Home | Community | Message Board

Magic-Mushrooms-Shop.com
This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Shop: Kraken Kratom Red Vein Kratom   Original Sensible Seeds Autoflowering Cannabis Seeds, Bulk Cannabis Seeds

Jump to first unread post Pages: 1
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
Offlinegooddrugguy
Male

Registered: 08/15/06
Posts: 527
Loc: Subjectiville
Last seen: 1 month, 23 days
Laced With??
    #5965919 - 08/15/06 12:01 PM (17 years, 5 months ago)

The other night I was rolling with a friend (third time ever to roll) at his house. The experience was so-so, and very much what I had come to expect from ecstasy. It was later that night, after I had headed home, that I decided to smoke a quick bowl to aid with the comedown. I was heartbroken to find that the only bud I had in the house was less than a g of compact, dry regs. Assuming that this was low-quality weed, I loaded it all into a bowl and preceded to smoke it. The taste and smell of the stuff was very unfamiliar, but at the time I thought little of it; dirty weed, dirty taste. Thirty minutes later I was starting at myself in the mirror making faces. I had a full-blown psychedelic experience. Walls rippled, patterns formed; the alley behind my house became a running stream. A loose vine transformed into the shadow of the Pink Panther doing cabaret. The visuals were very similar to shrooms or LSD, but the mental and body high was not present. No shudders, no looped thought, no deep and prolific epiphany . All in all, my mind felt numb. This may have been from exhaustion or the X, but I had little of the mental effects that come with shrooms and acid. My question is: what the hell happened? X-Weed combo gone psychedelic? Laced weed? Flashback? The whole experience lasted maybe 7 or 8 hours, not including the ecstasy. Any ideas?


Extras: Filter Print Post Top
InvisibleDark_Star
train driver pervading a desktop
Male User Gallery

Registered: 08/20/04
Posts: 31,859
Loc: Uranus
Re: Laced With?? [Re: gooddrugguy]
    #5965933 - 08/15/06 12:05 PM (17 years, 5 months ago)

X is psychedelic in a way, as is marijuana....combining the two can lead to a very psychedelic experience. That's what you experienced. No worries my friend.


--------------------


Extras: Filter Print Post Top
InvisibleBiG_StroOnZ
Male User Gallery

Registered: 04/19/06
Posts: 3,323
Re: Laced With?? [Re: Dark_Star]
    #5965975 - 08/15/06 12:18 PM (17 years, 5 months ago)

Haha yah man, welcome to the world of rolling. If you pop a really good pill and smoke some dank buds it can send you to the stars just as easy as shroomin can. You just had some MDMA in your system and proceded to smoke a bowl, where you then saw the affect of doing so.

It's definitley great, there are many ways to experience MDMA. From the Club scene to a nice spiritual healing with some good bud and a pill alone at home or even with a special someone.

E is powerful fun. :smile:


Edited by BiG_StroOnZ (08/15/06 12:19 PM)


Extras: Filter Print Post Top
InvisibleDark_Star
train driver pervading a desktop
Male User Gallery

Registered: 08/20/04
Posts: 31,859
Loc: Uranus
Re: Laced With?? [Re: BiG_StroOnZ]
    #5966102 - 08/15/06 01:01 PM (17 years, 5 months ago)

Yeah I love E, it's the 3rd most healing drug (After LSD & DMT) that I have ever done....and I've done a lot of them. Moderation is key though.


--------------------


Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: Laced With?? [Re: Dark_Star]
    #5966156 - 08/15/06 01:30 PM (17 years, 5 months ago)

The pill also could've been MDA rather than MDMA.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Extras: Filter Print Post Top
Offlinegooddrugguy
Male

Registered: 08/15/06
Posts: 527
Loc: Subjectiville
Last seen: 1 month, 23 days
Re: Laced With?? [Re: Koala Koolio]
    #5966217 - 08/15/06 01:56 PM (17 years, 5 months ago)

It was a white crown, but I know little more. I have done E before, and every time I have done it I have smoked afterwards to help with the comedown. This last time I did it was the least effective ecstasy and dirtiest weed, but when I combined the two I got a serious psychedelic experience. Before the E would give me a good body high, and when I would smoke afterwards (ususally high-quality stuff), I would feel good, but the visuals were no where near this last experience. Why this time, with the least-effective E and cheapest bud did I get such an intense reaction?


Extras: Filter Print Post Top
InvisibleDark_Star
train driver pervading a desktop
Male User Gallery

Registered: 08/20/04
Posts: 31,859
Loc: Uranus
Re: Laced With?? [Re: gooddrugguy]
    #5966256 - 08/15/06 02:13 PM (17 years, 5 months ago)

Describe the effect of this E if you can, perhaps that'll give us a better idea of what it contained.


--------------------


Extras: Filter Print Post Top
Offlineimpgl
CrimethINCspecial agent
 User Gallery
Registered: 02/07/06
Posts: 2,462
Loc: california!
Last seen: 7 years, 4 months
Re: Laced With?? [Re: Dark_Star]
    #5966300 - 08/15/06 02:29 PM (17 years, 5 months ago)

www.pillreports.com    look for around a couple of weeks from now (datewise) , see if you could find your white crowns. try n make sure theyre from the same area. also, if you live in  cali or the South, a lot of the pills are "mysteriously" the same. when you blazed, did you get a tingly sensation in you thighs? cause thats what i usually get when i blaze on the come down. if the pill was cut with 2cb or some other drug, (first of all...... BUY AS MANY AS YOU CAN  :naughty: ), you woulda felt it while rolling. if you smoke good weed all the time, then some times regs get you way high, imo. thats why i used to switch it up when i smoked.


Extras: Filter Print Post Top
Offlinegooddrugguy
Male

Registered: 08/15/06
Posts: 527
Loc: Subjectiville
Last seen: 1 month, 23 days
Re: Laced With?? [Re: Dark_Star]
    #5966313 - 08/15/06 02:33 PM (17 years, 5 months ago)

The effects of the E were minimal, if present at all. I felt slight euphoria and an ok body high, but no rushes and no altered thought. It was pretty much just like a light E high. After the bowl, though, everything I touched felt great, but I was pretty mentally disconnected the entire time. It is the strongest visual psychedelic experience I have ever had: I looked at myself in the mirror and my image was severly altered; I became a demon if a smiled or a monkey if I frowned. Any moving light had some tracers, and shadows and clouds would become faces and objects. It all looked very much like an acid trip, but mentally I really wasnt there. I have never done ketamine or PCP, but the dissociation described in trip reports is the only real way I can compare it. Then again, it was 6 or 7 in the morning, and I could have just been mentally exhausted. I did have an SSRI in my system, but that I mostly just blame the weak E experience on, not the hallucinations.


Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: Laced With?? [Re: impgl]
    #5966361 - 08/15/06 02:46 PM (17 years, 5 months ago)

Quote:

impgl said:
www.pillreports.comif the pill was cut with 2cb or some other drug




Or as some of us would say: A 2C-B pill cut with MDMA. :smile:


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Extras: Filter Print Post Top
Offlinetwiggedoubt
twigburst
Male User Gallery

Registered: 10/10/01
Posts: 2,387
Last seen: 16 years, 8 months
Re: Laced With?? [Re: Koala Koolio]
    #5967013 - 08/15/06 06:00 PM (17 years, 5 months ago)

MDA and MDMA feel very simular, though they are obviously different. I have seen shit on both substances, and your description sounds like mixing weed and e.


Extras: Filter Print Post Top
Jump to top Pages: 1

Shop: Kraken Kratom Red Vein Kratom   Original Sensible Seeds Autoflowering Cannabis Seeds, Bulk Cannabis Seeds


Similar ThreadsPosterViewsRepliesLast post
* weed laced with household chemicals?
( 1 2 3 4 all )
drunkgoat 13,244 65 05/12/09 01:42 AM
by redenbacher
* Very weird MJ experience ?!
( 1 2 3 all )
MattEx 3,530 52 01/28/05 05:22 AM
by Vertigo6911
* Smoked Laced Marijuana
( 1 2 3 all )
Chaos_ult 7,018 53 03/04/05 10:06 AM
by Locus
* Question about mushrooms being laced with LSD or PCP MtnMan437 16,955 15 02/13/05 05:21 PM
by LilShank
* Ecstasy Slang Ravus 2,619 17 05/15/06 04:16 PM
by wiggles
* How do ppl lace MJ and other drugs?
( 1 2 all )
hpnotiq 3,080 36 01/03/05 10:48 PM
by Dark_Star
* laced shrooms Sucellos 1,407 11 01/31/05 10:37 PM
by incubaby_421
* Practical use of Learys Psychedelic Experience and psytrance Psiledehysp 2,552 12 01/18/06 07:25 AM
by psychedelix

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: psilocybinjunkie, Rose, mushboy, LogicaL Chaos, Northerner, bodhisatta
1,041 topic views. 1 members, 45 guests and 20 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2024 Mind Media. Some rights reserved.

Generated in 0.021 seconds spending 0.004 seconds on 12 queries.