Home | Community | Message Board


This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

PhytoExtractum Shop: Maeng Da Thai Kratom Leaf Powder

Jump to first unread post Pages: < Back | 1 | 2 | 3 | Next >  [ show all ]
Offlinefireworks_godS
Sexy.Butt.McDanger
Male

Registered: 03/12/02
Posts: 24,855
Loc: Pandurn
Last seen: 1 year, 2 months
Re: Moderator Evaluations. [Re: twiggedoubt]
    #6608709 - 02/25/07 01:30 PM (17 years, 1 month ago)

Jealous much? :smirk:


--------------------
:redpanda:
If I should die this very moment
I wouldn't fear
For I've never known completeness
Like being here
Wrapped in the warmth of you
Loving every breath of you

:heartpump: :bunnyhug: :yinyang:

:yinyang: :levitate: :earth: :levitate: :yinyang:

Extras: Filter Print Post Top
Offlinetwiggedoubt
twigburst
Male User Gallery

Registered: 10/10/01
Posts: 2,387
Last seen: 16 years, 10 months
Re: Moderator Evaluations. [Re: fireworks_god]
    #6608746 - 02/25/07 01:46 PM (17 years, 1 month ago)

I just don't think people deserve jack dick to mod, neither does anyone that contributes. If they have money to pay mods, they have too much.

Extras: Filter Print Post Top
Invisiblejewunit
Brutal!
Male User Gallery
Registered: 01/11/07
Posts: 34,264
Loc: Ohio
Re: Moderator Evaluations. [Re: twiggedoubt]
    #6609364 - 02/25/07 04:50 PM (17 years, 1 month ago)

What do you propose they do with the money instead?


--------------------
!

Extras: Filter Print Post Top
InvisibleBoom
just a tester
Male
Registered: 06/16/04
Posts: 11,252
Loc: Cypress Creek
Re: Moderator Evaluations. [Re: jewunit]
    #6609381 - 02/25/07 04:57 PM (17 years, 1 month ago)

What money? :lol:

Extras: Filter Print Post Top
Invisibleadrug

Registered: 02/04/03
Posts: 15,800
Re: Moderator Evaluations. [Re: jewunit]
    #6609390 - 02/25/07 04:59 PM (17 years, 1 month ago)

Quote:


What do you propose they do with the money instead?




I propose they restart Shroomery Radio broadcasts with me in charge.

I pm'ed Ythan about it the last week, but I never even got a read receipt so I have no idea if anyone read it...

but I did save it in my sent messages in case I have to send it to someone else.

Extras: Filter Print Post Top
InvisibleTHE KRAT BARON
one-eyed willie
Registered: 07/08/03
Posts: 42,409
Re: Moderator Evaluations. [Re: adrug]
    #6609411 - 02/25/07 05:04 PM (17 years, 1 month ago)

Bringing back Shroomery radio would be tits. :yesnod:


On another note has anyone else noticed that some of the mods that are never active have now mysteriously started posting here and there now that the evaluation is in effect? :lol:


--------------------
m00nshine is currently vacationing in Maui. Rumor has it he got rolled by drunken natives and is currently prostituting himself in order to pay for airfare back to the mainland but he's having trouble juggling a hairon addiction. He won't be back for a long while.

Extras: Filter Print Post Top
OfflineMadtowntripper
Sun-Beams out of Cucumbers
 User Gallery

Registered: 03/06/03
Posts: 21,287
Loc: The Ocean of Notions
Last seen: 8 months, 9 days
Re: Moderator Evaluations. [Re: THE KRAT BARON]
    #6609512 - 02/25/07 05:29 PM (17 years, 1 month ago)

I think the poll is flawed in that respect.

I only see Chinacat once in a blue moon, and Papaver is only around here and there, but I wouldnt dream of De-Modding either one of them.


--------------------
After one comes, through contact with it's administrators, no longer to cherish greatly the law as a remedy in abuses, then the bottle becomes a sovereign means of direct action.  If you cannot throw it at least you can always drink out of it.  - Ernest Hemingway

If it is life that you feel you are missing I can tell you where to find it.  In the law courts, in business, in government.  There is nothing occurring in the streets. Nothing but a dumbshow composed of the helpless and the impotent.    -Cormac MacCarthy

He who learns must suffer. And even in our sleep pain that cannot forget falls drop by drop upon the heart, and in our own despair, against our will, comes wisdom to us by the awful grace of God.  - Aeschylus

Extras: Filter Print Post Top
InvisibleBanez
Stranger
Male User Gallery

Registered: 09/23/05
Posts: 15,181
Re: Moderator Evaluations. [Re: THE KRAT BARON]
    #6609676 - 02/25/07 06:17 PM (17 years, 1 month ago)

Quote:

mattzdope said:

On another note has anyone else noticed that some of the mods that are never active have now mysteriously started posting here and there now that the evaluation is in effect? :lol:




i was thinking the same thing yesterday when i saw moderators actually making threads in the pub, this is rare besides zippoz and wiccan.. but i def saw some mods posting that i had completely forgotten about.


--------------------
Banez' PF Tek For Beginners

Extras: Filter Print Post Top
InvisibleTHE KRAT BARON
one-eyed willie
Registered: 07/08/03
Posts: 42,409
Re: Moderator Evaluations. [Re: Madtowntripper]
    #6609768 - 02/25/07 06:35 PM (17 years, 1 month ago)

Quote:

Madtowntripper said:
I think the poll is flawed in that respect.

I only see Chinacat once in a blue moon, and Papaver is only around here and there, but I wouldnt dream of De-Modding either one of them.




I disagree 100%. Moderators should be active in the forums they moderate. If they do not have the time to be active then they should not be moderating. This isn't to say that I don't like either of them (or any of the other inactive mods for that matter) or that it's anything personal.


--------------------
m00nshine is currently vacationing in Maui. Rumor has it he got rolled by drunken natives and is currently prostituting himself in order to pay for airfare back to the mainland but he's having trouble juggling a hairon addiction. He won't be back for a long while.

Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: Moderator Evaluations. [Re: THE KRAT BARON]
    #6609782 - 02/25/07 06:40 PM (17 years, 1 month ago)

Quote:

mattzdope said:
On another note has anyone else noticed that some of the mods that are never active have now mysteriously started posting here and there now that the evaluation is in effect? :lol:




Yep.

I don't have a problem with any of the mods here. They're good people. (Though I guess I don't know some of them in those 'strange' community forums. :smile: )

There are those that do a fantastic job, like Wiccan for example.
Those who do a fine job, and have no reason to be demodded.
Those who are technically mods, but we all forgive them for not being around. (Chinacat and Papaver were mentioned for example).
And then there are those who haven't posted since august. And though I'm not sure why/have no problem with them/hope they're doing alright in real life, perhaps some new mods coming in would help out, as sometimes it appears that there are more mods than are really active.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!

Extras: Filter Print Post Top
Offlinetwiggedoubt
twigburst
Male User Gallery

Registered: 10/10/01
Posts: 2,387
Last seen: 16 years, 10 months
Re: Moderator Evaluations. [Re: jewunit]
    #6609857 - 02/25/07 06:56 PM (17 years, 1 month ago)

Quote:

jewunit said:
What do you propose they do with the money instead?




Lots of stuff, contests, better servers, more space, I don't care what the hell they do with it, mods shouldn't be paid period. The idea of it pisses me off, the reason this forum works isn't because of the mods, its because people contribute and why do mods deserve anymore than someone who posts? I just don't think this is what msg boards should be about.

Extras: Filter Print Post Top
OfflineRedstorm
Prince of Bugs
Male

Folding@home Statistics
Registered: 10/08/02
Posts: 44,175
Last seen: 5 months, 27 days
Re: Moderator Evaluations. [Re: twiggedoubt]
    #6611127 - 02/26/07 12:00 AM (17 years, 1 month ago)

I don't think we should be paid, but I think you seriously underestimate how much shit we have to deal with.

Extras: Filter Print Post Top
Offlinetwiggedoubt
twigburst
Male User Gallery

Registered: 10/10/01
Posts: 2,387
Last seen: 16 years, 10 months
Re: Moderator Evaluations. [Re: Redstorm]
    #6611623 - 02/26/07 06:00 AM (17 years, 1 month ago)

Well I can only comment on what I see, but the point is that everyone contributes and thats why message boards work. Paying mods is probably the gayest idea I have ever heard on any of the message boards I have ever posted at.

Extras: Filter Print Post Top
InvisibleStein
Stranger
 User Gallery

Registered: 07/02/03
Posts: 35,129
Re: Moderator Evaluations. [Re: twiggedoubt]
    #6611644 - 02/26/07 06:20 AM (17 years, 1 month ago)

I heard the admins are gonna pay by the ban.

Extras: Filter Print Post Top
Offlinetwiggedoubt
twigburst
Male User Gallery

Registered: 10/10/01
Posts: 2,387
Last seen: 16 years, 10 months
Re: Moderator Evaluations. [Re: Stein]
    #6611651 - 02/26/07 06:29 AM (17 years, 1 month ago)

Will you get more money for banning higher post counts?

Extras: Filter Print Post Top
InvisibleStein
Stranger
 User Gallery

Registered: 07/02/03
Posts: 35,129
Re: Moderator Evaluations. [Re: twiggedoubt]
    #6611655 - 02/26/07 06:32 AM (17 years, 1 month ago)

I'm not sure how it's gonna work. For all I know I'll be bannished after the survey.

Extras: Filter Print Post Top
Offlinetwiggedoubt
twigburst
Male User Gallery

Registered: 10/10/01
Posts: 2,387
Last seen: 16 years, 10 months
Re: Moderator Evaluations. [Re: Stein]
    #6611660 - 02/26/07 06:38 AM (17 years, 1 month ago)

You should of thought about that before being an asshole to all the nice hippies at the shroomery. I gave you a good evaluation if it makes any difference.

Extras: Filter Print Post Top
InvisibleStein
Stranger
 User Gallery

Registered: 07/02/03
Posts: 35,129
Re: Moderator Evaluations. [Re: twiggedoubt]
    #6611670 - 02/26/07 06:48 AM (17 years, 1 month ago)

I don't think I struck too many bad chords but I sure will miss that retirement package they're offering.

Extras: Filter Print Post Top
OfflineRonoS
DSYSB since '01
Male User Gallery

Registered: 01/25/01
Posts: 16,259
Loc: Calgary, Alberta
Last seen: 1 year, 1 month
Re: Moderator Evaluations. [Re: Stein]
    #6611762 - 02/26/07 08:11 AM (17 years, 1 month ago)

Tell me about it...I was just starting to get used to having a company car.


--------------------
"Life has never been weird enough for my liking"

Extras: Filter Print Post Top
InvisibleStein
Stranger
 User Gallery

Registered: 07/02/03
Posts: 35,129
Re: Moderator Evaluations. [Re: Rono]
    #6611884 - 02/26/07 09:03 AM (17 years, 1 month ago)

I hope they don't come for compensation for all the 900 numbers I called on the mod issued cells.

Extras: Filter Print Post Top
Jump to top Pages: < Back | 1 | 2 | 3 | Next >  [ show all ]

PhytoExtractum Shop: Maeng Da Thai Kratom Leaf Powder


Similar ThreadsPosterViewsRepliesLast post
* Other Drugs Discussion: Temporarily Closed & Fully Moderated
( 1 2 all )
geokillsA 5,043 27 03/17/03 06:36 PM
by geokills
* Some of the New Moderators and Their Power Trips!
( 1 2 3 all )
IneedHitsPLEASE 7,465 47 07/16/01 02:55 PM
by Thor
* moderation in moderation please? ;P
( 1 2 3 all )
Strumpling 6,411 48 05/30/03 09:16 AM
by 3DSHROOM
* Do you want to be a moderator?
( 1 2 3 all )
ThorA 7,932 54 10/20/04 12:40 PM
by Locus
* Fighting a determined enemy, post whores.
( 1 2 3 4 all )
Ellis Dee 10,378 71 12/06/04 12:54 PM
by joe666
* Notify Moderator... ATWAR 766 4 07/02/04 04:45 AM
by Loki
* Selective moderation SeussA 1,794 5 02/23/02 01:37 PM
by djfrog
* Wher the HELL are the moderators? dioze1 1,335 5 05/17/01 04:05 AM
by dioze1

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: Ythan, Thor, Seuss, geokills
5,108 topic views. 0 members, 1 guests and 3 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2024 Mind Media. Some rights reserved.

Generated in 0.036 seconds spending 0.01 seconds on 15 queries.