Home | Community | Message Board

MushroomMan Mycology
This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Shop: Kraken Kratom Red Vein Kratom   PhytoExtractum Kratom Powder for Sale   Bridgetown Botanicals CBD Concentrates   Original Sensible Seeds Autoflowering Cannabis Seeds

Jump to first unread post Pages: 1
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
OfflineNalim
OTD Kelly Girl
Female User Gallery

Registered: 01/13/06
Posts: 15,033
Last seen: 1 year, 5 months
Cereus peruvianus or T. pachanoi mutant?
    #6408284 - 12/29/06 02:27 PM (17 years, 2 months ago)

I saw a cacti(actually 3) that looked suspiciously like t. pachanoi mutants: http://desjamaan.nl/cgi-ron/sjm_pict.exe?1309 in my local plant-school.
Only one of these was named; Cereus peruvianus, which I know is a non active. Thing is; the other two differed from that one a bit(they where more evenly green)..  :ooo:
I was wondering; Is this a common kind of mutation in the cacti world or is it likely I have stumbled upon two t. pachanoi mutants? :confused:


--------------------

Rodney Brooks on Robots
Nalim said: "Quoting yourself is retarded."

Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: Cereus peruvianus or T. pachanoi mutant? [Re: Nalim]
    #6408308 - 12/29/06 02:35 PM (17 years, 2 months ago)

strange link. says it's an exe. renamed it to jpg, and it works.

I would never be able to ID a crested cactus, but it looks like a crested pachanoi, and nothing like pictures of crested c. peruvianus I've seen.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!

Extras: Filter Print Post Top
Offlinefelixhigh
Scientist
Male User Gallery

Registered: 06/24/01
Posts: 7,565
Loc: Ly
Last seen: 19 days, 1 hour
Re: Cereus peruvianus or T. pachanoi mutant? [Re: Koala Koolio]
    #6408398 - 12/29/06 03:07 PM (17 years, 2 months ago)

These are really hard to ID, only the flower would ID it for sure, there are crested Cereus around as well...


FH

Extras: Filter Print Post Top
OfflineNalim
OTD Kelly Girl
Female User Gallery

Registered: 01/13/06
Posts: 15,033
Last seen: 1 year, 5 months
Re: Cereus peruvianus or T. pachanoi mutant? [Re: felixhigh]
    #6408594 - 12/29/06 04:11 PM (17 years, 2 months ago)

The one that has the name Cereus peruvianus printed on the pot is pretty different from the other two, I would guess that they aren't of the same type... Are there a lot of other species that form these mutations eccept Trichocereus and Cereus?

Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: Cereus peruvianus or T. pachanoi mutant? [Re: Nalim]
    #6408623 - 12/29/06 04:23 PM (17 years, 2 months ago)

Yep.

There are even crested lophophora



--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!

Extras: Filter Print Post Top
OfflineNalim
OTD Kelly Girl
Female User Gallery

Registered: 01/13/06
Posts: 15,033
Last seen: 1 year, 5 months
Re: Cereus peruvianus or T. pachanoi mutant? [Re: Koala Koolio]
    #6408755 - 12/29/06 05:33 PM (17 years, 2 months ago)

damned that's one cool-looking lophophora! Well perhaps I'll buy em anyhow and hope like a madman that they are t. pachanoi or t. peruvianus then try to get them to flower. Would be worth it if they where... And if not; what the hell they're still beautiful...


--------------------

Rodney Brooks on Robots
Nalim said: "Quoting yourself is retarded."

Extras: Filter Print Post Top
Offlinehooksbooks
Fun Guy
Male

Registered: 06/26/06
Posts: 417
Loc: Central, TX
Last seen: 12 years, 3 months
Re: Cereus peruvianus or T. pachanoi mutant? [Re: Nalim]
    #6411008 - 12/30/06 04:36 PM (17 years, 2 months ago)

T. Pachanoi mutants arent that hard to find, you can pretty easily propogate many mutants bu dividing a larger one.  The cested Cereus that I have seen looks like the spines are a little too close together, as well ass too thin to be a trichocereous species.  Oh yeah the flowers on crested cacti can be very profuse... often forming a ridge along parts of the crest, creating many flowers, but dont expect the seeds to be cristate... :bouncysmoke:

Extras: Filter Print Post Top
OfflineNalim
OTD Kelly Girl
Female User Gallery

Registered: 01/13/06
Posts: 15,033
Last seen: 1 year, 5 months
Re: Cereus peruvianus or T. pachanoi mutant? [Re: hooksbooks]
    #6412776 - 12/31/06 05:10 AM (17 years, 2 months ago)

Thnx. :smile:
I know that they are pretty common.
The interest in these that I found is because they are much cheaper than those I've seen on the internet(haven't found them in any stores in my area before :frown:).


--------------------

Rodney Brooks on Robots
Nalim said: "Quoting yourself is retarded."

Extras: Filter Print Post Top
Jump to top Pages: 1

Shop: Kraken Kratom Red Vein Kratom   PhytoExtractum Kratom Powder for Sale   Bridgetown Botanicals CBD Concentrates   Original Sensible Seeds Autoflowering Cannabis Seeds


Similar ThreadsPosterViewsRepliesLast post
* mutant san pedro pichefkes 399 4 02/26/15 08:23 AM
by Lemnaminor
* Picture time: a glimpse in Funkey's garden!!
( 1 2 all )
Funkey 4,344 21 06/15/05 10:44 AM
by Funkey
* Cactus mutant pictures!
( 1 2 3 4 5 6 all )
intelligentlife 17,170 108 10/20/14 03:14 PM
by Dclay
* Just Wanna Show Of My New San Pedro Crest!
( 1 2 all )
Dezzy 4,018 29 12/06/09 02:51 AM
by Dezzy
* Did I stumble upon a true pachanoi today? Rafiikii 3,011 17 04/05/15 12:55 PM
by SuperFly
* seed, cutting, crest? PhloppyPhrktLz 580 10 05/31/14 02:21 PM
by PhloppyPhrktLz
* Pachanoi Crest Repot. Cactusdan 1,039 12 12/16/09 09:44 PM
by Cactusdan
* ID: real pachanoi, or a mutt ? islanduniverse 1,609 17 07/28/13 04:36 PM
by intelligentlife

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: Mostly_Harmless, A.k.a
1,945 topic views. 2 members, 5 guests and 7 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2024 Mind Media. Some rights reserved.

Generated in 0.021 seconds spending 0.004 seconds on 12 queries.