|
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
|
Koala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
|
Re: seed potency loss [Re: Nalim]
#6682646 - 03/18/07 05:38 AM (16 years, 11 months ago) |
|
|
Pub? Intentional?
-------------------- You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!
|
Nalim
OTD Kelly Girl



Registered: 01/13/06
Posts: 15,033
Last seen: 1 year, 4 months
|
|
no it was a misspelling, but it was a funny such.
--------------------
    Rodney Brooks on Robots Nalim said: "Quoting yourself is retarded."
|
Taharka
The Root of the Problem


Registered: 09/29/05
Posts: 686
|
|
Quote:
Dexter_Morgan said: The room for 'genetic contamination' is within the females body FOREVER. It is an established fact, that some part of an offspring, will stay with the mother.
Im done repeating myself. Its not as simple as male sperm meets female egg; meiosis; 1/2 from father 1/2 from mother. Unless the mother has never sired litter, she will carry some genes/proteins/whatever, of her former litter. This is not a problem as long as she never mates outside her breed.
Leftover proteins that affect the immune system and such have nothing to do with the genetic makeup of the puppies. Female mammals retain no portion of the genetic material from their offspring or their mates - if you wish to say otherwise, I'm sure you can actually cite your sources instead of just telling us this is established fact. With the understanding of the reproductive process that we have today, I'm sure such an important mechanism that adds pieces of the mate or offspring's DNA into the mother's would have been described before. This is *all* about meiosis and DNA. From a genetic standpoint, children get nothing from their parents that isn't in the parents' DNA.
And we would see it in other mammals, surely, such as humans. A white woman who has a child by a black man will not produce anything other than a white child with a white man. And even if he is gay, with all your talk earlier, he is still racially, genetically white.
*This* is established fact. You complain about bad things in the garden, when you're the one sowing them.
I apologize for the off-topic posting, but the original question has been thoroughly answered. For Great Justice we must continue.
|
Dexter_Morgan
Towlie's Mentor




Registered: 02/09/05
Posts: 6,666
Loc: higher than you
|
Re: seed potency loss [Re: Taharka]
#6683941 - 03/18/07 02:43 PM (16 years, 11 months ago) |
|
|
Tell it to the dog kennel clubs.
Im done reading your remarks, offspring are exposed to different proteins/markers, depending on previous occupants of the uterus. Its not fully understood, but that is a fact. I guarantee no recognized dog kennel club will accept puppies from a bitch who has sired mutts. You can argue for your 'half from father, half from mother' 8th grade bs, as much as you want. It's not as black and white as 8th grade.
You can call them pure breeds, but no one, who knows anything about dog breeding, will accept your conclusions.
You started this off-topic tangent with your comment. Figure out why kennel clubs will not allow what you claim, and THEN come back to this thread and explain it all.
-------------------- Uncleluke, getting his assbeat, then he tries to delete it http://www.shroomery.org/forums/showflat.php/Number/6355469#Post6355469 Tomato-Faced Banez http://www.shroomery.org/forums/showflat.php/Number/5933438#Post5933438 Dexter's Thesaurus beer = guinness smoke = vaporize pubers = reasons to be pro-choice
|
Dexter_Morgan
Towlie's Mentor




Registered: 02/09/05
Posts: 6,666
Loc: higher than you
|
Re: seed potency loss [Re: Nalim]
#6683960 - 03/18/07 02:48 PM (16 years, 11 months ago) |
|
|
Quote:
It is hypothesized that the fraternal birth order effect may be caused by increasing levels of antibodies produced by the mother to the HY antigen with each son. The HY antigen (histocompatibility Y-antigen) is found on the surface of the cells of male mammals. The presence of this foreign chemical when bearing a son could trigger the mother's immune response, which may then lead to different brain development patterns in later male children.
And there is the hypothesis. baby is effected by a lot more than just papa's sperm and mama's egg.
-------------------- Uncleluke, getting his assbeat, then he tries to delete it http://www.shroomery.org/forums/showflat.php/Number/6355469#Post6355469 Tomato-Faced Banez http://www.shroomery.org/forums/showflat.php/Number/5933438#Post5933438 Dexter's Thesaurus beer = guinness smoke = vaporize pubers = reasons to be pro-choice
|
Phish_Dude
steppin' into yesterday




Registered: 10/16/06
Posts: 5,745
Loc: secret tweeker pad
|
|
maybe we should start a new thread for dog breeding and mitosis?
--------------------
|
Dexter_Morgan
Towlie's Mentor




Registered: 02/09/05
Posts: 6,666
Loc: higher than you
|
Re: seed potency loss [Re: Phish_Dude]
#6685031 - 03/18/07 08:15 PM (16 years, 11 months ago) |
|
|
seeds will not lose potency with age, and O2 will not effect a seeds future ability to produce THC (or any other cannabinoid).
I never brought up the dog breeding, but at least two people are calling shinagins, yet no one will accept the fact that this is the reason they would not be allowed into a kennel club. At first i was just trying to point out that his neighobor was correct, and what he had stated was incorect. Whatever Im done, anyone who understands, or care to know about dog breeding, will see that i am correct, and anyone who doesnt understand this part of my last quote, will be able to look it up.
Quote:
It is hypothesized that the fraternal birth order effect may be caused by increasing levels of antibodies produced by the mother to the HY antigen with each son. The HY antigen (histocompatibility Y-antigen) is found on the surface of the cells of male mammals. The presence of this foreign chemical when bearing a son could trigger the mother's immune response, which may then lead to different brain development patterns in later male children.
lets break a few parts down... HY-antigen = histo-compatibility Y-antigen. histo = latin for uterus (hence hysterectomy = removal of the uterus). (lets remember 8th grade, and the fact that females dont carry a Y chromosome, and are never exposed to the Y chromosome; unless they are carrying a male in utero)
so, the uterus-compatibility for the Y chromosome antigen(HY-antigen), stays with teh mother forever
-------------------- Uncleluke, getting his assbeat, then he tries to delete it http://www.shroomery.org/forums/showflat.php/Number/6355469#Post6355469 Tomato-Faced Banez http://www.shroomery.org/forums/showflat.php/Number/5933438#Post5933438 Dexter's Thesaurus beer = guinness smoke = vaporize pubers = reasons to be pro-choice
|
Taharka
The Root of the Problem


Registered: 09/29/05
Posts: 686
|
|
Yes, you're right there. Antigens stay with the mother forever. And immune disorders plague even humans. But what exactly, again, do antigens have to do with the genetic makeup of the baby? Nothing. Fraternal birth order, the immune system, NONE of this has anything to do with genetics.
You may consider yourself an excellent and knowledgeable dog breeder, but for all you know females that have been mated with males from other breeds can't "officially" produce purebred puppies for the same reason that tails need to be docked in certain species. It could be something as stupid as ideals or an outdated tradition. But it has nothing to do with science.
The offspring might be affected by alot more than the parents' genes, during the developmental stages after the embryo has already been created. But none of these things will change it's DNA. The breed of the puppies (or the race of a human, which can be seen as analogous) depends solely on their genetic makeup. You can talk about antigens all you want, but they have nothing to do with this. You are wrong.
|
Magash
Da Bud Guru


Registered: 07/25/02
Posts: 5,876
Loc: Near Hilo
|
Re: seed potency loss [Re: Phish_Dude]
#6685756 - 03/19/07 12:14 AM (16 years, 11 months ago) |
|
|
This thread has been closed.
Reason: This just got way off topic and way to stupid.
|
|