Home | Community | Message Board

MushroomCube.com
This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Shop: Left Coast Kratom Buy Kratom Extract   Myyco.com Golden Teacher Liquid Culture For Sale   Unfolding Nature Unfolding Nature: Being in the Implicate Order   Kraken Kratom Red Vein Kratom   PhytoExtractum Maeng Da Thai Kratom Leaf Powder   North Spore North Spore Mushroom Grow Kits & Cultivation Supplies   Original Sensible Seeds Bulk Cannabis Seeds

Jump to first unread post Pages: 1
OfflineLuSiD9
reality is plastic
Male User Gallery

Folding@home Statistics
Registered: 09/06/06
Posts: 4,705
Loc: The Bowels of Canada
Last seen: 2 months, 11 days
Oregon vortex...
    #6474098 - 01/18/07 05:22 PM (17 years, 2 months ago)

http://www.oregonvortex.com/
http://montanavortex.com/index.php?option=com_frontpage&Itemid=1

Has anyone been to one of these 'vortex locations'? This is some whacky fucking shit!... Apparently they are scattered around the world, but the one in oregon is supposedly the most 'active' one.

I'd like to spend a mushroom/any other psychedelic trip in one of these locations!:)... I wonder if there are any here in canada.


--------------------
Nothing is true, everything is permissible.

Our laws make law impossible; our liberties destroy all freedom; our property is organized robbery; our morality an impudent hypocrisy; our wisdom is administered by inexperienced or mal-experienced dupes; our power wielded by cowards and weaklings; and our honour false in all its points. I am an enemy of the existing order for good reasons.

Extras: Filter Print Post Top
OfflineKonnrade
↑↑↓↓<--><-->BA
Male User Gallery

Folding@home Statistics
Registered: 09/13/05
Posts: 13,833
Loc: LA Suburbs
Last seen: 10 months, 23 days
Re: Oregon vortex... [Re: LuSiD9]
    #6474205 - 01/18/07 05:51 PM (17 years, 2 months ago)

It's all a matter of illusion. The entire thing is smoke and mirrors.

A local themepark here has some of the same attractions in a little sideshow, and they explain the actual deceptions behind it. They didn't built that sideshow in a mystical location, either. You can build a stage for magic tricks anywhere, putting it on a supposedly enchanted location merely lends it a bit of superstitious credibility.


--------------------

I find your lack of faith disturbing

Extras: Filter Print Post Top
OfflineLuSiD9
reality is plastic
Male User Gallery

Folding@home Statistics
Registered: 09/06/06
Posts: 4,705
Loc: The Bowels of Canada
Last seen: 2 months, 11 days
Re: Oregon vortex... [Re: Konnrade]
    #6474224 - 01/18/07 05:58 PM (17 years, 2 months ago)

I know what your saying, but honestly, I don't think it's 'staged' or a 'magic trick' my girlfreinds physics professor was telling her about it, and apparently the laws of physics have some trouble explaining the phenomena it produces.


--------------------
Nothing is true, everything is permissible.

Our laws make law impossible; our liberties destroy all freedom; our property is organized robbery; our morality an impudent hypocrisy; our wisdom is administered by inexperienced or mal-experienced dupes; our power wielded by cowards and weaklings; and our honour false in all its points. I am an enemy of the existing order for good reasons.

Extras: Filter Print Post Top
OfflineLuSiD9
reality is plastic
Male User Gallery

Folding@home Statistics
Registered: 09/06/06
Posts: 4,705
Loc: The Bowels of Canada
Last seen: 2 months, 11 days
Re: Oregon vortex... [Re: LuSiD9]
    #6474246 - 01/18/07 06:04 PM (17 years, 2 months ago)

Mystery Spots

Just think of an Ames Room and multiply the effect by a thousand. This is what a Mystery Spot is like. A dozen in America are described in Douglas B Vogt's book Gravitational Mystery Spots: Explained Using the Theory of Multidimensional Reality; all being very similar, I have visited the one at Santa Cruz in California. Others are in Florida, Michigan, North Carolina, Ohio, Oregon, South Dakota, Tennessee (not open), Wisconsin, and Wyoming. There are also Magnetic Hills, especially in Canada, near Moncton in New Brunswick, the Electric Bray in Ayrshire, Scotland, and there are many others around the world. But these are only roads on which cars seem to run upwards against gravity. They are not the Full Monty. The Full Monty Mystery Spot has a lopsided two-roomed wooden cabin perched on the side of a steep forested hill. The first probably happened by accident---a cabin sliding down a hill, ending up twisted though intact before reaching the bottom. The other American Mystery Spots seem to be straight copies of the first. They are tourist attractions owned and run as businesses by families. They are deservedly popular and well worth a visit.

As the cabins have crazy shapes they have misleading---because not true---horizontals and verticals. They are confusing to the extent of producing vertigo and even nausea which lasts for quite a time. One hangs on to anything available to keep one's balance. There are several associated phenomena---especially the shrink-and-grow effect. People standing on an apparently horizontal plank outside the cabin appear taller when at one end and shorter standing on the other end of the plank. This can be shown in a photograph, though it is somewhat hard to know where to place the camera on the steep slope of the hill. Also, it feels harder to push a heavy suspended bob in one direction than in others. If confirmed, this is a particularly interesting effect.

One needs a complement of measuring instruments to be sure of just what is going on. But thorough investigation of a Mystery Spot is not easy, as one is dissuaded from lingering, or indeed questioning the received philosophy: multidimensional gravity and local anomaly of spacetime. For the dramatic phenomena are not presented as perceptual illusions but as anomalies of a future physics. In fact the notion of illusions is seen as illusory!

The situation is very different from an Ames Room, which uses `negative perspective' to give the same retinal image as a normal rectangular room, though it is a strange shape; so, if properly made, it must look like a normal room. It becomes interesting when objects (especially people) are added, for they look too tall or too short when they are at different distances though apparently at the same distance. These twisted cabins evidently violate our assumptions of normal horizontal and vertical, which is a very different matter. They raise many questions, such as what deviations from horizontal and vertical work best? Do the effects occur if it is not a realistic cabin, or room? Do they disappear with familiarity? Does long-term adaptation make a normal room appear strange? Do people unfamiliar with rectangular rooms experience similar effects in the Mystery Spots? These are kinds of questions we might ask, and I simply don't know the answers; but Douglas Vogt views the situation very differently.

Investigating the Oregon Vortex (at 4303 Sardine Creek Road, Gold Hill, OR 97525), Vogt found that time slowed down in the vortex. This Mystery Spot is the oldest known, and quite likely the first. Apparently it was owned and investigated by a John Lister in 1914, after being an assay office of a mining company, before sliding down the hill and coming to rest near a large tree. Vogt thinks that Lister built the cabin crooked, to accentuate the effect of the vortex. This is in the hill itself, causing trees to grow crooked and spiralled, with magnetic and time-warping effects in this small special region. It seems that Lister described the vortex as circular, but with `terralines' some 57 inches apart, oriented to the four compass points and intersecting at 90<$>\deg<$>. He describes the circular area as expanding and contracting periodically, and saw the phenomena as electromagnetic.

Vogt does not believe this electromagnetic account, and he carried out a series of experiments in this and some other Mystery Spots, following a different theory, entirely opposed to perceptual illusions, writing: ``My experimental approach was that if there was a time shift associated with the size change, then it would rule out any possibility of visual illusions or trickery'' (page 10).

From time measurements with a 25 MHz `freely oscillating crystal', powered by a 9 V battery, Vogt gives several graphs relating the oscillator frequency to position across the vortex, compared with measurements made ``in normal time and space''. Though standard deviations or statistical significances are not given, the `mystery' and the `normal' curves do look very different. The oscillator frequency stays almost constant, over several hours, in the normal conditions; but rises when moved towards the centre of the anomaly---as ``time was affected''.

The guide to the Santa Cruz Mystery Spot that I visited produced the same kind of explanation for the visual phenomena. Any illusions that there might be were dismissed as masking the true phenomena. Changes of gravity and time in the anomaly were expounded, in apparent good faith, to children and adults alike.

Just why don't I believe a word of it? It is presented as science, with measurements including controls. But the more it looks like science the more disturbing it is that the public are given this account as though acceptably true. If there were no measurements, no graphs, one might simply dismiss it as unjustified belief. But here there are powerful phenomena, which are surely significant if considered appropriately. For us they demonstrate basic perceptual principles, and they may raise some questions we can only partly answer. Just why is an iron bob harder to push ``towards the vortex'' than away? Is there a hidden magnet, or is this a perceptual phenomenon? It is foolish to be dogmatic, yet I am absolutely certain that it is a Bad Idea to tell children that they are suffering local anomalies of spacetime, when they are experiencing dramatic phenomena created by their eyes and brains.

Richard Gregory

Vogt D B, 1996 Gravitational Mystery Spots: Explained Using the Theory of Multidimensional Reality (Bellevue, WA: Vector Associates)


--------------------
Nothing is true, everything is permissible.

Our laws make law impossible; our liberties destroy all freedom; our property is organized robbery; our morality an impudent hypocrisy; our wisdom is administered by inexperienced or mal-experienced dupes; our power wielded by cowards and weaklings; and our honour false in all its points. I am an enemy of the existing order for good reasons.

Extras: Filter Print Post Top
InvisibleLosAngelesGraff
Ca Shroomite
Male User Gallery

Folding@home Statistics
Registered: 06/09/06
Posts: 7,047
Loc: Califas
Re: Oregon vortex... [Re: LuSiD9]
    #6474264 - 01/18/07 06:08 PM (17 years, 2 months ago)

damn that shit does loook tight


--------------------
:prawn::baggy::zilla:
Please help support cover-upz blog
http://cover-upz.blogspot.com/
Please PM me if you can help build cover upz blog.

Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: Oregon vortex... [Re: LosAngelesGraff]
    #6474299 - 01/18/07 06:19 PM (17 years, 2 months ago)

I've been to a couple. Thought it was pretty lame.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!

Extras: Filter Print Post Top
InvisibleDieCommie

Registered: 12/11/03
Posts: 29,258
Re: Oregon vortex... [Re: LuSiD9]
    #6474314 - 01/18/07 06:23 PM (17 years, 2 months ago)

As a mysterious physics phenomena, complete and utter BS. As a novelty like a house of mirrors, could be fun.

http://www.randi.org/jr/101003.html

Extras: Filter Print Post Top
OfflineLuSiD9
reality is plastic
Male User Gallery

Folding@home Statistics
Registered: 09/06/06
Posts: 4,705
Loc: The Bowels of Canada
Last seen: 2 months, 11 days
Re: Oregon vortex... [Re: DieCommie]
    #6474350 - 01/18/07 06:35 PM (17 years, 2 months ago)

:sad:

Hmmm, I thought it seemed a little 'touristy' it would still be fun though.

Can the orbs and some of the other phenomena be explained though?

BTW, I wasn't implying that this was a 'magical' or 'sacred' site, just found it trippy.


--------------------
Nothing is true, everything is permissible.

Our laws make law impossible; our liberties destroy all freedom; our property is organized robbery; our morality an impudent hypocrisy; our wisdom is administered by inexperienced or mal-experienced dupes; our power wielded by cowards and weaklings; and our honour false in all its points. I am an enemy of the existing order for good reasons.

Extras: Filter Print Post Top
OfflineToTheSummit
peregrinus
 User Gallery

Folding@home Statistics
Registered: 08/22/99
Posts: 9,126
Loc: Las Vegas
Last seen: 1 month, 22 days
Re: Oregon vortex... [Re: LuSiD9]
    #6474424 - 01/18/07 07:06 PM (17 years, 2 months ago)

The whole idea of some "mystery sopt" is just more gimmick to help advertise their attraction. These things are everwhere. I've personally been to at least 5 of them in my life. The most recent was at Calico Ghost Town last summer here in Southern Cal. I was so unimpressed (after seeing several of these before) that this was the only picture I bothered to take. It shows the somewhat unenthusiastic teenage guide standing next to a balancing broom.



Oh, and they always have some goofy back-story to tell you when you take the tour. Everything from magnetic metorites to ghosts of dead miners.


--------------------
You invented the wheel....You push the motherfucker!!

Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: Oregon vortex... [Re: ToTheSummit]
    #6474450 - 01/18/07 07:12 PM (17 years, 2 months ago)

Yeah, both of mine had magnetic rock/meteor stories. It caused the nails in the house to allegedly tilt when they built it.

Also, both had a gift shop, and then a long, long winding stair case into sort of a valley where any other man made object was completely out of site, to ensure that you wouldn't compare it to the "mystery spot" and spoil the illusion.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!

Extras: Filter Print Post Top
Jump to top Pages: 1

Shop: Left Coast Kratom Buy Kratom Extract   Myyco.com Golden Teacher Liquid Culture For Sale   Unfolding Nature Unfolding Nature: Being in the Implicate Order   Kraken Kratom Red Vein Kratom   PhytoExtractum Maeng Da Thai Kratom Leaf Powder   North Spore North Spore Mushroom Grow Kits & Cultivation Supplies   Original Sensible Seeds Bulk Cannabis Seeds


Similar ThreadsPosterViewsRepliesLast post
* Tonite there is 1 Person with a vortex for good vibez
( 1 2 3 all )
World Spirit 2,286 55 12/02/09 09:33 PM
by World Spirit
* marko rodin- vortex based mathematics whatshisname 1,099 17 03/17/11 03:42 PM
by Fungal-one
* Gravity Vortex bong noticeofeviction 3,549 17 03/04/10 12:58 PM
by noticeofeviction
* My weekend adventure - hiking and motorcycling the best of Oregon - tons of rad pics! Grok 2,787 15 10/14/07 08:23 AM
by Merkin
* Nerf Vortex Megahowler Atheist 758 13 06/04/08 02:14 PM
by boletusoftruth
* Nerf Vortex Classic Redstorm 856 11 06/05/05 11:51 PM
by Redstorm
* Mirror Vortex Knowl3dge 212 2 06/26/09 11:51 AM
by Groomies
* so This is a dilemma
( 1 2 all )
happyhardcore22 2,756 29 04/15/09 02:05 AM
by happyhardcore22

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: Entire Staff
2,085 topic views. 3 members, 29 guests and 85 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2024 Mind Media. Some rights reserved.

Generated in 0.027 seconds spending 0.008 seconds on 14 queries.