|
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
|
juggalacious12
Inconspicuouswhite chick
Registered: 02/11/07
Posts: 280
Loc: Oregon
Last seen: 13 years, 4 months
|
Has anyone here taken shrooms for over half a year?
#7054034 - 06/16/07 08:24 PM (16 years, 9 months ago) |
|
|
I am wondering what the transition from serotonin reality to psilocybin reality is.
Since these chemicals are so similar in structure I believe that as you take shrooms your serotonin is replaced somewhat with psilocybin as the neurotransmitter.
I am wondering what it is like to replace serotonin, a natural and the general neurotransmitter or humans, with psilocybin, an alien neurotransmitter structurally similar to sertonin.
I know that tollerance developes quickly, but that is irrelevant. I believe that if humans ran off of psilocybin and they took serotonin than they would trip the same way. This is because one is accustomed to one general neurotransmitter to perform lifely functions, and when one is changed the new way of thinking forces your mind into new variations of reality that are, though different, actually the same, just through a different neurotransmitting lens, hence the introspection and alternate realities.
Is the new reality normal, just as a serotonin one is?
What are the variations in the realities, if any?
Is the transition particularly hard?
I am trying to reverse engineer the human brain, and subsequently all consciousness', and I kind of need to know different is to know what "normal" is. I have already learned to speak most animals, plants, insects, objects, people, and conscienceness as well as a few intangible ideas that I have only recently begun to realize that I understand and can also convey. I really believe that I have the ability to do this and any bit of your help will be greatly appreciated!
|
Sophistic Radiance
Free sVs!
Registered: 07/11/06
Posts: 43,135
Loc: Center of the Universe
|
Re: Has anyone here taken shrooms for over half a year? [Re: juggalacious12]
#7054050 - 06/16/07 08:29 PM (16 years, 9 months ago) |
|
|
I've never heard of somebody dosing on mushrooms for an entire half-year straight. It would be fucking hardcore.
I imagine it would be very difficult to maintain such a steady supply of psilocin for the brain. I know that LSD interacts with your brain for all of 2-3 hours after you ingest it, then it's gone. Considering how closely related psilocin is to LSD I'm guessing it does roughly the same thing. The brain trips on its own. I'm not sure that the constant presence of psychedelics alone is sufficient to have a consistent "altered perception" of reality, especially considering rapid tolerance build-up, and even eating mushrooms for every meal every day would never actually replace your natural serotonergic system.
-------------------- Enlil said: You really are the worst kind of person.
Edited by Tchan909 (06/16/07 08:31 PM)
|
juggalacious12
Inconspicuouswhite chick
Registered: 02/11/07
Posts: 280
Loc: Oregon
Last seen: 13 years, 4 months
|
Re: Has anyone here taken shrooms for over half a year? [Re: Sophistic Radiance]
#7054078 - 06/16/07 08:36 PM (16 years, 9 months ago) |
|
|
I know that you couldn't ever replace the serotonin system, it's natural and everflowing, but with psilocybin you could have enough to create an alternate system in which you could soley function, like the way vets like small doses v. youngins that like big ones.
I think that tollerance is a normal reaction to the new "reality". It's not a new reality, but a new neurotransmitter and thus a new way to seeing things. These new things I believe are the trip. You get sucked into exponential rifts of thought that pass by and sweep you away, but with enough mental power and control you may be the master, to create general reality anew. With this ability one might break the conventionalism of general preception and make any realty that they choose.
I have always been a firm believer that you can see whatever, you just need the skill and now I believe that I have found a way to build that skill.
To comprehend, I must first know what it is to not. With that I can make any variation to create any variation of any reality that I wish.
-------------------- It's kinda like the "rooms" made from drawing a star, where you are in the middle and have access to all of the other rooms simultaniously. Ya know? Also, I guess that I feel it apropriate to note that all statements of mine are either hypathetical, invalid, or otherwise legal. The resistance to side changes, fixation in one place without the ability to change it, precievably. YOu will never see a psychedelic experience greater than yourself (keep in mind that this is still relative, and that your best, however sad it may be, is still THE best!) I don't just want to see these fascets of my mind, I want(have) to experience them.
|
Sophistic Radiance
Free sVs!
Registered: 07/11/06
Posts: 43,135
Loc: Center of the Universe
|
Re: Has anyone here taken shrooms for over half a year? [Re: juggalacious12]
#7054085 - 06/16/07 08:40 PM (16 years, 9 months ago) |
|
|
Psilocybin isn't a neurotransmitter (at least not for humans), though. It's a foreign alkaloid that the brain will dispose of as soon as it can. I believe tolerance build-up occurs not because the brain is "accustomed" to the new chemicals but simply because it has gotten better at disposing of the foreign chemicals before they can reach full effect.
Unless I'm sorely mistaken, that's pretty much how tolerance works across the board, for all drugs. Somebody feel free to correct me if I'm wrong.
-------------------- Enlil said: You really are the worst kind of person.
Edited by Tchan909 (06/16/07 08:41 PM)
|
xFrockx
Registered: 09/17/06
Posts: 10,457
Loc: Northeast
Last seen: 2 days, 17 hours
|
Re: Has anyone here taken shrooms for over half a year? [Re: juggalacious12]
#7054086 - 06/16/07 08:41 PM (16 years, 9 months ago) |
|
|
Your pretty far off here, tolerance has nothing to do with subjective observations of reality. its chemical.
|
Koala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG
Registered: 01/07/04
Posts: 7,752
|
Re: Has anyone here taken shrooms for over half a year? [Re: xFrockx]
#7054266 - 06/16/07 09:31 PM (16 years, 9 months ago) |
|
|
There are different reasons that you might seek a higher and higher dose to be "wowed". It is true that you might become used to the state, even more comfortable in it, and thus find yourself less impressed with what you're seeing, desiring a higher dose. This doesn't compare though to the required increase in dosage needed to achieve the same effects 2 days in a row, and so on. As previously said, the answer is a chemical one.
-------------------- You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!
|
Stephen
Friend
Registered: 01/25/07
Posts: 156
Loc: North Carolina
Last seen: 15 years, 28 days
|
Re: Has anyone here taken shrooms for over half a year? [Re: Koala Koolio]
#7054294 - 06/16/07 09:38 PM (16 years, 9 months ago) |
|
|
Well, all I know is that serotonin could not be replaced by psilocybin, and if it did, i dont think your brain would be in any shape to function in reality. Serotonin is a neurotransmitter that couldnt really be replaced with anything as I remember.
-------------------- "To use your head, you have to get out of your mind." -Timothy Leary
|
juggalacious12
Inconspicuouswhite chick
Registered: 02/11/07
Posts: 280
Loc: Oregon
Last seen: 13 years, 4 months
|
Re: Has anyone here taken shrooms for over half a year? [Re: Stephen]
#7054441 - 06/16/07 10:15 PM (16 years, 9 months ago) |
|
|
I don't really expect anything to happen, only for a new way of thinking to be opened, and by that I mean that nothing happens. If psilocybin is related to serotonin than it should act enough like it to replace it, I would think.
When I eat mushrooms I get this feeling that besides what is happening there is this thing that I should be noting, but can't because I don't know what it is. I no longer really trip anymore, I get psychedelic. I do not believe that psychedelic is an induced state, but rather a way of looking at things or a frame of mind that can be achieved sober or otherwise.
Even if it is a chemical and your tollerance is total, the substance is still there and I believe that with even just one molecule and enough mental knowhow one could theoretically place themselves in soley the psilocybin realm with just that one molecule, so long as there was always at least one in each center of the brain used for the function and preception of that person in that reality..
-------------------- It's kinda like the "rooms" made from drawing a star, where you are in the middle and have access to all of the other rooms simultaniously. Ya know? Also, I guess that I feel it apropriate to note that all statements of mine are either hypathetical, invalid, or otherwise legal. The resistance to side changes, fixation in one place without the ability to change it, precievably. YOu will never see a psychedelic experience greater than yourself (keep in mind that this is still relative, and that your best, however sad it may be, is still THE best!) I don't just want to see these fascets of my mind, I want(have) to experience them.
|
juggalacious12
Inconspicuouswhite chick
Registered: 02/11/07
Posts: 280
Loc: Oregon
Last seen: 13 years, 4 months
|
Re: Has anyone here taken shrooms for over half a year? [Re: juggalacious12]
#7054460 - 06/16/07 10:19 PM (16 years, 9 months ago) |
|
|
Real quick, let me explain this philosophy. One plus one equals two, but it can also equal three, because you can also include the two grouped as another combination, and to a further extent the two can be reversed to equal four, because you can group them to make a new figure that is in reality just a variation on the origional, but isn't that what makes life? DNA doesn't descriminate, and all life is just the slightest variation of the origional that we think is so different though it's not.
-------------------- It's kinda like the "rooms" made from drawing a star, where you are in the middle and have access to all of the other rooms simultaniously. Ya know? Also, I guess that I feel it apropriate to note that all statements of mine are either hypathetical, invalid, or otherwise legal. The resistance to side changes, fixation in one place without the ability to change it, precievably. YOu will never see a psychedelic experience greater than yourself (keep in mind that this is still relative, and that your best, however sad it may be, is still THE best!) I don't just want to see these fascets of my mind, I want(have) to experience them.
|
juggalacious12
Inconspicuouswhite chick
Registered: 02/11/07
Posts: 280
Loc: Oregon
Last seen: 13 years, 4 months
|
Re: Has anyone here taken shrooms for over half a year? [Re: juggalacious12]
#7054488 - 06/16/07 10:25 PM (16 years, 9 months ago) |
|
|
When I am psychedelic, I can't positively say that anything happens, all that I can say for sure is that I feel different, just that.
Yesterday I ate about two grams, not much but I'm in tune with that part of me, and almost nothing happened besides the shiteating grins what you get when people are looking at you, even though my thoughts were completely collected when I was alone. I could even speak, I got a ride from a friends parents and did pretty ok. My mom got home and all I did was have a huge, gregarious grin. There was no mental fuck, no colors, not that I've ever had them, no body high, nothing. It was the cleanest, purest, most personal high I've ever had. It was even more interpritable than the one where I learned how to speak to squirrels, and then everything.
-------------------- It's kinda like the "rooms" made from drawing a star, where you are in the middle and have access to all of the other rooms simultaniously. Ya know? Also, I guess that I feel it apropriate to note that all statements of mine are either hypathetical, invalid, or otherwise legal. The resistance to side changes, fixation in one place without the ability to change it, precievably. YOu will never see a psychedelic experience greater than yourself (keep in mind that this is still relative, and that your best, however sad it may be, is still THE best!) I don't just want to see these fascets of my mind, I want(have) to experience them.
|
juggalacious12
Inconspicuouswhite chick
Registered: 02/11/07
Posts: 280
Loc: Oregon
Last seen: 13 years, 4 months
|
Re: Has anyone here taken shrooms for over half a year? [Re: juggalacious12]
#7054823 - 06/17/07 12:06 AM (16 years, 9 months ago) |
|
|
Does anyone even remotely understand the statement that I am trying to make here?
-------------------- It's kinda like the "rooms" made from drawing a star, where you are in the middle and have access to all of the other rooms simultaniously. Ya know? Also, I guess that I feel it apropriate to note that all statements of mine are either hypathetical, invalid, or otherwise legal. The resistance to side changes, fixation in one place without the ability to change it, precievably. YOu will never see a psychedelic experience greater than yourself (keep in mind that this is still relative, and that your best, however sad it may be, is still THE best!) I don't just want to see these fascets of my mind, I want(have) to experience them.
|
incubaby_421
half naked andfull witted
Registered: 08/14/04
Posts: 2,629
Loc: the center of the univers...
Last seen: 5 years, 8 months
|
Re: Has anyone here taken shrooms for over half a year? [Re: juggalacious12]
#7054897 - 06/17/07 12:21 AM (16 years, 9 months ago) |
|
|
three months str8 everyday is my best... i wouldnt exactly recomend it... then again i wouldnt take it back either... but as for replacing seratonin with psilocin (what you meant becuase psilocybin is not actually an active chemical)... thats in the eye of the beholder, its good, it will open your mind in ways you couldnt even cognate... the negative side is that you fall out of society and pretty much will be the wierdo with a beardo for the rest of your life... but judge "negative" as you will... i see it as a good thing... it will fuck up your job, school, etc... but as far as i can see the truth is priceless in any matter
-------------------- "yet the more i dig, the more i consume, the more i unfold... the less protected i feel. i am the spit on the hair of the son of an electron, swimming around the nucleus of a cell inside the sperm of a killer bee, and my purpose is as nebulous as why weve been bestowed with the capacity to give a shit" Brandon Boyd
|
juggalacious12
Inconspicuouswhite chick
Registered: 02/11/07
Posts: 280
Loc: Oregon
Last seen: 13 years, 4 months
|
Re: Has anyone here taken shrooms for over half a year? [Re: incubaby_421]
#7055013 - 06/17/07 12:43 AM (16 years, 9 months ago) |
|
|
Maybe it's just me, but I feel differently. I feel that I have the capacity to accomodate the transition between conventional reality and shroom reality quite well.
I do understand what you mean about the losing touch part though. I was going through a rough patch in my life and did dxm, diphenhydramine and dimenhydrinate for about a year. Near the end, before I got caught shoplifting and had to quit I was about to go to 900mg dxm. You really begin to believe that people really are that stupid, just because they don't say anything. Just so you know, I didn't trip like normal people, which explains why I would eat about 50+ dramamine a week, I didn't get all alienie or paranoid, I just got really comfortable being a not so good person and eventually it came back to bite me on the ass.
When I eat mushrooms I do feel some high, but at the same time there is something normal and almost homey about the experience. Don't get me wrong, I don't like large doses, at such a point I beging to resist and complications start, but I know that time come I will be able to accomodate any amount that I see fit, be it .25gm or 25gm. The way that it feels is so, almost normal. Pretty soon I expect to never conventionally trip, not that I do now too well anyway. I still don't know why I never see colors... On 4-20, i ate an eighth, the clouds were red, but it was more like a vinear covering them and I could easily tell that I could have seen through it if I had wished.
I just can't explain how not spectacular the mushroom experience is for me, even if I do get overwhelmed. Some day I will make it my new home, having not even taken it in some 10 years!
-------------------- It's kinda like the "rooms" made from drawing a star, where you are in the middle and have access to all of the other rooms simultaniously. Ya know? Also, I guess that I feel it apropriate to note that all statements of mine are either hypathetical, invalid, or otherwise legal. The resistance to side changes, fixation in one place without the ability to change it, precievably. YOu will never see a psychedelic experience greater than yourself (keep in mind that this is still relative, and that your best, however sad it may be, is still THE best!) I don't just want to see these fascets of my mind, I want(have) to experience them.
|
juggalacious12
Inconspicuouswhite chick
Registered: 02/11/07
Posts: 280
Loc: Oregon
Last seen: 13 years, 4 months
|
Re: Has anyone here taken shrooms for over half a year? [Re: juggalacious12]
#7055023 - 06/17/07 12:46 AM (16 years, 9 months ago) |
|
|
Even though I know now that I was a "horrible" ass when I was going through my thang, I wouldn't not do it either. I learned so much about myself that if I did I may not know who I am now, or may have killed myself. Depression was my drive, more a lack of anyone to share my troubles with..
-------------------- It's kinda like the "rooms" made from drawing a star, where you are in the middle and have access to all of the other rooms simultaniously. Ya know? Also, I guess that I feel it apropriate to note that all statements of mine are either hypathetical, invalid, or otherwise legal. The resistance to side changes, fixation in one place without the ability to change it, precievably. YOu will never see a psychedelic experience greater than yourself (keep in mind that this is still relative, and that your best, however sad it may be, is still THE best!) I don't just want to see these fascets of my mind, I want(have) to experience them.
|
Shroomnibbler
Stranger
Registered: 04/24/07
Posts: 160
Last seen: 14 years, 4 months
|
Re: Has anyone here taken shrooms for over half a year? [Re: incubaby_421]
#7056092 - 06/17/07 08:50 AM (16 years, 9 months ago) |
|
|
Quote:
incubaby_421 said: three months str8 everyday is my best... i wouldnt exactly recomend it... then again i wouldnt take it back either...
Excuse me, but are you utterly and completely bumfuck crazy?
|
juggalacious12
Inconspicuouswhite chick
Registered: 02/11/07
Posts: 280
Loc: Oregon
Last seen: 13 years, 4 months
|
Re: Has anyone here taken shrooms for over half a year? [Re: Shroomnibbler]
#7057291 - 06/17/07 02:54 PM (16 years, 9 months ago) |
|
|
How big was your dose by the time you were near the end?
I am kind of speaking of some type of tonic, I think it would be. Since tollerance is so quick and complete, I would prolly just stay with the dose I was at after a month or so to keep me whole.
Did you still trip? Or was it more like smoking pot after a couple years? Do you think that shrooms might be able to be accepted the same way by someone whose mind accomodates such conditions?
-------------------- It's kinda like the "rooms" made from drawing a star, where you are in the middle and have access to all of the other rooms simultaniously. Ya know? Also, I guess that I feel it apropriate to note that all statements of mine are either hypathetical, invalid, or otherwise legal. The resistance to side changes, fixation in one place without the ability to change it, precievably. YOu will never see a psychedelic experience greater than yourself (keep in mind that this is still relative, and that your best, however sad it may be, is still THE best!) I don't just want to see these fascets of my mind, I want(have) to experience them.
|
Psilopsychedelic
Voodoo Child
Registered: 06/22/06
Posts: 79
Loc: A point in space in time
Last seen: 8 years, 3 months
|
Re: Has anyone here taken shrooms for over half a year? [Re: incubaby_421]
#7057729 - 06/17/07 04:31 PM (16 years, 9 months ago) |
|
|
Three months straight wow man that's amazing. I would think my thought process would just get so warped.
-------------------- It's a strange world. Some people get rich and others eat shit and die. - Hunter S. Thompson
|
Sophistic Radiance
Free sVs!
Registered: 07/11/06
Posts: 43,135
Loc: Center of the Universe
|
Re: Has anyone here taken shrooms for over half a year? [Re: Psilopsychedelic]
#7057785 - 06/17/07 04:41 PM (16 years, 9 months ago) |
|
|
Jugg... no offense, but the idea is ridiculous. Eating mushrooms every day won't make some kind of mystical alteration to your brain and bring you to another reality. You'll just get exhausted, which will only serve to compound your delusional state from taking so goddamn much shrooms and the sleep deprivation you'll likely come up against. It's not a matter of "making the transition," but a matter of seriously abusing both your brain and the mushrooms themselves. You'll be hurting both yourself and us by doing something so freaking stupid that it will probably end up reinforcing the idea that mushrooms are dangerous and should be kept prohibited. The best case scenario is that your brain will get to destroying that psilocin so fast you can't trip anymore, constituting a huge waste of money on your part. And that's the best case, any other case could result in major psychological damage and worse.
At least, that's my two cents.
-------------------- Enlil said: You really are the worst kind of person.
Edited by Tchan909 (06/17/07 04:45 PM)
|
Blend
afferent orchestra
Registered: 08/16/06
Posts: 2,957
|
Re: Has anyone here taken shrooms for over half a year? [Re: Sophistic Radiance]
#7057853 - 06/17/07 04:56 PM (16 years, 9 months ago) |
|
|
yeah... kinda what I was thinking.. guess it goes without saying, or should
|
juggalacious12
Inconspicuouswhite chick
Registered: 02/11/07
Posts: 280
Loc: Oregon
Last seen: 13 years, 4 months
|
Re: Has anyone here taken shrooms for over half a year? [Re: Sophistic Radiance]
#7057855 - 06/17/07 04:56 PM (16 years, 9 months ago) |
|
|
I don't think you understand what I mean by "new" reality. By that I mean that nothing will happen, but because you are using a foreign neurotransmitter it is still new and you are perceiving reality as such. After tollerance has built, I don't expect one to keep increasing their dose to continue tripping for such a period, I really do believe that a person can function on mushrooms the way some do on cannabis you need only to see the three plus realities created by altering just one. Make sense?
As for the mystical reality part, where did that come from? I guess that I'm talking about the dissassembley of conventionalism (psychedelic experience), assessment of its components and characteristics, and reassembly of conventionalism while still in the place where it was dismantled and still "unfixable". The new reality is just what happens when you can function normally on shrooms. Let me explain them.. Normal is what we are born with in this case via serotonin, Altered is when a foreign substance is taken into us that alters our preception, and New Reality is when normality can be attained while altered. Does that make more sense? I can keep trying to explain this all day folks... At least till I think you get what I'm saying, whether you agree or not.
I have not eaten shrooms for even two days in a row, I may be misunderstanding you and not the other way around, but from what I have surmised, one that doesn't warp (as I do not) may be able to accomplish essentially "replacing" serotonin with psilocyn. I know that replacement can't be total, but the extra path is all that I care about.
-------------------- It's kinda like the "rooms" made from drawing a star, where you are in the middle and have access to all of the other rooms simultaniously. Ya know? Also, I guess that I feel it apropriate to note that all statements of mine are either hypathetical, invalid, or otherwise legal. The resistance to side changes, fixation in one place without the ability to change it, precievably. YOu will never see a psychedelic experience greater than yourself (keep in mind that this is still relative, and that your best, however sad it may be, is still THE best!) I don't just want to see these fascets of my mind, I want(have) to experience them.
|
|