|
 Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
|
 phaust
Stranger
Registered: 08/22/06
Posts: 70
Loc: Toronto, ON
Last seen: 7 years, 5 months
|
 Sensory Deprivation? 
#6417200 - 01/02/07 01:07 AM (17 years, 3 months ago) |
|
|
Since my shroom sources have once again withered away for an unknown amount of time, I began prodding around the net for some alternative sources of enlightenment. I was wondering:
Has anyone here attempted a sensory deprivation experiment in their homes? In a bathtub or something? I was just wondering if anybody had, and if so, whether they could provide some information on the matter.
Edited by phaust (01/02/07 01:12 AM)
|
mikehawk
Stranger
Registered: 12/30/06
Posts: 211
Last seen: 16 years, 8 months
|
 Re: Sensory Deprivation? [Re: phaust]
#6417210 - 01/02/07 01:13 AM (17 years, 3 months ago) |
|
|
what in the world is sensory deprivation.
please fill me in
|
 MistaUNGA
green crack GREEN CRACK!!
Registered: 10/01/06
Posts: 1,519
Loc: Kalifornien, im Süden...
|
Re: Sensory Deprivation? [Re: mikehawk]
#6417278 - 01/02/07 02:15 AM (17 years, 3 months ago) |
|
|
SD is what it says it is. You are depriving yourself of your senses. This means that it is dark -> no visual sense, quiet -> no auditory sense, warm water (usually around body temp) -> relaxing, and less physical sensation, and you're not eating or smelling anything.
I have read about people going into SD chambers or whatever, but I think it would be difficult to achieve in home. However, I'd heard it can lead to some OBEs, mild hallucinations, etc. It really depends on a deep mediation.
--------------------
Madtowntripper said:Or just give her a cloroform soaked rag and tell her it's ether!
|
euphoricpoison
Expand your Mind
Registered: 10/10/06
Posts: 3,270
Loc: NewYork
Last seen: 4 years, 1 month
|
 Re: Sensory Deprivation? [Re: MistaUNGA]
#6417378 - 01/02/07 04:06 AM (17 years, 3 months ago) |
|
|
whats an OEB? Out of body expirience?
|
j3ckyl
☣☤Penteract☤☣
Registered: 11/16/06
Posts: 450
Loc: Earth
Last seen: 7 years, 10 months
|
|
this is a subject i am very interested in, so much so that on the 9th of this month i will be travelling with my g/f to experience one hour in a sensory isolation chamber at edinburgh floatarium in search of natural enlightenment.
Sensory isolation chambers are sound proof, light proof and filled with high concentrate salt solution. Also the water and the air must remain the same temperature so that when the body becomes accustomed it feels neither water nor the air, providing one with a sense of floating in zero gravity. With this in mind it would be difficult although not necessarily impossible to achieve at home. Ill be sure to post my experience with the chamber when i return.
--------------------
"There are only two states of being: Too much and not enough"
Isnt the war on drugs supposed to reduce harm? So far all i see are casualties.
|
euphoricpoison
Expand your Mind
Registered: 10/10/06
Posts: 3,270
Loc: NewYork
Last seen: 4 years, 1 month
|
Re: Sensory Deprivation? [Re: j3ckyl]
#6417469 - 01/02/07 06:00 AM (17 years, 3 months ago) |
|
|
I ment whats an OBE?
Edited by euphoricpoison (01/02/07 06:01 AM)
|
j3ckyl
☣☤Penteract☤☣
Registered: 11/16/06
Posts: 450
Loc: Earth
Last seen: 7 years, 10 months
|
|
most probably out of body experience, a common theme among people who use the chambers. One hour in an SD chamber is the equivalent of 6 hours rest for the people who use it for relaxation. This is its most common use but it can be used to induce extremely deep states of meditation and people report out of body experiences, enlightenment, metaphysical projection and such like. Probably the most intense thing you could do without drugs.
--------------------
"There are only two states of being: Too much and not enough"
Isnt the war on drugs supposed to reduce harm? So far all i see are casualties.
|
euphoricpoison
Expand your Mind
Registered: 10/10/06
Posts: 3,270
Loc: NewYork
Last seen: 4 years, 1 month
|
Re: Sensory Deprivation? [Re: j3ckyl]
#6417504 - 01/02/07 06:45 AM (17 years, 3 months ago) |
|
|
thanx man, 5 stars
|
j3ckyl
☣☤Penteract☤☣
Registered: 11/16/06
Posts: 450
Loc: Earth
Last seen: 7 years, 10 months
|
|
--------------------
"There are only two states of being: Too much and not enough"
Isnt the war on drugs supposed to reduce harm? So far all i see are casualties.
|
RoosterCogburn
Fearless,one-eyed U.S.Marshall
Registered: 08/25/06
Posts: 8,508
Loc: Dirty South, NJ
Last seen: 12 years, 7 months
|
Re: Sensory Deprivation? [Re: j3ckyl]
#6417566 - 01/02/07 08:06 AM (17 years, 3 months ago) |
|
|
What would happen if you low dosed (~2g shrooms) and then went in for 3 hours?
I think in about 15 minutes, you'd be itching to get out!!
On a side note, do they sell home models of these SD chambers?
|
j3ckyl
☣☤Penteract☤☣
Registered: 11/16/06
Posts: 450
Loc: Earth
Last seen: 7 years, 10 months
|
|
If anything a low dose before entering the chamber would most likely heighten the experience without destroying it. It's supposedly very hard not to relax inside one unless you were claustrophobic and achluophobic. If i choose to return i will probably load up with something first to measure the difference in experience. After about 40 mins inside a chamb er without any external stimulants the brain enters theta wave states without actually falling asleep, i think the 2gms might make that period more interesting. Most commercial places however will only let you go in for periods of one hour.
To your side note, there are chambers designed for home use. However expect to pay a serious amount of money for one and needing a place to put one may not be a simple problem (about the size of a small car in some cases). In an ideal world i'd have one in a heart beat.
--------------------
"There are only two states of being: Too much and not enough"
Isnt the war on drugs supposed to reduce harm? So far all i see are casualties.
Edited by j3ckyl (01/02/07 08:32 AM)
|
RoosterCogburn
Fearless,one-eyed U.S.Marshall
Registered: 08/25/06
Posts: 8,508
Loc: Dirty South, NJ
Last seen: 12 years, 7 months
|
Re: Sensory Deprivation? [Re: j3ckyl]
#6417620 - 01/02/07 08:55 AM (17 years, 3 months ago) |
|
|
Might be fun to try and build one... Just mimic a large tropical saltwater fish tank, with opaque walls and some kind of FAE.
I don't have the room or I'd proabably try it.
|
TuneInTurnOn
Guru
Registered: 12/11/06
Posts: 521
Loc: Toronto, Canada
Last seen: 14 years, 5 months
|
Re: Sensory Deprivation? [Re: phaust]
#6417656 - 01/02/07 09:28 AM (17 years, 3 months ago) |
|
|
You can try it at home without the isolation tank; take blue toilet/tissue paper, tape it to the inside of chemistry goggles, and stare at a light for 20 minutes. You are essentially depraving your sense of sight so the brain hallucinates to keep itself busy.
--------------------
My apartment in New York was on Perry Street, a five minute walk from the White Horse. I often drank there, but I was never accepted because I wore a tie. The real people wanted no part of me.
- The Rum Diary
|
j3ckyl
☣☤Penteract☤☣
Registered: 11/16/06
Posts: 450
Loc: Earth
Last seen: 7 years, 10 months
|
|
Is what you said about the goggles true tuneinturnon?if possible any links for further reading? it would certainly make an interesting experiment. Any particular reason for blue?
--------------------
"There are only two states of being: Too much and not enough"
Isnt the war on drugs supposed to reduce harm? So far all i see are casualties.
|
TuneInTurnOn
Guru
Registered: 12/11/06
Posts: 521
Loc: Toronto, Canada
Last seen: 14 years, 5 months
|
Re: Sensory Deprivation? [Re: j3ckyl]
#6417694 - 01/02/07 10:01 AM (17 years, 3 months ago) |
|
|
yup, apparently it works although I have not tried it, I have read about sensory depravation in the past. I have no idea why the paper should be blue! lol, when it said "blue toilet paper", I thought, "where the hell am I going to get blue toilet paper??" I put tissue paper up above because the idea just occured to me, ill try it with tissue paper and see if it works. Here is a quote from this link: http://www.hackcanada.com/ice3/wetware/no_drug.txt
"For those of you into sensory depravation, try the Lilly Tank.
Just like in the movie _Altered_States_, this tank will change the
frequency at which your brain operates. Also try Ganzfeld Goggles. A
pair of old diving goggles covered with blue toilet paper will do.
Just lay back on a bed with these goggles on and stare into a light
bulb. The toilet paper turns the light from the bulb into a uniform
glowing blue field. Since your eyes have nothing to focus on, your
brain keeps itself busy by hallucinating. (This effect may take
from 5-20 minutes to occur.)"
and they have this info listed on Totse as well, by the same author (Jeff Hunter)
http://www.totse.com/en/drugs/otc/no_drug.html
It would be a very interesting experiment I agree!
--------------------
My apartment in New York was on Perry Street, a five minute walk from the White Horse. I often drank there, but I was never accepted because I wore a tie. The real people wanted no part of me.
- The Rum Diary
|
RoosterCogburn
Fearless,one-eyed U.S.Marshall
Registered: 08/25/06
Posts: 8,508
Loc: Dirty South, NJ
Last seen: 12 years, 7 months
|
|
/em runs to store for blue tissue paper and goggles.
If I buy them at the same time, will the DEA add me to a list? 
|
AmericaOnLSD
Stranger
Registered: 10/14/06
Posts: 240
Loc: USA
Last seen: 11 years, 9 months
|
|
 Probably best to buy them at two different stores. And make sure you pay cash!
--------------------
See AmericaOnLSD!
Edited by AmericaOnLSD (01/02/07 04:06 PM)
|
TuneInTurnOn
Guru
Registered: 12/11/06
Posts: 521
Loc: Toronto, Canada
Last seen: 14 years, 5 months
|
|
Quote:
AmericaOnLSD said:
Probably best to buy them at two different stores. And make sure you pay cash!
And wear a ski mask, just in case.
--------------------
My apartment in New York was on Perry Street, a five minute walk from the White Horse. I often drank there, but I was never accepted because I wore a tie. The real people wanted no part of me.
- The Rum Diary
|
j3ckyl
☣☤Penteract☤☣
Registered: 11/16/06
Posts: 450
Loc: Earth
Last seen: 7 years, 10 months
|
|
heh, they would if they could. I'm gonna try the goggle trick some time, but the article linked mentions playing frequencies through headphones and goggles with LEDs in them, well a few years back I was at a festival over here and there were a bunch of stalls set up promoting "legal highs" (those words together make me cringe) amongst the salvia, indian head massages and poppers there was a guy who had a stall which was around 15 or so deck chairs each with a pair of headphones and a seat of funny looking goggle type things on them. Naturally I went. It was called a dream machine and you sat in the chair and put the glasses/goggles and the headphones on. Inside the glasses was like 4 different coloured LEDs in each lense and the headphones played, to begin with, a single solid odd sounding tone and then they changed, the LEDs flashed together in sequence in and out of synchronisation. The result was very odd thought patterns, relaxed feelings and bizarre body sensations. I once saw an advert in a magazine advertising home versions of the machine, i didn't buy one and i've been kicking myself ever since. if anyone knows what they are please let me know.
--------------------
"There are only two states of being: Too much and not enough"
Isnt the war on drugs supposed to reduce harm? So far all i see are casualties.
|
TuneInTurnOn
Guru
Registered: 12/11/06
Posts: 521
Loc: Toronto, Canada
Last seen: 14 years, 5 months
|
Re: Sensory Deprivation? [Re: j3ckyl]
#6418922 - 01/02/07 04:30 PM (17 years, 3 months ago) |
|
|
Ebay man, there are tons of models, just search "mind machine", the sirius mindmachine looks the best to me.
--------------------
My apartment in New York was on Perry Street, a five minute walk from the White Horse. I often drank there, but I was never accepted because I wore a tie. The real people wanted no part of me.
- The Rum Diary
|
roby000
me
Registered: 02/28/05
Posts: 9,189
|
Re: Sensory Deprivation? *DELETED* [Re: TuneInTurnOn]
#6418946 - 01/02/07 04:38 PM (17 years, 3 months ago) |
|
|
Post deleted by roby000
Reason for deletion: s
|
j3ckyl
☣☤Penteract☤☣
Registered: 11/16/06
Posts: 450
Loc: Earth
Last seen: 7 years, 10 months
|
Re: Sensory Deprivation? [Re: roby000]
#6419020 - 01/02/07 05:00 PM (17 years, 3 months ago) |
|
|
sensory isolation and sensory deprivation are different things. Think being deprived of food or being isolated from it. Sensory isolation is gauntanamo bay style torture method/self discipline, mainly involving wearing gloves, heavy shoes, blacked out goggles, ear protectors and a hood or hat (see: http://en.wikipedia.org/wiki/Sensory_deprivation). Sensory Isolation is the chambers and is a very common relaxation therapy, I don't believe that it would cause any of the sensations you mention but sensory deprivation most likely would cause all of the above and more.
--------------------
"There are only two states of being: Too much and not enough"
Isnt the war on drugs supposed to reduce harm? So far all i see are casualties.
Edited by j3ckyl (01/02/07 05:11 PM)
|
roby000
me
Registered: 02/28/05
Posts: 9,189
|
Re: Sensory Deprivation? *DELETED* [Re: j3ckyl]
#6419079 - 01/02/07 05:16 PM (17 years, 3 months ago) |
|
|
Post deleted by roby000
Reason for deletion: s
|
j3ckyl
☣☤Penteract☤☣
Registered: 11/16/06
Posts: 450
Loc: Earth
Last seen: 7 years, 10 months
|
Re: Sensory Deprivation? [Re: roby000]
#6419138 - 01/02/07 05:31 PM (17 years, 3 months ago) |
|
|
Interesting you should mention that because sensory isolation chambers were originally conceived to research the effects of sensory deprivation. Thats why "isolation" chambers are called that now, to rid them of the negative connotations with the term deprivation.
I know sleep deprivation, I used to push myself with that to see what my mind was capable of. On the third day everything turned into a picasso painting and peoples features roamed freely around the mess of colour where their head should have been, speech was difficult, no, impossible to understand. Like someone walking up to you and just making gibberish noises at you, complete delirium and incoherence. I'd do it again but fears for personal safety are a big concern, in full blown sleep deprivation you are a walking wreck, and the chances are you wont remember bits or you'll just lose whole hours.
Mind if I ask the purpose of your sensory deprivation experience/experiment?
--------------------
"There are only two states of being: Too much and not enough"
Isnt the war on drugs supposed to reduce harm? So far all i see are casualties.
|
phaust
Stranger
Registered: 08/22/06
Posts: 70
Loc: Toronto, ON
Last seen: 7 years, 5 months
|
Re: Sensory Deprivation? [Re: j3ckyl]
#6419668 - 01/02/07 07:30 PM (17 years, 3 months ago) |
|
|
I tried that audio dream manipulation once, but I haven't attempted it again for a while.
The reason for trying it is simple enough, I'm just curious about other states of consciousness and the capabilities of psychedelic tools beyond just marijuana. I will admit that weed, correctly used, is a decent relaxer and fun when it comes to thinking and CEV's. Although I often get mildly uncomfortable with the constant thoughts. I wonder if shrooms are an amplified version of weed in that respect. I imagine they are.
Edited by phaust (01/02/07 07:33 PM)
|
Koala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG
Registered: 01/07/04
Posts: 7,752
|
Re: Sensory Deprivation? [Re: phaust]
#6420124 - 01/02/07 09:42 PM (17 years, 3 months ago) |
|
|
"Sensory isolation chambers are sound proof, light proof and filled with high concentrate salt solution. "
Would one not smell the salt?
--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!
|
j3ckyl
☣☤Penteract☤☣
Registered: 11/16/06
Posts: 450
Loc: Earth
Last seen: 7 years, 10 months
|
|
phaust: I hear you about weed man, I love that stuff but its like it puts my thoughts on crack. I cycle through trains of thought and often when i get pretty baked it's not being able to slow down the thoughts that stops me sleeping. But I don't get plagued by turbo thinking on shrooms, they always seem to offer me a bunch of visions and show me some neat stuff.
Koala Koolio: epsom salts and certain other choice minerals are used for that reason, you smell those but become very quickly accustomed to it apparently. That and I think they're better for the skin.
--------------------
"There are only two states of being: Too much and not enough"
Isnt the war on drugs supposed to reduce harm? So far all i see are casualties.
|
Koala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG
Registered: 01/07/04
Posts: 7,752
|
Re: Sensory Deprivation? [Re: j3ckyl]
#6421095 - 01/03/07 10:26 AM (17 years, 3 months ago) |
|
|
Thanks... sounds quite interesting.
--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!
|
fresh313
journeyman
Registered: 09/01/03
Posts: 2,537
Last seen: 13 years, 3 days
|
|
book from early 70's on iso tanks by john lilly
pdf link = http://www.savefile.com/files/388255
|
j3ckyl
☣☤Penteract☤☣
Registered: 11/16/06
Posts: 450
Loc: Earth
Last seen: 7 years, 10 months
|
Re: Sensory Deprivation? [Re: fresh313]
#6424776 - 01/04/07 02:11 PM (17 years, 3 months ago) |
|
|
cool, will give it a read. Thanks for the link
--------------------
"There are only two states of being: Too much and not enough"
Isnt the war on drugs supposed to reduce harm? So far all i see are casualties.
|
astraalialma
Friend
Registered: 07/25/05
Posts: 175
Loc: Funland
Last seen: 13 years, 10 months
|
Re: Sensory Deprivation? [Re: j3ckyl]
#6426833 - 01/05/07 12:38 AM (17 years, 3 months ago) |
|
|
|
|
Threaded
Previous
Index
Next
Edit 
Reply 
good wiki article on the subject
swingline
gbhtrfv
Cow Shit Collector
Shnezbit
1 2 all )
Holydiver
barfightlard