|
 Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
|
 imachavel
I loved and lost but I loved-ftw
 
Registered: 06/06/07
Posts: 31,488
Loc: You get banned for saying that 
Last seen: 16 hours, 1 minute
|
 a question about enzymes 
#7228170 - 07/26/07 09:23 PM (16 years, 8 months ago) |
|
|
does anyone know anything about enzymes assisting the production of psychedelics in plants or fungus?
peace
--------------------
 I did not say to edit my signature soulidarity! Now forever I will never remember what I said about understanding the secrets of the universe by paying attention to subtleties!
 I'm never giving you the password again. Jerk
|
imachavel
I loved and lost but I loved-ftw
Registered: 06/06/07
Posts: 31,488
Loc: You get banned for saying that
Last seen: 16 hours, 1 minute
|
Re: a question about enzymes [Re: imachavel]
#7230488 - 07/27/07 12:57 PM (16 years, 8 months ago) |
|
|
no one? the room is usually full of master chemists. how about master botanists? I was reading something that was saying, almost every organic reaction building cells to life, is based on an enzyme, in an organic structure, if a cell protein 1 is turned into cell protein 2, almost always there's a cell protein synthesase enzyme between the two, don't they usually have polypeptide structures?
peace
--------------------
I did not say to edit my signature soulidarity! Now forever I will never remember what I said about understanding the secrets of the universe by paying attention to subtleties!
I'm never giving you the password again. Jerk
|
imachavel
I loved and lost but I loved-ftw
Registered: 06/06/07
Posts: 31,488
Loc: You get banned for saying that
Last seen: 16 hours, 1 minute
|
Re: a question about enzymes [Re: imachavel]
#7231382 - 07/27/07 05:23 PM (16 years, 8 months ago) |
|
|
please point out this, go to this site:
http://en.wikipedia.org/wiki/Category:Organic_reactions
please point out the reactions(there's links too for sets of reactions), and tell me the process of reactions that form
1. lysergic acid
2. the amide
3. lysergic acid hydroxyethylamide
4. tryptophan
5. psilocybin
6. phenylalanine
7. tyrosine
8. and mescaline
any other essential things I'm missing would be nice also, phenylalanine, dmt, anything ok?
peace
--------------------
I did not say to edit my signature soulidarity! Now forever I will never remember what I said about understanding the secrets of the universe by paying attention to subtleties!
I'm never giving you the password again. Jerk
|
Dr_T
Random Dude
Registered: 06/03/07
Posts: 1,839
Loc: Colorado
Last seen: 16 years, 6 months
|
Re: a question about enzymes [Re: imachavel]
#7231418 - 07/27/07 05:37 PM (16 years, 8 months ago) |
|
|
Your question is really broad.
In a general sense, enzymes are one of the tools used by cells for biosynthesis. The cell's DNA contains the instructions to build the enzymes and other reactants that produce the chemicals the cell uses to function, starting from base materials like carbon and hydrogen.
But if you are asking "what sequence of events occurs to produce psilocybin- list all precursors, enzymes, and other contributors"... that's not a question you are going to have answered here or anywhere. You could get yourself a PhD by answering that, I think.
--------------------
Roger Rabbit said: Growing mushrooms is part art, and part science, but it's not magic.
|
 Sophistic Radiance
Free sVs!
Registered: 07/11/06
Posts: 43,135
Loc: Center of the Universe
|
Re: a question about enzymes [Re: Dr_T]
#7231432 - 07/27/07 05:44 PM (16 years, 8 months ago) |
|
|
Enzymes are very complex, quite a mystery that would be difficult to solve... especially for psychedelic plants, substances generally illegal even for research.
--------------------
Enlil said:
You really are the worst kind of person.
|
Dr_T
Random Dude
Registered: 06/03/07
Posts: 1,839
Loc: Colorado
Last seen: 16 years, 6 months
|
|
Depends on how you go about applying for the research grant, I think.
Suppose you told the feds you were looking for a chemical that would inhibit THC production, and could be safely sprayed out of airplanes and put into city water supplies. You might get approved for that one.
--------------------
Roger Rabbit said: Growing mushrooms is part art, and part science, but it's not magic.
|
imachavel
I loved and lost but I loved-ftw
Registered: 06/06/07
Posts: 31,488
Loc: You get banned for saying that
Last seen: 16 hours, 1 minute
|
Re: a question about enzymes [Re: Dr_T]
#7231608 - 07/27/07 06:52 PM (16 years, 8 months ago) |
|
|
lol, man im wondering. just for example, if you were to explain how tryptophan evolved into lysergic acid amide, which set of reactions on that site would explain that?
peace
--------------------
I did not say to edit my signature soulidarity! Now forever I will never remember what I said about understanding the secrets of the universe by paying attention to subtleties!
I'm never giving you the password again. Jerk
|
Dr_T
Random Dude
Registered: 06/03/07
Posts: 1,839
Loc: Colorado
Last seen: 16 years, 6 months
|
Re: a question about enzymes [Re: imachavel]
#7231624 - 07/27/07 06:59 PM (16 years, 8 months ago) |
|
|
That's what I'm telling you- the answer to that question isn't going to be found on Wikipedia, it's going to be found in a graduate-level organic chem book, if anywhere. Likely as a 'student exercise'.
--------------------
Roger Rabbit said: Growing mushrooms is part art, and part science, but it's not magic.
|
imachavel
I loved and lost but I loved-ftw
Registered: 06/06/07
Posts: 31,488
Loc: You get banned for saying that
Last seen: 16 hours, 1 minute
|
Re: a question about enzymes [Re: Dr_T]
#7231629 - 07/27/07 07:02 PM (16 years, 8 months ago) |
|
|
i hear what your saying, this is what I'm asking 'IF YOU KNOW.' tell me this. What set of reactions form lysergic acid amide, and can you specify the type of reaction, or the subcategory, so I can look it up on that page.
peace
--------------------
I did not say to edit my signature soulidarity! Now forever I will never remember what I said about understanding the secrets of the universe by paying attention to subtleties!
I'm never giving you the password again. Jerk
|
Dr_T
Random Dude
Registered: 06/03/07
Posts: 1,839
Loc: Colorado
Last seen: 16 years, 6 months
|
Re: a question about enzymes [Re: imachavel]
#7231761 - 07/27/07 07:48 PM (16 years, 8 months ago) |
|
|
No, I don't know.
I don't think anybody knows. Enzyme reactions are hideously complicated. The way people make chemicals is not the way cells make chemicals.
Let me ask you- what is you are trying to accomplish? Are you looking to extract tryptophan, and convert that to psilocybin? Or take a bacterium, and engineer that to make acid? Or what?
Start with something smaller. Look up the Krebs Cycle. Learn that inside and out, until you can sketch it out and describe each step. When you can do that, you'll know what the body does with ascorbic acid, vitamin C. Humans are well-studied, and vitamin C is a familiar chemical. Mushrooms aren't known as well as people, and psilocin isn't as important to the scientific world as ATP.
That's why it's such an unanswerable question, it's just too broad and deep. The people who might have an inkling of an answer aren't hanging out at The Shroomery, they are doing seriously intense research.
--------------------
Roger Rabbit said: Growing mushrooms is part art, and part science, but it's not magic.
|
imachavel
I loved and lost but I loved-ftw
Registered: 06/06/07
Posts: 31,488
Loc: You get banned for saying that
Last seen: 16 hours, 1 minute
|
Re: a question about enzymes [Re: Dr_T]
#7232011 - 07/27/07 09:11 PM (16 years, 8 months ago) |
|
|
yeah, it's weird, lol. I just keep thinking there's a few things I could feed my woodrose that would get the seeds to make pure lsd. And i feel like, if i knew what is was, it would be so simple, but no one knows. Anyway, it's crazy I guess, why do people know so much about human enzymes and chemistry, but barely about plant enzymes and chemistry. I mean, I don't know, they know about mescaline formation I think, and psilocybin formation. Anyway, peace
also, thanks.
--------------------
I did not say to edit my signature soulidarity! Now forever I will never remember what I said about understanding the secrets of the universe by paying attention to subtleties!
I'm never giving you the password again. Jerk
|
imachavel
I loved and lost but I loved-ftw
Registered: 06/06/07
Posts: 31,488
Loc: You get banned for saying that
Last seen: 16 hours, 1 minute
|
Re: a question about enzymes [Re: imachavel]
#7232101 - 07/27/07 09:34 PM (16 years, 8 months ago) |
|
|
kreb cycle, i looked it up. That's bad ass, damn that's bad ass. I mean they show every piece of that, that is some shit right there.
they don't show that cycle for any drug, huh? ANyway, do they have at least more enzyme cycles like that? with pictures? that's cool man. you could a lot from that, my mans in the back right now forming a storm of chemicals nice, and not so nice, and maybe too nice for you. No i'm playing, i wish though
peace
--------------------
I did not say to edit my signature soulidarity! Now forever I will never remember what I said about understanding the secrets of the universe by paying attention to subtleties!
I'm never giving you the password again. Jerk
|
johnm214
Registered: 05/31/07
Posts: 17,582
Loc: Americas
|
Re: a question about enzymes [Re: imachavel]
#7232352 - 07/27/07 11:09 PM (16 years, 8 months ago) |
|
|
Quote:
imachavel said:
yeah, it's weird, lol. I just keep thinking there's a few things I could feed my woodrose that would get the seeds to make pure lsd.
Very unlikely, you'd have to "create" an entirely new process. The ergots present in plants (the precusor molecules which are later changed to LSA) have groups attached the the amide that would need to be ethylated to go from LSA-> LSD or lysergic acid to LSD. Because this is exactly the spot where the enzyme is active, the LSA substrate will be tightly-bound to this very spot- therefore no substitutions on the Nitrogen would likely be possible, as the enzyme would ignore them.
Also, the groups on the amide prohibit additional bonds to that nitrogen of the sort needed to yield LSD from the final product- even if the enzyme could act on the substituted LSA.
If you wanted to make LSD, you'd pretty much have to do it via synthesis. Finding something, and making it, that would work via natural plant processes would be infinetly more difficult that simply making it yourself.
See this study for some pics of what I'm talking about
But really, everytime someone talks about LSD someone else says "you need years of schooling et cet." This is bunk. Chemical synthesis is simply following a recipe. If you get the reagents, you can make it. While the purifications can be a bitch, LSD is so active in small quantities, that simple extractions and crystalizations could be crudely done without the usual concern for yield reduction, and still make a ton of product.
In short, you don't need to know jack to make acid except simplely-learned tecniques that are both intuitive and available all over the internet.
Edited by johnm214 (07/27/07 11:11 PM)
|
johnm214
Registered: 05/31/07
Posts: 17,582
Loc: Americas
|
Re: a question about enzymes [Re: johnm214]
#7232382 - 07/27/07 11:22 PM (16 years, 8 months ago) |
|
|
Most biosynthetic pathways for major drugs of clinical import are known, but it really doesn't matter. If the plant makes it- use it.
Some discussion and pics of opiate production in poppy: http://www.pnas.org/cgi/reprint/101/38/13957.pdf
|
imachavel
I loved and lost but I loved-ftw
Registered: 06/06/07
Posts: 31,488
Loc: You get banned for saying that
Last seen: 16 hours, 1 minute
|
Re: a question about enzymes [Re: johnm214]
#7233291 - 07/28/07 10:39 AM (16 years, 8 months ago) |
|
|
that's pretty fukin cool. I just wish somewhere there was someone doing something like this, I don't know, do you think the plant would grow better? Maybe not, maybe so. WHo knows, growing the proper enzymes to make lsd would mean it'd probably have to be a shade plant, as it would probably have a very sensitive enzyme structure, also, as far as I know lsd is a very sensitive molecule, so it would have to be a well preserved plant, like, having very much thick skin. Anyway, I don't know, think of this.
what was so different about g-13? I mean, it was apparently genetically engineered, right? but what was so different about it, other than providing one of the nicest buds of pure unshitty thc right? I mean, does it provide thc in high quanitities no matter what? even if it's pollinated? I just want to know.....
somewhere in the world, someone is genetically engineering a plant or fungus to produce lsd, I just want to know where, and... where to buy the plane ticket........ heheheh, but they do have studies on genetically engineering drugs in plants, right? Anyway..
one last question... what are the properties of lsd that make it so unstable, is it eaten by bacteria? Or is it just so unstable that sunlight, and water, and movement, and heat activate the chemical reaction that causes it to break down. But then, you can store it airtight in the fridge for years, right? So maybe it's like ice, it's stable in the right conditions for eternity, but in other conditions it 'melts.' I don't know, are there chemicals in our body kept in the right conditions that last in us for years, and removed would decompose easily? DOn't know, anyway, point me to the genetic engineering lab......
peace
--------------------
I did not say to edit my signature soulidarity! Now forever I will never remember what I said about understanding the secrets of the universe by paying attention to subtleties!
I'm never giving you the password again. Jerk
|
imachavel
I loved and lost but I loved-ftw
Registered: 06/06/07
Posts: 31,488
Loc: You get banned for saying that
Last seen: 16 hours, 1 minute
|
Re: a question about enzymes [Re: imachavel]
#7233316 - 07/28/07 10:51 AM (16 years, 8 months ago) |
|
|
also, what does lsd break down into? This article:
http://www.pubmedcentral.nih.gov/picrender.fcgi?artid=1153415&blobtype=pdf
would've been bad ass with pictures. Does anyone have something with pictures? I mean, damn, you should see molecules forming, the images are awesome, because they show you where the molecules connect, where the bond that's stronger is, that breaks the molecule down so the smaller piece can connect with another molecule, being that it has a stronger bond, so it breaks off from it's other place, to form with the other molecule, as already stated. Those things are really bad ass if you know chemistry. If you don't though...
it's difficult, are there any learning pages of organic chemistry that have a lot of pictures? Things I could do with feeding plants things, to see the different reactions. Or growing things with organic chemicals you can buy at the store. Or... ANYTHING? peace
--------------------
I did not say to edit my signature soulidarity! Now forever I will never remember what I said about understanding the secrets of the universe by paying attention to subtleties!
I'm never giving you the password again. Jerk
|
Dr_T
Random Dude
Registered: 06/03/07
Posts: 1,839
Loc: Colorado
Last seen: 16 years, 6 months
|
Re: a question about enzymes [Re: imachavel]
#7234868 - 07/28/07 08:16 PM (16 years, 8 months ago) |
|
|
Quote:
imachavel said:
one last question... what are the properties of lsd that make it so unstable,
Lots and lots of chemicals are unstable when exposed to air, light, heat, extreme cold, humidity, shock, etc, etc.
A few examples:
hydrogen peroxide
nitrogen tri-iodide
TNT and a bunch of other explosives (but some are very stable)
silver nitrate
I'll think of more here in a bit...
--------------------
Roger Rabbit said: Growing mushrooms is part art, and part science, but it's not magic.
|
imachavel
I loved and lost but I loved-ftw
Registered: 06/06/07
Posts: 31,488
Loc: You get banned for saying that
Last seen: 16 hours, 1 minute
|
Re: a question about enzymes [Re: Dr_T]
#7242310 - 07/31/07 02:43 AM (16 years, 8 months ago) |
|
|
i just wanted to ask, are there chemicals that are unstable when exposed, but are preserved inside a plant? I don't know, I know there's heat, water, light, exposure to a plants total chemistry but, you know, maybe the plant has a place for it, that's kept intact by an enzyme system or something, I was looking at the krebbs cycle, it almost appears that the plant keeps recycling the citric acid, although I'm not sure. I don't know, aren't there extremely sensitive molecules in a human preserved somehow? Or am I wrong? Peace
--------------------
I did not say to edit my signature soulidarity! Now forever I will never remember what I said about understanding the secrets of the universe by paying attention to subtleties!
I'm never giving you the password again. Jerk
|
Dr_T
Random Dude
Registered: 06/03/07
Posts: 1,839
Loc: Colorado
Last seen: 16 years, 6 months
|
Re: a question about enzymes [Re: imachavel]
#7242501 - 07/31/07 05:23 AM (16 years, 8 months ago) |
|
|
Yes, the citric acid gets recycled.
Being inside a plant is probably a more stable environment for certain chems- the pH is right, no light, no free oxygen, etc. Sure, there are chemicals that are ok inside a plant that degrade outside.
True of animals, too. Insulin is a great example.
--------------------
Roger Rabbit said: Growing mushrooms is part art, and part science, but it's not magic.
|
imachavel
I loved and lost but I loved-ftw
Registered: 06/06/07
Posts: 31,488
Loc: You get banned for saying that
Last seen: 16 hours, 1 minute
|
Re: a question about enzymes [Re: Dr_T]
#7336228 - 08/26/07 12:49 PM (16 years, 7 months ago) |
|
|
well, let me ask you something. Does anyone know how plants 'recieve' things? they have receptors, correct? they aren't like nuerotransmitting receptors, but they do 'recieve' things, and change their growth, or molecular composition based on that, correct? do you think you could alter certain plants chemical composition, by feeding them things, they would grow new 'receptors' for, and if they grew new receptors, they would probably produce new and different things, based on how they 'recieved' and produced things?
if they don't have receptors, how do they know they are recieving a certain nutrient, and to turn into a molecular compound. I'm not saying they don't, i'm just asking how they do if that's not how it works.
peace
--------------------
I did not say to edit my signature soulidarity! Now forever I will never remember what I said about understanding the secrets of the universe by paying attention to subtleties!
I'm never giving you the password again. Jerk
|
imachavel
I loved and lost but I loved-ftw
Registered: 06/06/07
Posts: 31,488
Loc: You get banned for saying that
Last seen: 16 hours, 1 minute
|
Re: a question about enzymes [Re: Dr_T]
#7336240 - 08/26/07 12:53 PM (16 years, 7 months ago) |
|
|
well, let me ask you something. Does anyone know how plants 'recieve' things? they have receptors, correct? they aren't like nuerotransmitting receptors, but they do 'recieve' things, and change their growth, or molecular composition based on that, correct? do you think you could alter certain plants chemical composition, by feeding them things, they would grow new 'receptors' for, and if they grew new receptors, they would probably produce new and different things, based on how they 'recieved' and produced things?
if they don't have receptors, how do they know they are recieving a certain nutrient, and to turn into a molecular compound. I'm not saying they don't, i'm just asking how they do if that's not how it works.
peace
--------------------
I did not say to edit my signature soulidarity! Now forever I will never remember what I said about understanding the secrets of the universe by paying attention to subtleties!
I'm never giving you the password again. Jerk
|
Koala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG
Registered: 01/07/04
Posts: 7,752
|
Re: a question about enzymes [Re: imachavel]
#7336432 - 08/26/07 01:56 PM (16 years, 7 months ago) |
|
|
You should do a lot of reading on the basics of biology, these ideas are pretty simple, and you'd probably enjoy learning about them from a better source of information than myself.
You're comparing neurotransmitters to enzymatic reactions, it seems like. All cells have receptors on them. It's how they communicate. A small amount of hormone can send a very large signal all throughout an organism, and cells with complimentary receptors may respond to those signals. Neurotransmitters carry messages as well, but they're small range. Neurotransmitters released into a synaptic cleft will only provide a message to the dendrites of a neighboring neuron microns away. This will change the membrane potential of the recieving neuron, and ions will flow in or out of it, exciting or inhibiting it depending on the charge of these ions. If they're excited to a certain degree, the neuron will "fire", basically, releasing neurotransmitters at its terminal end, repeating the process.
But if you're just talking about nutrients, not chemical signals, plants will absorb almost anything in the water they absorb. Though I believe things like pH can play a big role in that...
Nutrients absorbed will flow through the vascular tissue of plants, certain things can end up in certain places based on specific gradients.
Neurotransmitter receptors and enzymes are different in that the neurotransmitter is released to either bind again or be taken back up by original neuron terminal or a glial cell (I believe). However, these cell receptors and enzymes are both proteins, composed of amino acids and produced in the same manner. If a molecule is going to interact with an enzyme, it's because the shape of the enzyme is such that it can lock on to the molecule. A molecule that doesn't fit will not react. Enzyme shapes are dependent on the order of amino acids that make them up. Proteins will fold based on the interactions between the side chains on these amino acids. Some will be attracted to each other, some will form di-sulfide bonds, etc, until you end up with a very complex, specialized structure. Google some molecular protein renderings and you'll see just how specialized they are.
For instance http://en.wikipedia.org/wiki/Image:Alkaline_phosphatase.png this is the sucker, I believe, that is responsible for dephosphorylating psilocybin into psilocin. It is not a simple molecule.
They work by lowering the activation energy needed for a chemical reaction to occur. They're not going to allow a thermodynamically unfavorable reaction to happen, but they may make a reaction occur the needed 100 times a second work, rather than 100 times a year as it might work out uncatalyzed.
Enzymes don't know anything. They're produced because they work, and because the organisms that had them had an advantage over those which did not. Mutations occur, and if the resulting protein increases the fitness of the individual, it will have a better chance of having kids, which will share the genetic sequence allowing them to produce this protein. If the enzyme simply changed, or the cell "grew new receptors" based on their environment, that'd be nifty, but the trend wouldn't continue in their offspring as there'd be no genetic basis for the change.
--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!
|
Acaterpillar
A little mad...
Registered: 06/09/07
Posts: 18,693
Loc: Down the rabbit hole
Last seen: 6 months, 11 days
|
Re: a question about enzymes [Re: Koala Koolio]
#7336456 - 08/26/07 02:05 PM (16 years, 7 months ago) |
|
|
This thread actually makes for a good read. 
--------------------
Aaa...E I O Uuu...A E I O Uuu..A E I O uh Uuu..
*Cough* *Cough*
Ooo...U E I O Aaa...U E I Aaa..A E I O Uuuuu...
At first sight, The Perfection of Wisdom is bewildering, full of paradox and apparent irrationality.
|
imachavel
I loved and lost but I loved-ftw
Registered: 06/06/07
Posts: 31,488
Loc: You get banned for saying that
Last seen: 16 hours, 1 minute
|
Re: a question about enzymes [Re: Koala Koolio]
#7337596 - 08/26/07 07:19 PM (16 years, 7 months ago) |
|
|
so i'm guessing then, the dna is one long chain code, damn, then all plants and animals are just one huge chemical chain reaction, the way the plant grows must be a chemical reaction just based on how molecules interact with the dna strand, or the dna is just a "code," like the plant uses it as a skeleton for the way everything else interacts, the best way to change the plants dna then, would be to test it in different growing situations, harsh or not.
i see why plants and animals took so long to form themselves then, i guess nature was building the skeleton, and it just took a long god damn ass time.
what's the next organic molecule up from the basic minerals it absorbs? a protein, right? no, an amino acid. Or is there something simpler than that? has anyone ever grown a plant out of a mostly carbon compound mixture? or is that what soil is? a carbon compound mixture?
Anyway, a plant uses amino acids to start to form what it needs, but an amino acid does a number of jobs, it stimulates about a hundred things if you feed the amino acid directly to the plant, because in synthesis the plant uses a small amount of amino acids in every reaction, but to a very detailed controlled extent, correct? you feed it an amino acid and it's reacting to a series of events all at once, hmmmmmmm.... interesting. tryptophan is the direct amino acid that is turned into lysergic acid amides. so this is tricky, huh? it's hard to manipulate this skeleton, when so many pieces are already so basic. but there's a plus side, psychoactive plants produce hundreds of "pieces," others more largely, the rest in trace amounts. All organic molecules must be extremely similarly related, extremely foreign species such as 'poisons,' and even psychoactives must be somewhat rare in the organic molecular world, but then again, in the foundation, life is all so interelated, but in the contructive overly formed world, life is all so differentiating, although these molecules are small, and therefore play a very 'basic' part in the constructive sequence of plants and organisms. So i'm guessing, that mostly, the small piece is directly related to the larger building, to variating extents, i like to think most of nature is extremely similar to how a building is built. depending on the building, being concrete, wood, or steel, most of the components are the same, the frame measurement would be the key to how long each piece is, the size of the nail, type of nail, how many nails, structure of the inner room, then another interesting factor. The larger structure subtly plays a big part in building construction, the smaller pieces only aid the inner sequence structure of the room, the floor, to calculate and map the bigger sequence of repeated patterns that each floor creates to make the total structure of the building.
i wonder if, the smaller components are only so basic, that every plant and animal has, compared to how and how often they are used in the sequence of building the room, and the sequence of interconnecting walls(very subtley observed i'm guessing) to create the pattern the sequence of interconnected rooms makes to build the floor, and the floors make the build the building. AND YET, for different structures, the different screw sizes and placements and measurements play a key role.
So it makes sense most biorganisms contain the same molecular genetic makeup, people must be the extremely complex building centers, while plants are more like houses without electricity but a cheap outdoor bathroom and stove heating, or some crap. and the basis of the foundamental structure is very similar exept some 'differentiating' houses contain different screws and boards and measurements of the placements of sequences, some houses might even have a different metal in it's 'nail', or complex boards or exotic wood floors though most building big and small have the same basic design structure. Of course big buildings with complex electric systems like elevators and computers with working plumbing would contain some unique pieces, mostly the same elements put together, some slightly different 'compounds,' but componentially very complexually different.
I don't know, seems feasable?
peace
--------------------
I did not say to edit my signature soulidarity! Now forever I will never remember what I said about understanding the secrets of the universe by paying attention to subtleties!
I'm never giving you the password again. Jerk
|
|
Threaded
Previous
Index
Next
Edit 
Reply 
RebelSteve33
Jackolantern
Anonymous
optikal_trip
Murex