

i'm glad more species are being rediscovered and studied further


--------------------
TRAPPED IN LINGUISTIC CONCEPTS


Extras: Filter Print Post Top
InvisibleMontanahunter420
Mushroom Hunter
Male User Gallery


Registered: 05/10/06
Posts: 1,188
Re: Psilocybe pellicullosa/silvatica [Re: casgoodie]
    #7747424 - 12/11/07 10:39 PM (16 years, 1 month ago)

http://www.shroomery.org/9465/Psychoactive-Mushroom-Species


Also found under

Mushroom info / find mushrooms / mushroom hunting faq / active mushrooms

then under the Psychoactive-Mushroom-Species document.


--------------------
All of my posts are purely fictional and for hypothetical purposes.


Extras: Filter Print Post Top
Offlinecasgoodie
weedwright
Male User Gallery

Registered: 10/31/06
Posts: 770
Loc: terra
Last seen: 10 years, 3 months
Re: Psilocybe pellicullosa/silvatica [Re: Montanahunter420]
    #7747463 - 12/11/07 10:53 PM (16 years, 1 month ago)

cool well if it turns out to be silvatica i'll let you know.


--------------------
TRAPPED IN LINGUISTIC CONCEPTS


Extras: Filter Print Post Top
OfflinemyCo_psyCo
a mycologist inthe making
Male User Gallery


Registered: 06/11/05
Posts: 969
Loc: own private hell
Last seen: 10 years, 8 months
Re: Psilocybe pellicullosa/silvatica [Re: casgoodie]
    #7749536 - 12/12/07 02:05 PM (16 years, 1 month ago)

well like i was sayen when we got back and looked at pics i dont think its silvatica because they tend to be more orange. they look and match the decsription of pelli but a few of the specimens look like nothing ive ever seen in the pictures and a lot of them look pretty active lol. i looked everywhere and couldnt find a pic of washingtonesens but the description in psilo mushrooms of the world sounds pretty close.
the first find looks definatly like pelli but from our last hunt they just look really different, maybe its the type of garbage that it grows around haha

anyway i would like to see how the spores from the last 2 sites match up to the first find


--------------------



Extras: Filter Print Post Top
Offlinecasgoodie
weedwright
Male User Gallery

Registered: 10/31/06
Posts: 770
Loc: terra
Last seen: 10 years, 3 months
Re: Psilocybe pellicullosa/silvatica [Re: myCo_psyCo]
    #7754527 - 12/13/07 04:30 PM (16 years, 1 month ago)

ok, well i am no good with a microscope so just posting these for fun. i believe the lens i used was 45X. first image is from a print, and the second image is from a cap fragment.



is that the appropriate magnification for looking at spores?


--------------------
TRAPPED IN LINGUISTIC CONCEPTS


Extras: Filter Print Post Top
Invisiblelandsnorkler


Registered: 09/26/06
Posts: 3,047
Loc: Montana
Trusted Identifier
Re: Psilocybe pellicullosa/silvatica [Re: casgoodie]
    #7754956 - 12/13/07 06:10 PM (16 years, 1 month ago)

Bigger!!!


--------------------


Extras: Filter Print Post Top
Offlinecasgoodie
weedwright
Male User Gallery

Registered: 10/31/06
Posts: 770
Loc: terra
Last seen: 10 years, 3 months
Re: Psilocybe pellicullosa/silvatica [Re: landsnorkler]
    #7755125 - 12/13/07 06:43 PM (16 years, 1 month ago)

ok. i'll try harder next time on a different microscope. there should be better images shortly


--------------------
TRAPPED IN LINGUISTIC CONCEPTS


Extras: Filter Print Post Top
OfflineIce House Shaman
Rider on the Storm
Male User Gallery


Registered: 02/25/03
Posts: 1,244
Loc: PNW
Last seen: 1 year, 2 months
Re: Psilocybe pellicullosa/silvatica [Re: casgoodie]
    #7759791 - 12/14/07 07:22 PM (16 years, 1 month ago)

Ive picked em and eaten em before. I find them along skid/logging roads in tree farms around SW WA Cascades foothills. I dont pick em any more because of the potency. They are very weak, IMHO. and I have an unlimited supply of Cyans. They will do the trick if you eat 50-75 fresh specimens, If you have no tolerance. I have also found them around trash or old dumped autos along logging roads. Very nice finds. They are more common than many people realize.


IHS


--------------------
you are not who i thought i was...


Extras: Filter Print Post Top
Offlinecasgoodie
weedwright
Male User Gallery

Registered: 10/31/06
Posts: 770
Loc: terra
Last seen: 10 years, 3 months
Re: Psilocybe pellicullosa/silvatica [Re: Ice House Shaman]
    #7761995 - 12/15/07 02:28 PM (16 years, 1 month ago)

i just tried em, theyre definately active but pretty weak. they are pretty common, it's just not the kind of mushroom you set out to hunt for, if you stumble upon enough to pick, why not?


--------------------
TRAPPED IN LINGUISTIC CONCEPTS


Extras: Filter Print Post Top
OfflineIce House Shaman
Rider on the Storm
Male User Gallery


Registered: 02/25/03
Posts: 1,244
Loc: PNW
Last seen: 1 year, 2 months
Re: Psilocybe pellicullosa/silvatica [Re: casgoodie]
    #7763730 - 12/15/07 09:59 PM (16 years, 1 month ago)

I agree with you, When I find em I do pick em. When I have em, I like to eat a few of them with my Cyans


--------------------
you are not who i thought i was...


Extras: Filter Print Post Top
Offlinecasgoodie
weedwright
Male User Gallery

Registered: 10/31/06
Posts: 770
Loc: terra
Last seen: 10 years, 3 months
Re: Psilocybe pellicullosa/silvatica [Re: Ice House Shaman]
    #7763942 - 12/15/07 10:43 PM (16 years, 1 month ago)

it's also interesting to see how different psilocybes and panaeolus are active in slightly different ways


--------------------
TRAPPED IN LINGUISTIC CONCEPTS


Extras: Filter Print Post Top
OfflineAlan RockefellerM
Mycologist
Male User Gallery

Registered: 03/10/07
Posts: 48,276
Last seen: 3 hours, 49 minutes
Trusted Identifier
Re: Psilocybe pellicullosa/silvatica [Re: casgoodie]
    #8378124 - 05/08/08 03:49 PM (15 years, 8 months ago)

Here are some SEM's of the spores from this collection that Scout24 made.

1800x:


3000x:


10000x:


Extras: Filter Print Post Top
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 48,276
Last seen: 3 hours, 49 minutes
Trusted Identifier
Re: Psilocybe pellicullosa/silvatica [Re: Alan Rockefeller]
    #27241364 - 03/07/21 03:31 AM (2 years, 10 months ago)

I was able to get a good DNA sequence from this one, and I was surprised to find that it's a 100% match for two sequences of Psilocybe fimetaria.

I wonder how common P. fimetaria is in the PNW, and if this could be a closely related species that has the same ITS sequence as P. fimetaria.  There's enough differences in the sequence to say that it is not P. pelliculosa.

I also wonder if any of the other obscure species in the PNW like P. sierrae or P. subfimetaria are synonyms of P. fimetaria. 

I am also curious as to what the full range of habitats is for P. fimetaria.

ITS sequence:

TCATTATTGAATGAACTTGGCTCGGTTGCAGCTGGTCCTCTCGAGGGCATG
TGCTCGCCGTGTCATCTTTATCTCTCCACCTGTGCACCCTTTGTAGACCTGGATTAGTTAACTTTCCGAGGAAACTCGGT
CGGGAGGATTGCTTTCACGAGCTCTCCTTGCAATTAAGCCCAGGCCTACGTTTTCATATACCCCAAAGTATGTAACAGAA
TGTATCATATGGCCTTGTGCCTATAAACTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACG
CAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTA
TTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTACCAGCTTTTGCTGATAATGGCTTGGATGTGGGGG
TCTTTTGCTGGCTTCGTCAAGAGGTCTGCTCCCCTTAAATGTATTAGCCGGTGCCCCGCGCAGAGCCGTCTATTGGTGTG
ATAATTATCTACGCCGTGGACGTCTGCATGAATGGGATTGCGCTGCTTCTAACCGTCCTTCACTGGACAACACAAATGAC
AATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCATAGGCGGAGGAA

Mushroom Observer record:  https://mushroomobserver.org/7476


Extras: Filter Print Post Top
OfflineRenegadeMycologist
On the case
Male User Gallery


Registered: 12/05/20
Posts: 3,817
Loc: Serbia Flag
Last seen: 8 days, 13 hours
Trusted Identifier
Re: Psilocybe pellicullosa/silvatica [Re: Alan Rockefeller]
    #27250961 - 03/13/21 08:51 AM (2 years, 10 months ago)

Well well well, i missed this thread , and i think Chuck also wanted to see fimetaria pics so here they are.

I would call it peli any day, actually somewhere in between peli and a semi.

Also, no annulus zone, non papillate pileus, and no coprophilic habitat. Next question is, where those matched sequences come from ?

Elusive fimetaria we're after you, you can run but you can't hide


--------------------
:mushroom2:  l e a r n i n g  t h i n g s :mushroom2:


Extras: Filter Print Post Top
InvisibleCHUCK.HNTR
feral urbanite
Male


Registered: 09/30/19
Posts: 2,258
Loc: SF, CA, USA
Re: Psilocybe pellicullosa/silvatica [Re: RenegadeMycologist]
    #27251028 - 03/13/21 09:45 AM (2 years, 10 months ago)

Yup this is what I wanted to see!

Alan could P. fimetaria be the other mushroom going under the name P. pelliculosa?
I think I remember you sequenced your Salt Point find and it matched as pelliculosa.

I dehydrated and saved the P. pelliculosa’ si found this past season at Jackson Demonstration Forest.
Happy to send them your way or send them into get sequenced myself if you think it’s worth doing.


--------------------
"What is the practical application of a million universes?" -Alan Watts
:mushroom2::mushroom2::mushroom2::mushroom2::mushroom2:


Extras: Filter Print Post Top
OfflineAnglerfishM
hearing things
Male User Gallery


Registered: 09/08/10
Posts: 18,643
Loc: Norvegr Flag
Last seen: 8 hours, 54 minutes
Trusted Identifier
Re: Psilocybe pellicullosa/silvatica [Re: RenegadeMycologist]
    #27251030 - 03/13/21 09:47 AM (2 years, 10 months ago)

Quote:

RenegadeMycologist said:
no coprophilic habitat.




Not that we can see, at least. Who knows if a horse came by and did its business there at some point.

And that furthers the question of taxonomy since the name itself indicates an affinity for dung.


--------------------




Extras: Filter Print Post Top
OfflineRenegadeMycologist
On the case
Male User Gallery


Registered: 12/05/20
Posts: 3,817
Loc: Serbia Flag
Last seen: 8 days, 13 hours
Trusted Identifier
Re: Psilocybe pellicullosa/silvatica [Re: Anglerfish]
    #27251138 - 03/13/21 10:48 AM (2 years, 10 months ago)

Quote:

Anglerfish said:
And that furthers the question of taxonomy since the name itself indicates an affinity for dung.



Correct, that's what I keep on saying. Fimetaria as originally described/concepted is probably not the new fimetaria we might end up with. I mean we could keep an old name, but it will not be reflective of the species habits.

That's why I think the most reasonable explanation is that old specimens were probably semilanceata growing on a dung, or semilanceata retaining an anullus, which is unusual, and made people confused enough to coin the fimetaria taxon unnecessarily. (One example is kk's specimen from another thread).
Many times it was probably a liniformans, but people did not check for separable gill edge feature (for example in thread kk shared where there were attempts to cultivate liniformans and where you figured out it was actually liniformans, but the thread started- oooh it's fimetaria!)
Many species do various kind of 'variations', for example semiovatus sometimes lacks a ring, and that variation is called semiovatus var.phaeleonarum (just a stupid example).

New ressurected fitetaria could be something else, so I wonder how those mushrooms actually look like, those with which it got sequence match, and also, where do they come from.


--------------------
:mushroom2:  l e a r n i n g  t h i n g s :mushroom2:


Edited by RenegadeMycologist (03/13/21 10:55 AM)


Extras: Filter Print Post Top
OfflineRenegadeMycologist
On the case
Male User Gallery


Registered: 12/05/20
Posts: 3,817
Loc: Serbia Flag
Last seen: 8 days, 13 hours
Trusted Identifier
Re: Psilocybe pellicullosa/silvatica [Re: RenegadeMycologist]
    #27251146 - 03/13/21 10:53 AM (2 years, 10 months ago)

Neotype for 'fimetaria' must be constructed, and for now I've only seen this observation.

Or, Anglerfish voluteners to do a hard work and dig some holes and search for composted horse manure and proves me wrong.


--------------------
:mushroom2:  l e a r n i n g  t h i n g s :mushroom2:


Extras: Filter Print Post Top
OfflineAnglerfishM
hearing things
Male User Gallery


Registered: 09/08/10
Posts: 18,643
Loc: Norvegr Flag
Last seen: 8 hours, 54 minutes
Trusted Identifier
Re: Psilocybe pellicullosa/silvatica [Re: RenegadeMycologist]
    #27251210 - 03/13/21 11:39 AM (2 years, 10 months ago)

Quote:

RenegadeMycologist said:
Neotype for 'fimetaria' must be constructed, and for now I've only seen this observation.





Check these observations of presumed P. fimetaria from Denmark:

https://svampe.databasen.org/taxon/19328


--------------------




Extras: Filter Print Post Top
OfflineRenegadeMycologist
On the case
Male User Gallery


Registered: 12/05/20
Posts: 3,817
Loc: Serbia Flag
Last seen: 8 days, 13 hours
Trusted Identifier
Re: Psilocybe pellicullosa/silvatica [Re: Anglerfish]
    #27251440 - 03/13/21 02:01 PM (2 years, 10 months ago)

FOLLOWING IS OLD POST OF MINE IN WHICH I AM TERRIBLY WRONG. DID NOT UNDERSTAND OR HAD ENOUGH REFERENCE MATERIAL FOR UNDERSTANDING FIMETARIA. I WAS ALSO A DOUCHEBAG. WILL NOT EDIT OR DELETE IT, MY EGO IS NOT HURT, WE LIVE AND LEARN.

That is Psilocybe semilanceata with preserved annulus and coprophilic habitat. I bet it would match 100% with semilanceata if sequenced.

I can see only one picture, but if there were more, I bet they would look like this (observation from England - https://mushroomobserver.org/437738?q=1eQHfin) in which it says in the end (as it always does) - "Growing in the same habitat as Psilocybe Semilanceata, sometimes right next to it."

Compare the last picture in this England find, with the Denmark find, it's the same species. Then look all the other pictures from England find (because it is a bigger sample), many of them could easily pass as semilanceata. It is semilanceata with oddball morphology and habitat, no need for creating new taxons. Microscopy also suggest they are synonyms, since there are no distinguishing features. That is not something to go by, but at this point only dna could prove fimetaria, since observations and microscopy failed.
I would also take into account what kk said about mushrooms proved to be libs and outnumbering fimetaria 100/1, since he is here for a long time and probably seen dozens of potential fimetaria requests, as I'm sure you also witnessed before my time here.

Also, Denmark find looks nothing like the one Alan labeled fimetaria and from this thread, for which I wonder, what did it match with.


Edited by RenegadeMycologist (09/09/23 01:58 PM)


Extras: Filter Print Post Top
OfflineAnglerfishM
hearing things
Male User Gallery


Registered: 09/08/10
Posts: 18,643
Loc: Norvegr Flag
Last seen: 8 hours, 54 minutes
Trusted Identifier
Re: Psilocybe pellicullosa/silvatica [Re: RenegadeMycologist]
    #27251542 - 03/13/21 03:39 PM (2 years, 10 months ago)

Quote:

RenegadeMycologist said:
That is Psilocybe semilanceata with preserved annulus and coprophilic habitat. I bet it would match 100% with semilanceata if sequenced.




I'm not so sure. The veil remnants on the cap speak against, P. semilanceata which at least in my experience never has that feature.

I don't think these pictures are conclusive of anything, though, but surely suggestive of a species different to P. semilanceata.

The hunt continues...


--------------------




Extras: Filter Print Post Top
Offlinesemilancreator
Stranger
 User Gallery


Registered: 03/24/21
Posts: 54
Last seen: 3 days, 8 hours
Re: Psilocybe pellicullosa/silvatica [Re: Anglerfish]
    #27268421 - 03/25/21 06:44 AM (2 years, 9 months ago)

As for Fimetaria. I've found a couple macroscopically ID by Alan. They seem a lot more common here in the Netherlands or at least we find a lot of blueing dung psilocybes (if there is any discussion about the actual existence of Fimetaria, Liniformans or the more evasive Puberula) the last 10 years or so. Mostly they are found in old pastures in dunes near the sea. This year I will do a big Fimetaria Hunt from October all the way to December. I will keep u posted.
As for now check my thread in Advanced mycology where I try to grow out the supposed Fimetaria.


Extras: Filter Print Post Top
OfflineRenegadeMycologist
On the case
Male User Gallery


Registered: 12/05/20
Posts: 3,817
Loc: Serbia Flag
Last seen: 8 days, 13 hours
Trusted Identifier
Re: Psilocybe pellicullosa/silvatica [Re: semilancreator]
    #27268450 - 03/25/21 07:16 AM (2 years, 9 months ago)

Doubt fimetaria is any different than 'strictipes', 'subfimetaria' or similar mysterious/non-existent taxons.

If it really does exist, I would like to see some respectable observations, then sequenced to see how close/far is to Ps.semilanceata. And how close is to those 2 sequences and Alans sequence for this one in this thread. That will conclude, either this from this thread and the two matched with it should be renamed to something else, or fimetaria is indeed standalone species.

As far as I see it, it shares with Ps.semilanceata same habitat, same micro characteristics, exact same fruiting season etc. Usually found few meters apart in the same field.
The only difference is that's growing from dung (if not, why name Fimetaria?), and that could explain absence of strong papilla as in ordinary libs, where they need pointy shape to push though grass roots.

As far as Ps.liniformans go, I've seen compelling evidence for it's existence, not requiring DNA sequencing, although that one should be sequenced as well.

@semilancreator
All the distinguishing features you listed in our corespondence for Psilocybe, like separable pelicle, or striate margin, or gill attachment, happens in Deconica as well. Other than bluing, there is not much difference in many cases, and many collections are ambiguous.
Send those fimetaria my way, or directly in Spain, I'm paying for them to get sequenced, like I already said I will.


--------------------
:mushroom2:  l e a r n i n g  t h i n g s :mushroom2:


Extras: Filter Print Post Top
OfflineRenegadeMycologist
On the case
Male User Gallery


Registered: 12/05/20
Posts: 3,817
Loc: Serbia Flag
Last seen: 8 days, 13 hours
Trusted Identifier
Re: Psilocybe pellicullosa/silvatica [Re: RenegadeMycologist]
    #27268458 - 03/25/21 07:26 AM (2 years, 9 months ago)

That said, I'm eager to find out how your fimetaria grow will turn out. Other than wood loving species and cubes, I don't have much experience in cultivation, so I can't chime in with any advice on that - other than straw/dung would probably be ideal bulk substrate.

Ps.liniformans is grown with great results, but Ps.semilanceata resisted all attempts at it. Best I've seen is 3 mushrooms from Cronicr, and if somebody seen/did better, please share link.
So I suspect your fimetaria could resist cultivation attempts.


--------------------
:mushroom2:  l e a r n i n g  t h i n g s :mushroom2:


Extras: Filter Print Post Top
OfflineAnglerfishM
hearing things
Male User Gallery


Registered: 09/08/10
Posts: 18,643
Loc: Norvegr Flag
Last seen: 8 hours, 54 minutes
Trusted Identifier
Re: Psilocybe pellicullosa/silvatica [Re: RenegadeMycologist]
    #27268482 - 03/25/21 07:49 AM (2 years, 9 months ago)

Quote:

RenegadeMycologist said:
Ps.semilanceata resisted all attempts at it. Best I've seen is 3 mushrooms from Cronicr, and if somebody seen/did better, please share link.




CaptainFuture did a pretty impressive grow many years ago: https://www.shroomery.org/forums/showflat.php/Number/13605521#13605521

Quote:

So I suspect your fimetaria could resist cultivation attempts.




Possibly. But consider that a dung loving species could have different growth parameters. It's always worth a try.


--------------------




Extras: Filter Print Post Top
OfflineRenegadeMycologist
On the case
Male User Gallery


Registered: 12/05/20
Posts: 3,817
Loc: Serbia Flag
Last seen: 8 days, 13 hours
Trusted Identifier
Re: Psilocybe pellicullosa/silvatica [Re: Anglerfish]
    #27268500 - 03/25/21 08:12 AM (2 years, 9 months ago)

Nicccccce, thanks for the link man :thumbup:

I'm cheering for the fimetaria grow. Think he should prolly hit mushroom cultivation, probably will get better response, adv mycology is dead end street.


--------------------
:mushroom2:  l e a r n i n g  t h i n g s :mushroom2:


Extras: Filter Print Post Top
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 48,276
Last seen: 3 hours, 49 minutes
Trusted Identifier
Re: Psilocybe pellicullosa/silvatica [Re: RenegadeMycologist]
    #27270138 - 03/26/21 10:32 AM (2 years, 9 months ago)

Quote:

RenegadeMycologist said:
Doubt fimetaria is any different than 'strictipes', 'subfimetaria' or similar mysterious/non-existent taxons.





Psilocybe fimetaria is quite distinct from Psilocybe strictipes.  P. strictipes is a synonym of P. semilanceata.  I am not sure what P. subfimetaria is.


Extras: Filter Print Post Top
Offlinesemilancreator
Stranger
 User Gallery


Registered: 03/24/21
Posts: 54
Last seen: 3 days, 8 hours
Re: Psilocybe pellicullosa/silvatica [Re: Alan Rockefeller]
    #27270145 - 03/26/21 10:40 AM (2 years, 9 months ago)

Quote:

Alan Rockefeller said:
Quote:

RenegadeMycologist said:
Doubt fimetaria is any different than 'strictipes', 'subfimetaria' or similar mysterious/non-existent taxons.





Psilocybe fimetaria is quite distinct from Psilocybe strictipes.  P. strictipes is a synonym of P. semilanceata.  I am not sure what P. subfimetaria is.




I think that what Renegade ment was that he thinks Fimetaria as a species will end up like Stictipes did... first being a seperate species however after proper analysis turning out to be in fact just Semilanceata. I think Renegade has the opinion that Fimetaria is a weird variety of Semilanceata however I do disagree since I found Fimetaria both in Semi and non semi habitat.

peace!


Extras: Filter Print Post Top
OfflineRenegadeMycologist
On the case
Male User Gallery


Registered: 12/05/20
Posts: 3,817
Loc: Serbia Flag
Last seen: 8 days, 13 hours
Trusted Identifier
Re: Psilocybe pellicullosa/silvatica [Re: semilancreator]
    #27270231 - 03/26/21 11:53 AM (2 years, 9 months ago)

Quote:

semilancreator said:
I think that what Renegade ment was that he thinks Fimetaria as a species will end up like Stictipes did... first being a seperate species however after proper analysis turning out to be in fact just Semilanceata. I think Renegade has the opinion that Fimetaria is a weird variety of Semilanceata...



Exactly, couldn't put it any better myself.

Wasn't comparing fimetaria to strictipes, not directly at least, I was just making a parallel how that taxon was unnessesary, and it's just a common variety of existing species.

Since it likes the same habitats and has the same fruting season, and it's usually in close viscinity of semilanceata, I have a theory, well it's just a hypothesis, that it could be semi.
I based that hypothesis on not well documented Fimetaria finds, overlapping microscopic characteristics with semilanceata, and many specimens having ambiguous morphological characteristics. Guzman's description of fimetaria does not really work with some of the supposed fimetaria finds. Not only in morphology, but in not 'fimetaria' (dung) habitat.
That is why I think european specimens (from dung and grass) should be collected, sequenced, and run against the database.

I know Alan that you got 2 matches with fimetaria, but that's a match with collections labeled fimetaria, maybe it's undesribed Psilocybe, and fimetaria is something else.

But all that is just a speculation and hypothesis, main reason I'm pushing this is to understand fimetaria better, since it's been quite mysterious during the years, and to help people identify fimetaria easier if it's real.


--------------------
:mushroom2:  l e a r n i n g  t h i n g s :mushroom2:


Extras: Filter Print Post Top
Offlinesemilancreator
Stranger
 User Gallery


Registered: 03/24/21
Posts: 54
Last seen: 3 days, 8 hours
Re: Psilocybe pellicullosa/silvatica [Re: RenegadeMycologist]
    #27270298 - 03/26/21 12:57 PM (2 years, 9 months ago)

Again I have to disagree on the semilanceata part (fimetaria also being found in nonsemi habitat like sanddunes and fields covered in moss) however the rest is interesting. This year I will do a big Fimi hunt and I allready got some Dutch shroomers anxious to help me. Hopefully we will be able to collect a large collection of the species to do proper testing on them.


Extras: Filter Print Post Top
OfflineAnglerfishM
hearing things
Male User Gallery


Registered: 09/08/10
Posts: 18,643
Loc: Norvegr Flag
Last seen: 8 hours, 54 minutes
Trusted Identifier
Re: Psilocybe pellicullosa/silvatica [Re: semilancreator]
    #27270314 - 03/26/21 01:17 PM (2 years, 9 months ago)

Quote:

semilancreator said:
Again I have to disagree on the semilanceata part (fimetaria also being found in nonsemi habitat like sanddunes and fields covered in moss)




Have you confirmed 100% that the ones growing in moss and sand dunes are P. fimetaria and not a different species?

Quote:

This year I will do a big Fimi hunt and I allready got some Dutch shroomers anxious to help me. Hopefully we will be able to collect a large collection of the species to do proper testing on them.




That sounds like a great idea, can't wait to see what you find!

Please make sure to put each collection in separate containers and take written notes of all features including habitat.
Also test for separable gill edge if it is P. liniformans. From the descriptions I take it that the two species can look
extremely similar if this feature is overlooked.

Looking forward to some Psilocybe Euro-porn! :crazy2:


--------------------




Extras: Filter Print Post Top
OfflineRenegadeMycologist
On the case
Male User Gallery


Registered: 12/05/20
Posts: 3,817
Loc: Serbia Flag
Last seen: 8 days, 13 hours
Trusted Identifier
Re: Psilocybe pellicullosa/silvatica [Re: Anglerfish]
    #27270350 - 03/26/21 01:55 PM (2 years, 9 months ago)

Quote:

Anglerfish said:
Please make sure to put each collection in separate containers and take written notes of all features including habitat.
Also test for separable gill edge if it is P. liniformans. From the descriptions I take it that the two species can look
extremely similar if this feature is overlooked.

Looking forward to some Psilocybe Euro-porn! :crazy2:



:whathesaid:


--------------------
:mushroom2:  l e a r n i n g  t h i n g s :mushroom2:


Extras: Filter Print Post Top
OfflineRenegadeMycologist
On the case
Male User Gallery


Registered: 12/05/20
Posts: 3,817
Loc: Serbia Flag
Last seen: 8 days, 13 hours
Trusted Identifier
Re: Psilocybe pellicullosa/silvatica [Re: semilancreator]
    #27270358 - 03/26/21 02:00 PM (2 years, 9 months ago)

Quote:

semilancreator said:
fimetaria also being found in nonsemi habitat like sanddunes and fields covered in moss



Fimis apparently also like to found themselves in coniferous highland woodland like fimis from this thread :crazy2:


--------------------
:mushroom2:  l e a r n i n g  t h i n g s :mushroom2:


Extras: Filter Print Post Top
OfflineRenegadeMycologist
On the case
Male User Gallery


Registered: 12/05/20
Posts: 3,817
Loc: Serbia Flag
Last seen: 8 days, 13 hours
Trusted Identifier
Re: Psilocybe pellicullosa/silvatica [Re: RenegadeMycologist]
    #27270362 - 03/26/21 02:05 PM (2 years, 9 months ago)

I think op's mushroom is silvaticas/medullosas retarded mutated dna cousin....

...and also, half observed fimis are deconica, other half are retarded semis :crazy2:

:robindance:


--------------------
:mushroom2:  l e a r n i n g  t h i n g s :mushroom2:


Extras: Filter Print Post Top
Offlinesemilancreator
Stranger
 User Gallery


Registered: 03/24/21
Posts: 54
Last seen: 3 days, 8 hours
Re: Psilocybe pellicullosa/silvatica [Re: Anglerfish]
    #27271884 - 03/27/21 01:45 PM (2 years, 9 months ago)

Yeah I will try to get a proper study going and photograph a lot of surrounding flora and fauna to get a good picture of what makes these creatures thrive. Ofcourse I check for the layer on the gills to confirm liniformans and to look for the distinct gills of the Deconica genus. It's nice to be able to do some science instead of just shroom around hahaha

peace!


Extras: Filter Print Post Top
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 48,276
Last seen: 3 hours, 49 minutes
Trusted Identifier
Re: Psilocybe pellicullosa/silvatica [Re: semilancreator]
    #27273843 - 03/28/21 11:40 PM (2 years, 9 months ago)

Quote:

semilancreator said:
I think that what Renegade ment was that he thinks Fimetaria as a species will end up like Stictipes did... first being a seperate species however after proper analysis turning out to be in fact just Semilanceata. I think Renegade has the opinion that Fimetaria is a weird variety of Semilanceata





That is not correct.  Psilocybe fimetaria is a good species with a unique DNA sequence.


Extras: Filter Print Post Top
Offlinesemilancreator
Stranger
 User Gallery


Registered: 03/24/21
Posts: 54
Last seen: 3 days, 8 hours
Re: Psilocybe pellicullosa/silvatica [Re: Alan Rockefeller]
    #27274568 - 03/29/21 02:41 PM (2 years, 9 months ago)

Indeed. True Fimetaria is something on it's own. However I have seen finds documented on the internet which are actually Deconica or Stropharia. I myself have seen one find that could be a flattened Semilanceata as well.
But again, point is that Fimetaria is a seperate species. I have found one person who might have tried them but I am not yet able to contact him. I am sending samples of my Fimetaria find to both Spain and Alan for sequencing and hopefully coming year I will collect so much that proper research alkaloid wise can be done on them when I send it to a lab!

Semilancreator,


Extras: Filter Print Post Top
OfflineRenegadeMycologist
On the case
Male User Gallery


Registered: 12/05/20
Posts: 3,817
Loc: Serbia Flag
Last seen: 8 days, 13 hours
Trusted Identifier
Re: Psilocybe pellicullosa/silvatica [Re: Alan Rockefeller]
    #27274662 - 03/29/21 03:34 PM (2 years, 9 months ago)

Quote:

Alan Rockefeller said:
Quote:

semilancreator said:
I think that what Renegade ment was that he thinks Fimetaria as a species will end up like Stictipes did... first being a seperate species however after proper analysis turning out to be in fact just Semilanceata. I think Renegade has the opinion that Fimetaria is a weird variety of Semilanceata



That is not correct.  Psilocybe fimetaria is a good species with a unique DNA sequence.



Perhaps sequence not so unique if it's identical to 'fimetaria' from this thread.
Why would specimen from high altitude coniferous forest match with European dung loving Psilocybe with a different morphology ?

Reference database for fimetaria is very weak.
Considering Genbank entries, I assume you were working with specimens collected September 5th, 1968 by R. J. Benedict in Washington, USA and with the original type specimens of Watling - collected two years prior, September 21st 1966 in Idaho, USA.
Also with one specimen from France.

You said this "pelliculosa/silvatica" got 2 matches, with which of those 3 fimetarias? I can't blast the results atm, my pc is broken.

Meanwhile I've seen some compelling photos of fimetaria from the Netherlands, so I'm slowly changing my mind about existence of fimetaria as a distinct species, but I'm working with semilancreator to understand it better.
I also wonder if Orton and Watling types even match.

Whatever the case may be, fimetaria is interesting and should be studied.


--------------------
:mushroom2:  l e a r n i n g  t h i n g s :mushroom2:


Extras: Filter Print Post Top
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 48,276
Last seen: 3 hours, 49 minutes
Trusted Identifier
Re: Psilocybe pellicullosa/silvatica [Re: RenegadeMycologist]
    #27276325 - 03/30/21 08:54 PM (2 years, 9 months ago)

Quote:

RenegadeMycologist said:
Perhaps sequence not so unique if it's identical to 'fimetaria' from this thread. Why would specimen from high altitude coniferous forest match with European dung loving Psilocybe with a different morphology ?




A pipetting error is a possibility.  I wasn't very good at pipetting in 2012.

Quote:

Reference database for fimetaria is very weak.




I have more sequences than are in Genbank.  Some I submitted a couple days ago and will be in Genbank in a few days, others are sequences that other researchers sent me and asked me to keep them private until they publish them.


Quote:

Considering Genbank entries, I assume you were working with specimens collected September 5th, 1968 by R. J. Benedict in Washington, USA and with the original type specimens of Watling - collected two years prior, September 21st 1966 in Idaho, USA.




Those haven't been sequenced yet and are in the Kew herbarium.  I don't have a way to access those.


Quote:

You said this "pelliculosa/silvatica" got 2 matches, with which of those 3 fimetarias? I can't blast the results atm, my pc is broken.




It matches all of the fimetaria sequences I have.

Quote:

I also wonder if Orton and Watling types even match.




Hopefully it still can be found and has good DNA.

Quote:

Whatever the case may be, fimetaria is interesting and should be studied.




I'll put it on agar and send the culture to people who like to grow rare stuff.


Extras: Filter Print Post Top
OfflineRenegadeMycologist
On the case
Male User Gallery


Registered: 12/05/20
Posts: 3,817
Loc: Serbia Flag
Last seen: 8 days, 13 hours
Trusted Identifier
Re: Psilocybe pellicullosa/silvatica [Re: Alan Rockefeller]
    #27276664 - 03/31/21 04:59 AM (2 years, 9 months ago)

Cool. Thanks for the explanation.

I understand whole fimetaria thing much better now.


--------------------
:mushroom2:  l e a r n i n g  t h i n g s :mushroom2:


Extras: Filter Print Post Top
Offlinesemilancreator
Stranger
 User Gallery


Registered: 03/24/21
Posts: 54
Last seen: 3 days, 8 hours
Re: Psilocybe pellicullosa/silvatica [Re: RenegadeMycologist]
    #27280398 - 04/24/21 12:33 PM (2 years, 9 months ago)

Hopefully the package to Alan arrives soon and we can sequence it and when our people in spain do the same we will know a lot more. This year will be the year of the Fimetaria :laugh:


Extras: Filter Print Post Top
Jump to top Pages: 1 | 2 | 3 | 4  [ show all ]

Shop: Original Sensible Seeds Bulk Cannabis Seeds   Mushroom-Hut Substrate Bags   Left Coast Kratom Buy Kratom Extract   North Spore Bulk Substrate   Kraken Kratom Red Vein Kratom   PhytoExtractum Kratom Powder for Sale


Similar ThreadsPosterViewsRepliesLast post
* psilocybe silvatica crod321 14,663 13 10/11/07 04:19 PM
by canid
* Needed: Psilocybe baeocystis pictures Alan RockefellerM 2,576 14 11/30/07 04:42 PM
by quiksilver98
* Psilocybe from a forest in Finland (silvatica??)
( 1 2 3 all )
knarkkorven 11,041 57 08/30/12 06:11 PM
by novictimnocrime
* Ps silvatica BookSaw 1,837 7 10/16/08 11:40 PM
by Mr. Mushrooms
* Psilocybe silvatica Infested 3,866 13 07/27/07 01:19 PM
by mjshroomer
* Need help identifying, Psilocybe silvatica? Pacific Northwest crod321 2,080 1 10/07/07 10:57 AM
by landsnorkler
* conocybe unknown active (smithii)
( 1 2 3 all )
trigger 5,807 45 03/14/09 07:33 PM
by Bobzimmer
* Psilocybe Caerulipes?
( 1 2 all )
Zen Peddler 9,713 33 12/15/02 07:05 AM
by Anonymous

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: ToxicMan, inski, Alan Rockefeller, Duggstar, TimmiT, Anglerfish, Tmethyl, Lucis, Doc9151, Land Trout
7,582 topic views. 3 members, 22 guests and 17 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2024 Mind Media. Some rights reserved.

Generated in 0.038 seconds spending 0.005 seconds on 12 queries.