|
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
|
casgoodie
weedwright


Registered: 10/31/06
Posts: 770
Loc: terra
Last seen: 10 years, 3 months
|
Re: Psilocybe pellicullosa/silvatica [Re: landsnorkler]
#7745220 - 12/11/07 02:03 PM (16 years, 1 month ago) |
|
|
yep. i am curious as well. i guess it could be potentially pelliculosa, silvatica and washingtonensis (maybe?). they were collected from 2 different locations so maybe more than one species could show up.
-------------------- TRAPPED IN LINGUISTIC CONCEPTS
|
Montanahunter420
Mushroom Hunter



Registered: 05/10/06
Posts: 1,188
|
Re: Psilocybe pellicullosa/silvatica [Re: landsnorkler]
#7745445 - 12/11/07 03:15 PM (16 years, 1 month ago) |
|
|
casgoodie I am adding this picture to the shroomery Psychoactive Species document, along with credit. If you would like me to remove it please pm me.
-------------------- All of my posts are purely fictional and for hypothetical purposes.
|
BlimeyGrimey
Collector of Spores




Registered: 08/24/05
Posts: 3,788
Loc: Puget Sound
|
Re: Psilocybe pellicullosa/silvatica [Re: casgoodie]
#7745621 - 12/11/07 03:55 PM (16 years, 1 month ago) |
|
|
Wow good find casgoodie! Seems alot of people are finding rare stuff this season. I've found some cyanifibrillosa which seem to be a different species according to Workman. Him and Alan have both been sent samples. Dried mushrooms to Workman and a spore print to Alan.
Here's the info on washingtonensis incase its needed.
Microscopic: Spores purplish brown in deposit, ellipsoid to slightly ovoid, 6-7.5 (8) by 4-4.5u.
Seems the spores Alan received are too big to be washingtonensis.
-------------------- Message me for free microscopy services on Psilocybe, Panaeolus, and Gymnopilus species. Looking for wild Panaeolus cinctulus and Panaeolus olivaceus prints.
|
casgoodie
weedwright


Registered: 10/31/06
Posts: 770
Loc: terra
Last seen: 10 years, 3 months
|
Re: Psilocybe pellicullosa/silvatica [Re: BlimeyGrimey]
#7745967 - 12/11/07 05:07 PM (16 years, 1 month ago) |
|
|
jeverden: no problem, please send me a link to this document so i can see it.
i'm glad more species are being rediscovered and studied further
-------------------- TRAPPED IN LINGUISTIC CONCEPTS
|
Montanahunter420
Mushroom Hunter



Registered: 05/10/06
Posts: 1,188
|
Re: Psilocybe pellicullosa/silvatica [Re: casgoodie]
#7747424 - 12/11/07 10:39 PM (16 years, 1 month ago) |
|
|
http://www.shroomery.org/9465/Psychoactive-Mushroom-Species
Also found under
Mushroom info / find mushrooms / mushroom hunting faq / active mushrooms
then under the Psychoactive-Mushroom-Species document.
-------------------- All of my posts are purely fictional and for hypothetical purposes.
|
casgoodie
weedwright


Registered: 10/31/06
Posts: 770
Loc: terra
Last seen: 10 years, 3 months
|
|
cool well if it turns out to be silvatica i'll let you know.
-------------------- TRAPPED IN LINGUISTIC CONCEPTS
|
myCo_psyCo
a mycologist inthe making



Registered: 06/11/05
Posts: 969
Loc: own private hell
Last seen: 10 years, 8 months
|
Re: Psilocybe pellicullosa/silvatica [Re: casgoodie]
#7749536 - 12/12/07 02:05 PM (16 years, 1 month ago) |
|
|
well like i was sayen when we got back and looked at pics i dont think its silvatica because they tend to be more orange. they look and match the decsription of pelli but a few of the specimens look like nothing ive ever seen in the pictures and a lot of them look pretty active lol. i looked everywhere and couldnt find a pic of washingtonesens but the description in psilo mushrooms of the world sounds pretty close. the first find looks definatly like pelli but from our last hunt they just look really different, maybe its the type of garbage that it grows around haha
anyway i would like to see how the spores from the last 2 sites match up to the first find
|
casgoodie
weedwright


Registered: 10/31/06
Posts: 770
Loc: terra
Last seen: 10 years, 3 months
|
Re: Psilocybe pellicullosa/silvatica [Re: myCo_psyCo]
#7754527 - 12/13/07 04:30 PM (16 years, 1 month ago) |
|
|
ok, well i am no good with a microscope so just posting these for fun. i believe the lens i used was 45X. first image is from a print, and the second image is from a cap fragment.

 is that the appropriate magnification for looking at spores?
-------------------- TRAPPED IN LINGUISTIC CONCEPTS
|
landsnorkler


Registered: 09/26/06
Posts: 3,047
Loc: Montana
|
Re: Psilocybe pellicullosa/silvatica [Re: casgoodie]
#7754956 - 12/13/07 06:10 PM (16 years, 1 month ago) |
|
|
Bigger!!!
|
casgoodie
weedwright


Registered: 10/31/06
Posts: 770
Loc: terra
Last seen: 10 years, 3 months
|
Re: Psilocybe pellicullosa/silvatica [Re: landsnorkler]
#7755125 - 12/13/07 06:43 PM (16 years, 1 month ago) |
|
|
ok. i'll try harder next time on a different microscope. there should be better images shortly
-------------------- TRAPPED IN LINGUISTIC CONCEPTS
|
Ice House Shaman
Rider on the Storm



Registered: 02/25/03
Posts: 1,244
Loc: PNW
Last seen: 1 year, 2 months
|
Re: Psilocybe pellicullosa/silvatica [Re: casgoodie]
#7759791 - 12/14/07 07:22 PM (16 years, 1 month ago) |
|
|
Ive picked em and eaten em before. I find them along skid/logging roads in tree farms around SW WA Cascades foothills. I dont pick em any more because of the potency. They are very weak, IMHO. and I have an unlimited supply of Cyans. They will do the trick if you eat 50-75 fresh specimens, If you have no tolerance. I have also found them around trash or old dumped autos along logging roads. Very nice finds. They are more common than many people realize.
IHS
-------------------- you are not who i thought i was...
|
casgoodie
weedwright


Registered: 10/31/06
Posts: 770
Loc: terra
Last seen: 10 years, 3 months
|
|
i just tried em, theyre definately active but pretty weak. they are pretty common, it's just not the kind of mushroom you set out to hunt for, if you stumble upon enough to pick, why not?
-------------------- TRAPPED IN LINGUISTIC CONCEPTS
|
Ice House Shaman
Rider on the Storm



Registered: 02/25/03
Posts: 1,244
Loc: PNW
Last seen: 1 year, 2 months
|
Re: Psilocybe pellicullosa/silvatica [Re: casgoodie]
#7763730 - 12/15/07 09:59 PM (16 years, 1 month ago) |
|
|
I agree with you, When I find em I do pick em. When I have em, I like to eat a few of them with my Cyans
-------------------- you are not who i thought i was...
|
casgoodie
weedwright


Registered: 10/31/06
Posts: 770
Loc: terra
Last seen: 10 years, 3 months
|
|
it's also interesting to see how different psilocybes and panaeolus are active in slightly different ways
-------------------- TRAPPED IN LINGUISTIC CONCEPTS
|
Alan Rockefeller
Mycologist


Registered: 03/10/07
Posts: 48,276
Last seen: 1 hour, 2 minutes
|
Re: Psilocybe pellicullosa/silvatica [Re: casgoodie]
#8378124 - 05/08/08 03:49 PM (15 years, 8 months ago) |
|
|
Here are some SEM's of the spores from this collection that Scout24 made.
1800x:

3000x:

10000x:
|
Alan Rockefeller
Mycologist

Registered: 03/10/07
Posts: 48,276
Last seen: 1 hour, 2 minutes
|
|
I was able to get a good DNA sequence from this one, and I was surprised to find that it's a 100% match for two sequences of Psilocybe fimetaria.
I wonder how common P. fimetaria is in the PNW, and if this could be a closely related species that has the same ITS sequence as P. fimetaria. There's enough differences in the sequence to say that it is not P. pelliculosa.
I also wonder if any of the other obscure species in the PNW like P. sierrae or P. subfimetaria are synonyms of P. fimetaria.
I am also curious as to what the full range of habitats is for P. fimetaria.
ITS sequence:
TCATTATTGAATGAACTTGGCTCGGTTGCAGCTGGTCCTCTCGAGGGCATG TGCTCGCCGTGTCATCTTTATCTCTCCACCTGTGCACCCTTTGTAGACCTGGATTAGTTAACTTTCCGAGGAAACTCGGT CGGGAGGATTGCTTTCACGAGCTCTCCTTGCAATTAAGCCCAGGCCTACGTTTTCATATACCCCAAAGTATGTAACAGAA TGTATCATATGGCCTTGTGCCTATAAACTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACG CAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTA TTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTACCAGCTTTTGCTGATAATGGCTTGGATGTGGGGG TCTTTTGCTGGCTTCGTCAAGAGGTCTGCTCCCCTTAAATGTATTAGCCGGTGCCCCGCGCAGAGCCGTCTATTGGTGTG ATAATTATCTACGCCGTGGACGTCTGCATGAATGGGATTGCGCTGCTTCTAACCGTCCTTCACTGGACAACACAAATGAC AATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCATAGGCGGAGGAA
Mushroom Observer record: https://mushroomobserver.org/7476
|
RenegadeMycologist
On the case



Registered: 12/05/20
Posts: 3,817
Loc: Serbia
Last seen: 8 days, 14 hours
|
|
Well well well, i missed this thread , and i think Chuck also wanted to see fimetaria pics so here they are.
I would call it peli any day, actually somewhere in between peli and a semi.
Also, no annulus zone, non papillate pileus, and no coprophilic habitat. Next question is, where those matched sequences come from ?
Elusive fimetaria we're after you, you can run but you can't hide
--------------------
l e a r n i n g t h i n g s
|
CHUCK.HNTR
feral urbanite



Registered: 09/30/19
Posts: 2,258
Loc: SF, CA, USA
|
|
Yup this is what I wanted to see!
Alan could P. fimetaria be the other mushroom going under the name P. pelliculosa? I think I remember you sequenced your Salt Point find and it matched as pelliculosa.
I dehydrated and saved the P. pelliculosa’ si found this past season at Jackson Demonstration Forest. Happy to send them your way or send them into get sequenced myself if you think it’s worth doing.
-------------------- "What is the practical application of a million universes?" -Alan Watts
   
|
Anglerfish
hearing things



Registered: 09/08/10
Posts: 18,643
Loc: Norvegr
Last seen: 10 hours, 9 minutes
|
|
Quote:
RenegadeMycologist said: no coprophilic habitat.
Not that we can see, at least. Who knows if a horse came by and did its business there at some point.
And that furthers the question of taxonomy since the name itself indicates an affinity for dung.
--------------------
★★★★★
|
RenegadeMycologist
On the case



Registered: 12/05/20
Posts: 3,817
Loc: Serbia
Last seen: 8 days, 14 hours
|
Re: Psilocybe pellicullosa/silvatica [Re: Anglerfish]
#27251138 - 03/13/21 10:48 AM (2 years, 10 months ago) |
|
|
Quote:
Anglerfish said: And that furthers the question of taxonomy since the name itself indicates an affinity for dung.
Correct, that's what I keep on saying. Fimetaria as originally described/concepted is probably not the new fimetaria we might end up with. I mean we could keep an old name, but it will not be reflective of the species habits.
That's why I think the most reasonable explanation is that old specimens were probably semilanceata growing on a dung, or semilanceata retaining an anullus, which is unusual, and made people confused enough to coin the fimetaria taxon unnecessarily. (One example is kk's specimen from another thread). Many times it was probably a liniformans, but people did not check for separable gill edge feature (for example in thread kk shared where there were attempts to cultivate liniformans and where you figured out it was actually liniformans, but the thread started- oooh it's fimetaria!) Many species do various kind of 'variations', for example semiovatus sometimes lacks a ring, and that variation is called semiovatus var.phaeleonarum (just a stupid example).
New ressurected fitetaria could be something else, so I wonder how those mushrooms actually look like, those with which it got sequence match, and also, where do they come from.
--------------------
l e a r n i n g t h i n g s
Edited by RenegadeMycologist (03/13/21 10:55 AM)
|
|