Home | Community | Message Board

Sporeworks
This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Shop: Kraken Kratom Red Vein Kratom   Left Coast Kratom Buy Kratom Capsules   PhytoExtractum Kratom Powder for Sale

Jump to first unread post Pages: 1
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
OfflineCaRnAgECaNdYS
Tool's groupie
Female User Gallery

Registered: 04/09/04
Posts: 11,505
Loc: Billy Howerdel's closet Flag
Last seen: 6 months, 23 days
I'm lost
    #5950316 - 08/10/06 11:52 AM (17 years, 5 months ago)

Where is the link for the list of vendors?


--------------------

The secret to being funny is to say smart things stupidly, or is it stupid things smartly? Whatever..it's not rocket surgery...or something like that.


Extras: Filter Print Post Top
InvisibleJaeger
Dreamer
Registered: 10/01/05
Posts: 960
Re: I'm lost [Re: CaRnAgECaNdY]
    #5950321 - 08/10/06 11:54 AM (17 years, 5 months ago)



Extras: Filter Print Post Top
OfflineCaRnAgECaNdYS
Tool's groupie
Female User Gallery

Registered: 04/09/04
Posts: 11,505
Loc: Billy Howerdel's closet Flag
Last seen: 6 months, 23 days
Re: I'm lost [Re: Jaeger]
    #5950332 - 08/10/06 11:57 AM (17 years, 5 months ago)

Thank you. Where did you find that?


--------------------

The secret to being funny is to say smart things stupidly, or is it stupid things smartly? Whatever..it's not rocket surgery...or something like that.


Extras: Filter Print Post Top
InvisibleRoadkillM
Retired Shroomery Mod
Male User Gallery

Registered: 12/11/01
Posts: 22,674
Loc: Montana
Re: I'm lost [Re: CaRnAgECaNdY]
    #5950351 - 08/10/06 12:02 PM (17 years, 5 months ago)

Quote:

Desiree said:

Thank you. Where did you find that?




look up at the banner ad above this thread...

and just under the banner is the link!~


click on the...please support our sponsors

that is a link to...

http://www.shroomery.org/sponsors.php



tc


--------------------
Laterz, Road

Who the hell you callin crazy?
You wouldn't know what crazy was if Charles Manson was eating froot loops on your front porch!


Brainiac said:
PM the names with on there names, that means they have mushrooms for sale.



Extras: Filter Print Post Top
OfflineCaRnAgECaNdYS
Tool's groupie
Female User Gallery

Registered: 04/09/04
Posts: 11,505
Loc: Billy Howerdel's closet Flag
Last seen: 6 months, 23 days
Re: I'm lost [Re: Roadkill]
    #5950545 - 08/10/06 01:01 PM (17 years, 5 months ago)

I don't see any ad?!
:confused:
Now I am lost. :frown:


--------------------

The secret to being funny is to say smart things stupidly, or is it stupid things smartly? Whatever..it's not rocket surgery...or something like that.


Extras: Filter Print Post Top
InvisibleRoadkillM
Retired Shroomery Mod
Male User Gallery

Registered: 12/11/01
Posts: 22,674
Loc: Montana
Re: I'm lost [Re: CaRnAgECaNdY]
    #5950796 - 08/10/06 02:37 PM (17 years, 5 months ago)

top of the page...

under the banner!~


lolzz


--------------------
Laterz, Road

Who the hell you callin crazy?
You wouldn't know what crazy was if Charles Manson was eating froot loops on your front porch!


Brainiac said:
PM the names with on there names, that means they have mushrooms for sale.



Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: I'm lost [Re: Roadkill]
    #5951696 - 08/10/06 07:20 PM (17 years, 5 months ago)

If you're a "supporter" which I am not... my apologies... :wink:

Can't you disable the ads? That's probably the issue.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Extras: Filter Print Post Top
OfflineCaRnAgECaNdYS
Tool's groupie
Female User Gallery

Registered: 04/09/04
Posts: 11,505
Loc: Billy Howerdel's closet Flag
Last seen: 6 months, 23 days
Re: I'm lost [Re: Koala Koolio]
    #5952341 - 08/10/06 10:46 PM (17 years, 5 months ago)

Yes, I am a supporter and I have,in fact....disabled the ads.


--------------------

The secret to being funny is to say smart things stupidly, or is it stupid things smartly? Whatever..it's not rocket surgery...or something like that.


Extras: Filter Print Post Top
OfflineCaRnAgECaNdYS
Tool's groupie
Female User Gallery

Registered: 04/09/04
Posts: 11,505
Loc: Billy Howerdel's closet Flag
Last seen: 6 months, 23 days
Re: I'm lost [Re: Roadkill]
    #5952344 - 08/10/06 10:47 PM (17 years, 5 months ago)

Thanks for laughing at me. :tongue:

I just went and bookmarked the page since I DON'T HAVE BANNER ADS!!


--------------------

The secret to being funny is to say smart things stupidly, or is it stupid things smartly? Whatever..it's not rocket surgery...or something like that.


Extras: Filter Print Post Top
Invisiblemonstermitch
Growing in Bags Doesn't Work

Folding@home Statistics
Registered: 02/10/06
Posts: 3,911
Loc: Arizona Bay Flag
Re: I'm lost [Re: CaRnAgECaNdY]
    #5952617 - 08/10/06 11:46 PM (17 years, 5 months ago)

Go to: Main Site

click on any dot by a shroom, say community for example

in the toolbar under Community:

Links ->

(click) commerce

at the bottom of the commerce page:

Shroomery Sponsors

there you go girl.


--------------------



Extras: Filter Print Post Top
Offlinedoodoomaster
Life's still good
Male User Gallery

Registered: 06/02/06
Posts: 393
Loc: The united states of Gene...
Last seen: 14 years, 1 month
Re: I'm lost [Re: monstermitch]
    #5957809 - 08/12/06 10:23 PM (17 years, 5 months ago)

Some firewall settings will block that link as well.


--------------------
For all you passive aggressive types.  Fuck you, kind of.


Extras: Filter Print Post Top
Jump to top Pages: 1

Shop: Kraken Kratom Red Vein Kratom   Left Coast Kratom Buy Kratom Capsules   PhytoExtractum Kratom Powder for Sale


Similar ThreadsPosterViewsRepliesLast post
* "Rock the vote" a sponsor? Mephestopheles 1,014 6 10/04/04 07:11 PM
by motaman
* Shroomery Sponsor List HSIHd 3,905 5 12/09/06 09:15 AM
by Roadkill
* On Becoming a Sponsor DiMiTriSouljah 1,391 3 03/02/05 04:16 PM
by Ripple
* List of sponsors with links. OOKLA 787 3 11/10/05 12:51 PM
by lid
* to all the sponsors! alpiner 2,674 9 06/01/04 05:18 PM
by DaPimp
* Hey Sponsors jamman 3,067 13 05/07/06 01:50 AM
by foomanchu
* *VOTE* Should STP Be A Sponsor/Vendor Here?
( 1 2 3 4 all )
TM 21,836 69 08/16/02 04:19 PM
by ChromeCrow
* New banner, your votes please **CONTEST**
( 1 2 3 4 all )
Una 5,847 64 03/04/02 04:24 AM
by Una

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: geokills, motaman
846 topic views. 0 members, 3 guests and 2 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2024 Mind Media. Some rights reserved.

Generated in 0.026 seconds spending 0.007 seconds on 14 queries.