|
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
|
CaRnAgECaNdY
Tool's groupie


Registered: 04/09/04
Posts: 11,505
Loc: Billy Howerdel's closet
Last seen: 6 months, 23 days
|
I'm lost
#5950316 - 08/10/06 11:52 AM (17 years, 5 months ago) |
|
|
Where is the link for the list of vendors?
--------------------
The secret to being funny is to say smart things stupidly, or is it stupid things smartly? Whatever..it's not rocket surgery...or something like that.
|
Jaeger
Dreamer
Registered: 10/01/05
Posts: 960
|
|
|
CaRnAgECaNdY
Tool's groupie


Registered: 04/09/04
Posts: 11,505
Loc: Billy Howerdel's closet
Last seen: 6 months, 23 days
|
Re: I'm lost [Re: Jaeger]
#5950332 - 08/10/06 11:57 AM (17 years, 5 months ago) |
|
|
Thank you. Where did you find that?
--------------------
The secret to being funny is to say smart things stupidly, or is it stupid things smartly? Whatever..it's not rocket surgery...or something like that.
|
Roadkill
Retired Shroomery Mod


Registered: 12/11/01
Posts: 22,674
Loc: Montana
|
|
Quote:
Desiree said:
Thank you. Where did you find that?
look up at the banner ad above this thread...
and just under the banner is the link!~
click on the...please support our sponsors
that is a link to...
http://www.shroomery.org/sponsors.php
tc
-------------------- Laterz, Road Who the hell you callin crazy? You wouldn't know what crazy was if Charles Manson was eating froot loops on your front porch! Brainiac said: PM the names with on there names, that means they have mushrooms for sale.
|
CaRnAgECaNdY
Tool's groupie


Registered: 04/09/04
Posts: 11,505
Loc: Billy Howerdel's closet
Last seen: 6 months, 23 days
|
Re: I'm lost [Re: Roadkill]
#5950545 - 08/10/06 01:01 PM (17 years, 5 months ago) |
|
|
I don't see any ad?!
 Now I am lost.
--------------------
The secret to being funny is to say smart things stupidly, or is it stupid things smartly? Whatever..it's not rocket surgery...or something like that.
|
Roadkill
Retired Shroomery Mod


Registered: 12/11/01
Posts: 22,674
Loc: Montana
|
|
top of the page...
under the banner!~
lolzz
-------------------- Laterz, Road Who the hell you callin crazy? You wouldn't know what crazy was if Charles Manson was eating froot loops on your front porch! Brainiac said: PM the names with on there names, that means they have mushrooms for sale.
|
Koala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
|
Re: I'm lost [Re: Roadkill]
#5951696 - 08/10/06 07:20 PM (17 years, 5 months ago) |
|
|
If you're a "supporter" which I am not... my apologies... 
Can't you disable the ads? That's probably the issue.
-------------------- You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!
|
CaRnAgECaNdY
Tool's groupie


Registered: 04/09/04
Posts: 11,505
Loc: Billy Howerdel's closet
Last seen: 6 months, 23 days
|
|
Yes, I am a supporter and I have,in fact....disabled the ads.
--------------------
The secret to being funny is to say smart things stupidly, or is it stupid things smartly? Whatever..it's not rocket surgery...or something like that.
|
CaRnAgECaNdY
Tool's groupie


Registered: 04/09/04
Posts: 11,505
Loc: Billy Howerdel's closet
Last seen: 6 months, 23 days
|
Re: I'm lost [Re: Roadkill]
#5952344 - 08/10/06 10:47 PM (17 years, 5 months ago) |
|
|
Thanks for laughing at me. 
I just went and bookmarked the page since I DON'T HAVE BANNER ADS!!
--------------------
The secret to being funny is to say smart things stupidly, or is it stupid things smartly? Whatever..it's not rocket surgery...or something like that.
|
monstermitch
Growing in Bags Doesn't Work


Registered: 02/10/06
Posts: 3,911
Loc: Arizona Bay
|
|
Go to: Main Site
click on any dot by a shroom, say community for example
in the toolbar under Community:
Links ->
(click) commerce
at the bottom of the commerce page:
Shroomery Sponsors
there you go girl.
--------------------
|
doodoomaster
Life's still good


Registered: 06/02/06
Posts: 393
Loc: The united states of Gene...
Last seen: 14 years, 1 month
|
|
Some firewall settings will block that link as well.
-------------------- For all you passive aggressive types. Fuck you, kind of.
|
|