Home | Community | Message Board

Avalon Magic Plants
This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Shop: Kraken Kratom Red Vein Kratom   Original Sensible Seeds Autoflowering Cannabis Seeds, Bulk Cannabis Seeds

Jump to first unread post Pages: 1
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
OfflineCptnGarden
fuck this site
Registered: 05/13/04
Posts: 11,945
Last seen: 14 years, 9 months
WTF set acid on fire?
    #5934525 - 08/05/06 12:55 PM (17 years, 5 months ago)

.


Edited by ShroomieOfDoomie (10/26/06 01:12 AM)


Extras: Filter Print Post Top
Invisible8374837
a fun guy

Registered: 06/27/06
Posts: 181
Loc: the dark side of the moon
Re: WTF set acid on fire? [Re: CptnGarden]
    #5934616 - 08/05/06 01:20 PM (17 years, 5 months ago)

what a fucking waste, i would have just taken it to see if it was good.


--------------------
"There are three side effects of acid: enhanced long-term memory, decreased short-term memory, and I forget the third."-the man in the middle


Extras: Filter Print Post Top
InvisibleUnderNose
all out of bubble gum
 User Gallery

Registered: 03/04/06
Posts: 1,612
Re: WTF set acid on fire? [Re: CptnGarden]
    #5934619 - 08/05/06 01:21 PM (17 years, 5 months ago)

I hope you bitch smacked him.

Look at LSD under a black light it should glow.

I have never heard of burning it, Even from people I know that have liquid


--------------------
LAGM 2.022

:dna::dna:


Extras: Filter Print Post Top
OfflineDrCubensis
Male

Registered: 07/03/05
Posts: 321
Last seen: 8 years, 10 months
Re: WTF set acid on fire? [Re: 8374837]
    #5934626 - 08/05/06 01:22 PM (17 years, 5 months ago)

I have read here in shroomery (no remember where) that if you burn some rc's on blotter it should smell like sulfur... is it that way?

although he can also test it with marquis test, lsd is colorless and rc's should show some color.

Regards.


--------------------

"Ever tried. Ever failed. Never mind. Try again. Fail again. Fail better." Samuel Beckett.


Extras: Filter Print Post Top
InvisiblethatiAM
Stranger

Registered: 06/14/06
Posts: 1,250
Re: WTF set acid on fire? [Re: DrCubensis]
    #5934754 - 08/05/06 02:08 PM (17 years, 5 months ago)

Seems like kinda a waste to me, acid is pretty special.  I woulda just eaten it :smile: Yum yum yum acid in my tum tum tum makes me happy, happy happy!

Flowers in her hair (In her hair)
Flowers everywhere (Everywhere)
I love the flower girl (I love the flower girl)
Oh, I don't know just why
She simply caught my eye
I love the flower girl (I love the flower girl)
She seemed so sweet and kind
She creeped into my mind (To my mind, to my mind)

I knew I had to say hello (Hello, hello)
She smiled up at me (Hello, how do you do)
And she took my hand
And we walked through the park alone.

But I knew
(I knew, I knew, I knew, I knew)
She had made me happy


But uhh, yeah.


Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: WTF set acid on fire? [Re: thatiAM]
    #5934782 - 08/05/06 02:19 PM (17 years, 5 months ago)

"Look at LSD under a black light it should glow."

As will most white paper.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Extras: Filter Print Post Top
Offlinehabitat0789
Insomniac
Male

Folding@home Statistics
Registered: 03/09/06
Posts: 1,029
Last seen: 13 years, 5 months
Re: WTF set acid on fire? [Re: Koala Koolio]
    #5934885 - 08/05/06 02:56 PM (17 years, 5 months ago)

that kinda shows you the difference between people who sell drugs and people who love them...


--------------------

ilove my woods...


Extras: Filter Print Post Top
InvisibleUnderNose
all out of bubble gum
 User Gallery

Registered: 03/04/06
Posts: 1,612
Re: WTF set acid on fire? [Re: Koala Koolio]
    #5934891 - 08/05/06 03:01 PM (17 years, 5 months ago)

Quote:

Koala Koolio said:
"Look at LSD under a black light it should glow."

As will most white paper.




As will liquid LSD
http://www.erowid.org/ask/ask.cgi?ID=3013
Take that


--------------------
LAGM 2.022

:dna::dna:


Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: WTF set acid on fire? [Re: UnderNose]
    #5935042 - 08/05/06 04:37 PM (17 years, 5 months ago)

Quote:

UnderNose said:
Quote:

Koala Koolio said:
"Look at LSD under a black light it should glow."

As will most white paper.




As will liquid LSD
http://www.erowid.org/ask/ask.cgi?ID=3013
Take that




As will white blotter without LSD on it.

I didn't mean to say that LSD doesn't glow. I thought that'd be clear with the "as will", meaning that in addition to LSD glowing, most white paper (easily the most common kind of blotter currently) will glow even if there is DOB, or nothing on it at all.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Extras: Filter Print Post Top
OfflineCptnGarden
fuck this site
Registered: 05/13/04
Posts: 11,945
Last seen: 14 years, 9 months
Re: WTF set acid on fire? [Re: Koala Koolio]
    #5935046 - 08/05/06 04:38 PM (17 years, 5 months ago)

the blotter was perf'd binder paper :lol: , but this person is experienced with lucy and said it is still good stuff.


Extras: Filter Print Post Top
OfflineCptnGarden
fuck this site
Registered: 05/13/04
Posts: 11,945
Last seen: 14 years, 9 months
Re: WTF set acid on fire? [Re: CptnGarden]
    #5935050 - 08/05/06 04:40 PM (17 years, 5 months ago)

my question was, in LSD flammable? I watched it go from no reaction to looking like someone threw gasoline or something on it. POOF, like when your cooking something and the oil catches fire, nothing to POOF in a millisecond.


Extras: Filter Print Post Top
Offlineyageman
already dead
 User Gallery

Registered: 01/26/06
Posts: 4,965
Last seen: 14 years, 9 months
Re: WTF set acid on fire? [Re: CptnGarden]
    #5935177 - 08/05/06 06:21 PM (17 years, 5 months ago)

My guess is that most paper acid does not go "poof". Even if lsd was flammable

The idea that burning lsd will help you know if it is good sort of blows my mind. Mainly because I have had many types of paper lsd and I know some of them would just burn evenly like paper. Mainly because of the amount of lsd that fits on the head of a pin. A good full hit can fit on such a small space.
If you use that amount of gasoline 50-100 ugs on a piece of blotter paper, it wont go "poof".

I have a hard time believing that this is a good way to test your tabs even if it was somewhat true. Tabs come on a few different types of paper. Some great acid is layed on ridiculously thin paper. Paper that would burn very quickly and evenly.


--------------------
[quote]Me_Roy said:
You moron. Material is material is material.  No 'thing' fixes any situation.  If anything were so simple we would be living in a much better world.[/quote] <-----the dumbest thing I have ever read in my life.
Thanks shroomery.


Extras: Filter Print Post Top
OfflineEraserhead
Lost Soul
Male User Gallery

Registered: 05/26/06
Posts: 1,363
Loc: Earth
Last seen: 14 years, 3 months
Re: WTF set acid on fire? [Re: Koala Koolio]
    #5935196 - 08/05/06 06:32 PM (17 years, 5 months ago)

Quote:

Koala Koolio said:
Quote:

UnderNose said:
Quote:

Koala Koolio said:
"Look at LSD under a black light it should glow."

As will most white paper.




As will liquid LSD
http://www.erowid.org/ask/ask.cgi?ID=3013
Take that




As will white blotter without LSD on it.

I didn't mean to say that LSD doesn't glow. I thought that'd be clear with the "as will", meaning that in addition to LSD glowing, most white paper (easily the most common kind of blotter currently) will glow even if there is DOB, or nothing on it at all.




Urine glows too! Mabey it has LSD in it?


--------------------


Extras: Filter Print Post Top
OfflineCptnGarden
fuck this site
Registered: 05/13/04
Posts: 11,945
Last seen: 14 years, 9 months
Re: WTF set acid on fire? [Re: yageman]
    #5935198 - 08/05/06 06:32 PM (17 years, 5 months ago)

it looked like it wasnt gonna burn at all but then instantly cumbusted.

I really haven't seen this done b4, but then again, how many of you have tried this before?

I have no clue to how or why, but it interests me.


Extras: Filter Print Post Top
Offlinedeadheadjpc2000
Blade
Male

Registered: 02/27/06
Posts: 1,277
Loc: Emerald Triangle, U.S.A.
Last seen: 15 years, 6 months
Re: WTF set acid on fire? [Re: CptnGarden]
    #5935379 - 08/05/06 08:15 PM (17 years, 5 months ago)

I used to get sheets " Right Off The Bus " at Dead shows( for $70-80!!). They were still wet, no doubt from being layed 15 ft from me.
As the crystals are dissolved in an easily-evaporating solution before being layed, or dipped, as it were, this solution can be highly flammable( the possibility is there). So if the guy JUST layed them, then maybe.
Still no indication of actual content. I would question his technique for purity. The Only way..
Get a hit or 2 and taste-test!!

BTW- When I was much younger, and had lots to play with, I put 2 hits in my metal pipe. Burned like normal paper, no poof or anything. And, of course, no effects. This was tested 2-hit-shit orally. Had to try!! Ahh, to be young agian...
Peace and G/L!! :laugh:


Extras: Filter Print Post Top
OfflineEdgekrusher
God
Registered: 10/10/05
Posts: 674
Last seen: 17 years, 1 month
Re: WTF set acid on fire? [Re: Eraserhead]
    #5935406 - 08/05/06 08:31 PM (17 years, 5 months ago)

Quote:

Eraserhead said:
Quote:

Koala Koolio said:
Quote:

UnderNose said:
Quote:

Koala Koolio said:
"Look at LSD under a black light it should glow."

As will most white paper.




As will liquid LSD
http://www.erowid.org/ask/ask.cgi?ID=3013
Take that




As will white blotter without LSD on it.

I didn't mean to say that LSD doesn't glow. I thought that'd be clear with the "as will", meaning that in addition to LSD glowing, most white paper (easily the most common kind of blotter currently) will glow even if there is DOB, or nothing on it at all.




Urine glows too! Mabey it has LSD in it?




Nope... I just tried to light my piss on fire and only got my hand all wet. Deffinitely not acid. But my weed deffinitely burns... a surefire sign it's potent?


Extras: Filter Print Post Top
Offlinehippie_cune
Nowhere Man
Registered: 06/13/06
Posts: 166
Last seen: 16 years, 4 months
Re: WTF set acid on fire? [Re: Edgekrusher]
    #5935444 - 08/05/06 09:01 PM (17 years, 5 months ago)

tell him if he wants to test any more acid to send it my way..

ill tell ya.


Extras: Filter Print Post Top
Offlineyageman
already dead
 User Gallery

Registered: 01/26/06
Posts: 4,965
Last seen: 14 years, 9 months
Re: WTF set acid on fire? [Re: hippie_cune]
    #5935533 - 08/05/06 09:52 PM (17 years, 5 months ago)

I have had many types of paper lsd and I know some of them would just burn evenly like paper. Mainly because of the amount of lsd that fits on the head of a pin. A good full hit can fit on such a small space.
If you use that amount of gasoline 50-100 ugs on a piece of blotter paper, it wont go "poof". It just wont.....

I have a hard time believing that this is a good way to test your tabs even if it was somewhat true. Tabs come on a few different types of paper. Some great acid is layed on ridiculously thin paper. Paper that would burn very quickly and evenly. Its not a good way to tell if you have real acid.........

I have not burned any lsd because thats just stupid.....or atleast in my opinion......

Why doesnt someone try to set a vial worth on fire. It might react a tiny bit, but if its good liquid it probably wont. Lsd is VERY likely NOT flammable in the way you described. I have not tried to burn any hits though. If I did im pretty sure most of them would not go "poof".

As far as blacklights used to test paper acid, thats just not a good indicator even if lsd does glow.


--------------------
[quote]Me_Roy said:
You moron. Material is material is material.  No 'thing' fixes any situation.  If anything were so simple we would be living in a much better world.[/quote] <-----the dumbest thing I have ever read in my life.
Thanks shroomery.


Edited by yageman (08/05/06 10:16 PM)


Extras: Filter Print Post Top
OfflineEraserhead
Lost Soul
Male User Gallery

Registered: 05/26/06
Posts: 1,363
Loc: Earth
Last seen: 14 years, 3 months
Re: WTF set acid on fire? [Re: Edgekrusher]
    #5936289 - 08/06/06 06:33 AM (17 years, 5 months ago)

No dude, I said it glows, not it combusts...

try a blacklight in the bathroom next time you go potty, just don't try to potty on the blacklight, at least not while it's plugged in.


--------------------


Extras: Filter Print Post Top
Jump to top Pages: 1

Shop: Kraken Kratom Red Vein Kratom   Original Sensible Seeds Autoflowering Cannabis Seeds, Bulk Cannabis Seeds


Similar ThreadsPosterViewsRepliesLast post
* Good Acid 4369875 1,804 17 09/03/04 04:06 PM
by 4369875
* Re: first time acid tripper Anonymous 4,284 8 12/15/99 02:47 PM
by Anonymous
* acid visuals [smile]
( 1 2 all )
HB 8,264 22 09/24/01 09:32 PM
by Anonymous
* Secrets Of An Acid Head - An Essay Jackal 6,733 13 07/30/13 04:56 AM
by Ghostofbillhicks
* Acid Idea's Marshmallow 1,884 17 01/30/04 11:13 PM
by Vulture
* Acid glows pink under blacklight clownbaby 5,029 18 10/26/06 08:21 PM
by palmersc
* Blacklight Acid DaZeDmerlin 1,915 17 10/04/06 09:01 PM
by Koala Koolio
* Testing LSD with a Blacklight??? superbob57 7,643 12 06/28/17 01:54 PM
by sourc3d

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: psilocybinjunkie, Rose, mushboy, LogicaL Chaos, Northerner, bodhisatta
2,883 topic views. 0 members, 49 guests and 19 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2024 Mind Media. Some rights reserved.

Generated in 0.051 seconds spending 0.031 seconds on 14 queries.