Home | Community | Message Board

Mycohaus
This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Shop: Original Sensible Seeds Bulk Cannabis Seeds   North Spore North Spore Mushroom Grow Kits & Cultivation Supplies   PhytoExtractum Buy Bali Kratom Powder   Kraken Kratom Red Vein Kratom

Jump to first unread post Pages: 1 | 2 | Next >  [ show all ]
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
OfflinePhishe
Lysergic Bliss
Male User Gallery

Registered: 01/21/06
Posts: 2,908
Loc: Planet Earth
Last seen: 11 years, 4 months
'LSD makes you dumb'
    #5907447 - 07/27/06 11:46 PM (17 years, 6 months ago)

So today, i was hanging out with some friends when a friend makes a statement about acid. He says 'you know, I just found out that acid makes you dumb, I never knew that.' Well this got me arguing that this doesn't really happen. No one would really agree with me and another one brought up that he was "sure it kills brain cells".

Anyone want to back me up that this is not true? Or it is not as extreme as they think...

Also the friend that brought this up has tried acid.

I know that LSD is dangerous and a risk on the mind, but i would have never thought in this way.


Extras: Filter Print Post Top
Offlinechris92346
Stranger
Registered: 09/10/05
Posts: 436
Last seen: 14 years, 12 days
Re: 'LSD makes you dumb' [Re: Phishe]
    #5907514 - 07/28/06 12:07 AM (17 years, 6 months ago)

Just throw it back at him... ask him to back his shit up and show you some research... don't just accept what a friend of a friend said.


Extras: Filter Print Post Top
InvisibleMushouse
Mycomancer

Registered: 06/26/06
Posts: 500
Re: 'LSD makes you dumb' [Re: chris92346]
    #5907527 - 07/28/06 12:13 AM (17 years, 6 months ago)

Ask them to tell their DARE officers that I said "hi."


Edited by Mushouse (07/28/06 12:29 AM)


Extras: Filter Print Post Top
Offlineanonymous123
Peope AreStrange
Male

Registered: 02/20/06
Posts: 619
Last seen: 10 years, 11 months
Re: 'LSD makes you dumb' [Re: Mushouse]
    #5907547 - 07/28/06 12:22 AM (17 years, 6 months ago)

what i hate most about DARE is that they go to schools and talk to kids and the kids are like thanks so much for telling me the danger of drugs. 5 years later the kids are experimenting with drugs, which i think is a part of life, and DARE thinks they actually did something.


Extras: Filter Print Post Top
Invisibleredgreenvines
irregular verb
 User Gallery

Registered: 04/08/04
Posts: 37,532
Re: 'LSD makes you dumb' [Re: anonymous123]
    #5907902 - 07/28/06 03:16 AM (17 years, 6 months ago)

I gurantee it doesn't make you dumb.
unfortunately some people actually are dumb to begin with, I mean we all fluctuate a bit.
But I am often astonished at how extensive this can be.
it can't really be helped:
Really dumb people can still be functional and even enjoy flashes of mental brilliance!
(I know that sounds ridiculous but even dogs occasionally glow with cleverness and mental energy)
we just have to be nice, and include them without worrying about the consistency of their capacity to decode meaning.

and that is the absolute most elitist thing I will say ever.


--------------------
:confused: _ :brainfart:🧠  _ :finger:


Extras: Filter Print Post Top
OfflineDeathCompany
Oneironaut
Male User Gallery

Registered: 03/16/05
Posts: 12,662
Loc: Somewhere in my head
Last seen: 9 months, 29 days
Re: 'LSD makes you dumb' [Re: redgreenvines]
    #5907918 - 07/28/06 03:30 AM (17 years, 6 months ago)

Quote:

redgreenvines said:
I gurantee it doesn't make you dumb.
unfortunately some people actually are dumb to begin with, I mean we all fluctuate a bit.
But I am often astonished at how extensive this can be.
it can't really be helped:
Really dumb people can still be functional and even enjoy flashes of mental brilliance!
(I know that sounds ridiculous but even dogs occasionally glow with cleverness and mental energy)
we just have to be nice, and include them without worrying about the consistency of their capacity to decode meaning.

and that is the absolute most elitist thing I will say ever.




:thumbup: :thumbup: :thumbup: :thumbup: :thumbup:


--------------------


Extras: Filter Print Post Top
OfflineLightShedder
Trading currencies
 User Gallery

Registered: 08/30/05
Posts: 3,026
Loc: AustinDenverLA
Last seen: 4 years, 7 months
Re: 'LSD makes you dumb' [Re: DeathCompany]
    #5910445 - 07/28/06 10:43 PM (17 years, 6 months ago)

I heard that it can turn you into a bottle of OJ too. Dis one time i ate some trips man and I saw like Mario running around tellin me to go kill my parents... it was CRAZY FOOL!

(just kidding)


--------------------


Extras: Filter Print Post Top
InvisibleDark_Star
train driver pervading a desktop
Male User Gallery

Registered: 08/20/04
Posts: 31,859
Loc: Uranus
Re: 'LSD makes you dumb' [Re: Phishe]
    #5944324 - 08/08/06 02:29 PM (17 years, 5 months ago)

Actually, it's the opposite....I've found that I learn more, grow more, advance more.....get SMARTER thanks to LSD. Some people are so indoctrinated by the anti-drug hysteria lies that they'll never listen, even when you present them with hard evidence. I've always found it baffling & sad that some people ignore this research, and more so that they ignore personal experience stories, and believe that they know more about something they've never done then someone who's done it. What bullshit.


--------------------


Extras: Filter Print Post Top
OfflineHerbus
...

Registered: 10/19/04
Posts: 1,477
Loc: Reading the map...
Last seen: 10 years, 23 days
Re: 'LSD makes you dumb' [Re: Phishe]
    #5944355 - 08/08/06 02:46 PM (17 years, 5 months ago)

Don't mind these people. If you continue to be inquisitive on the matter you'll quickly realize the extent of their knowledge...

First, ask them "What brain cells are destroyed?" Of course they're most likely not going to know, ask them if the cells are damaged permenantly. They might tell you how brain cells can't come back, like many "officers" of "the Law" might explain...

So why does the word neurogenesis exist in the english dictionary? Explain that LSD-25 works on selective receptor sites within the serotonergic receptor system, and does so as an agonist. LSD "tricks" said sites by being similiar in chemical structure to the intended molecule. Later, it is metabolized (somewhat, right? I'm not sure here.) and excreted. No apparent damage is known to occur.

Then go ahead and remind them, since more than likely they enjoy drinking, that alcohol is a very pervasive molecule and pervades pretty much every region of the body (including the brain) and literally "fucks up" the cells contained within.


--------------------
...


Extras: Filter Print Post Top
InvisibleHank, FTW
Looking for the Answer

Registered: 05/04/06
Posts: 3,912
Re: 'LSD makes you dumb' [Re: Herbus]
    #5944380 - 08/08/06 02:55 PM (17 years, 5 months ago)

My mother is convinced it was her lsd use in the 70's that created the legions on her brain that showed up in an MRI scan she took. I have never heard evidence to support this, but I am not sure where else these legions would have come from. Is this possible? or were they created by something else you think?


--------------------
Capliberty:

"I'll blow the hinges off your freakin doors with my trips, level 5 been there, I personally like x, bud, acid and shroom oj, altogether, do that combination, and you'll meet some morbid figures, lol
Hell yeah I push the limits and hell yeah thats fucking cool, dope, bad ass and all that, I'm not changing shit, I'm cutting to to the chase and giving u shroom experience report. Real trippers aren't afraid to go beyond there comfort zone "

:rofl:


Extras: Filter Print Post Top
OfflinePSylopHiLe
stoner
Male User Gallery

Registered: 06/04/06
Posts: 86
Last seen: 17 years, 1 month
Re: 'LSD makes you dumb' [Re: anonymous123]
    #5944398 - 08/08/06 03:00 PM (17 years, 5 months ago)

Quote:

dunnen said:
what i hate most about DARE is that they go to schools and talk to kids and the kids are like thanks so much for telling me the danger of drugs. 5 years later the kids are experimenting with drugs, which i think is a part of life, and DARE thinks they actually did something.



Thank you DARE :mushroom2:


--------------------
"Try not to let your mind wander, it might not come back"


Extras: Filter Print Post Top
OfflinePSylopHiLe
stoner
Male User Gallery

Registered: 06/04/06
Posts: 86
Last seen: 17 years, 1 month
Re: 'LSD makes you dumb' [Re: Dark_Star]
    #5944403 - 08/08/06 03:02 PM (17 years, 5 months ago)

Quote:

Dark_Star said:
Actually, it's the opposite....I've found that I learn more, grow more, advance more.....get SMARTER thanks to LSD. Some people are so indoctrinated by the anti-drug hysteria lies that they'll never listen, even when you present them with hard evidence. I've always found it baffling & sad that some people ignore this research, and more so that they ignore personal experience stories, and believe that they know more about something they've never done then someone who's done it. What bullshit.



amen


--------------------
"Try not to let your mind wander, it might not come back"


Extras: Filter Print Post Top
Invisibleredgreenvines
irregular verb
 User Gallery

Registered: 04/08/04
Posts: 37,532
Re: 'LSD makes you dumb' [Re: Hank, FTW]
    #5944509 - 08/08/06 03:28 PM (17 years, 5 months ago)

Quote:

alpharedecho said:
My mother is convinced it was her lsd use in the 70's that created the legions on her brain that showed up in an MRI scan she took. I have never heard evidence to support this, but I am not sure where else these legions would have come from. Is this possible? or were they created by something else you think?




lesions
not legions
legions are fighting troops
lesions are ripped torn or damaged tissues.
no way lsd makes lesions in brain.

she may have suffered impact damage or
she may have early onset alzheimers

every one (with lsd or not) loses 1000's of brain cells per day, meantime, hundreds grow larger with new connections penetrating the space that the unused dying cells leave.

lots of mis-information in this area and lots of incomplete analysis too.
brain cells have to die - those would be normally the ones that are not being used. Connections can tunnel through the space left by dying cells.
if you make no new connects then you can get lesions in the left over space.
you could say that not learning anything is associated with growing lesions, but that also is an over simplification of the alzheimers process.


--------------------
:confused: _ :brainfart:🧠  _ :finger:


Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: 'LSD makes you dumb' [Re: redgreenvines]
    #5944534 - 08/08/06 03:35 PM (17 years, 5 months ago)

Indeed, there is no evidence of LSD causing lesions. Ketamine and PCP and DXM are often considered to be potentially responsible for lesions, though the jury is still out on whether or not that is true for humans. Still might be worth asking her what else she experiemented with. But immediately jumping to any recreational drug used decades ago is a bit silly. I'm curious if she is legitimately convinced this is true, or if she simply thinks it's possible, and wants you to think so too.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Extras: Filter Print Post Top
InvisibleFixer
Unconventional
Male User Gallery

Registered: 07/24/06
Posts: 306
Loc: Northeast, USA
Re: 'LSD makes you dumb' [Re: Phishe]
    #5944584 - 08/08/06 03:50 PM (17 years, 5 months ago)

It's been 29 years since I used LSD and I used it frequently from the ages of 13-17, over 100 times. I don't believe it made me dumb. I became willing to take intellectual risks that I wouldn't have taken previously, and challenge things I wouldn't have challenged before. My self-discovery was incredibly enhanced as well, and I grew from the experiences and conquered personal fears. Nevertheless, it slowed down my processing speed and ability and I got to the point that I would sometimes forget what I was saying mid-sentence. It had no effect on whether I would understand something difficult that I was reading or something like that. But I still find linking a string of subjects which build on each other a conscious chore whereas before I was able to intellectually picture and link each step spontaneously. I stopped because I knew it was causing the slow down. Perhaps I used it too frequently.


Extras: Filter Print Post Top
OfflineEraserhead
Lost Soul
Male User Gallery

Registered: 05/26/06
Posts: 1,363
Loc: Earth
Last seen: 14 years, 3 months
Re: 'LSD makes you dumb' [Re: redgreenvines]
    #5945259 - 08/08/06 07:04 PM (17 years, 5 months ago)

Quote:

redgreenvines said:
Quote:

alpharedecho said:
My mother is convinced it was her lsd use in the 70's that created the legions on her brain that showed up in an MRI scan she took. I have never heard evidence to support this, but I am not sure where else these legions would have come from. Is this possible? or were they created by something else you think?




lesions
not legions
legions are fighting troops
lesions are ripped torn or damaged tissues.
no way lsd makes lesions in brain.




I don't know about that, I've had a few trips where I thought there were legions on my brain....
they usually dissipated with the end of the trip tho, I doubt they'd stick around for an MRI scan to detect them....
I'm defiantly highly convinced LSD causes legions on the brain...


--------------------


Extras: Filter Print Post Top
Offlinewortiesbo
Male

Registered: 03/18/06
Posts: 866
Loc: new vegas
Last seen: 6 years, 9 days
Re: 'LSD makes you dumb' [Re: Eraserhead]
    #5945311 - 08/08/06 07:17 PM (17 years, 5 months ago)

Quote:

Eraserhead said:
Quote:

redgreenvines said:
Quote:

alpharedecho said:
My mother is convinced it was her lsd use in the 70's that created the legions on her brain that showed up in an MRI scan she took. I have never heard evidence to support this, but I am not sure where else these legions would have come from. Is this possible? or were they created by something else you think?




lesions
not legions
legions are fighting troops
lesions are ripped torn or damaged tissues.
no way lsd makes lesions in brain.




I don't know about that, I've had a few trips where I thought there were legions on my brain....
they usually dissipated with the end of the trip tho, I doubt they'd stick around for an MRI scan to detect them....
I'm defiantly highly convinced LSD causes legions on the brain...


they are talking about real lesions silly  :wink:


--------------------


Extras: Filter Print Post Top
Invisibleredgreenvines
irregular verb
 User Gallery

Registered: 04/08/04
Posts: 37,532
Re: 'LSD makes you dumb' [Re: Eraserhead]
    #5946556 - 08/09/06 04:38 AM (17 years, 5 months ago)

Quote:

Eraserhead said:
Quote:

redgreenvines said:
Quote:

alpharedecho said:
My mother is convinced it was her lsd use in the 70's that created the legions on her brain that showed up in an MRI scan she took. I have never heard evidence to support this, but I am not sure where else these legions would have come from. Is this possible? or were they created by something else you think?




lesions
not legions
legions are fighting troops
lesions are ripped torn or damaged tissues.
no way lsd makes lesions in brain.




I don't know about that, I've had a few trips where I thought there were legions on my brain....
they usually dissipated with the end of the trip tho, I doubt they'd stick around for an MRI scan to detect them....
I'm defiantly highly convinced LSD causes legions on the brain...



funny that you put it that way.
I get the same impression as well.
but mri's are not tuned to the ephemeral holographic resonance patterns as they fleetingly march through the busy streets of the mind.


--------------------
:confused: _ :brainfart:🧠  _ :finger:


Extras: Filter Print Post Top
InvisibleHank, FTW
Looking for the Answer

Registered: 05/04/06
Posts: 3,912
Re: 'LSD makes you dumb' [Re: redgreenvines]
    #5946905 - 08/09/06 09:59 AM (17 years, 5 months ago)

Quote:

redgreenvines said:
Quote:

Eraserhead said:
Quote:

redgreenvines said:
Quote:

alpharedecho said:
My mother is convinced it was her lsd use in the 70's that created the legions on her brain that showed up in an MRI scan she took. I have never heard evidence to support this, but I am not sure where else these legions would have come from. Is this possible? or were they created by something else you think?




lesions
not legions
legions are fighting troops
lesions are ripped torn or damaged tissues.
no way lsd makes lesions in brain.




I don't know about that, I've had a few trips where I thought there were legions on my brain....
they usually dissipated with the end of the trip tho, I doubt they'd stick around for an MRI scan to detect them....
I'm defiantly highly convinced LSD causes legions on the brain...



funny that you put it that way.
I get the same impression as well.
but mri's are not tuned to the ephemeral holographic resonance patterns as they fleetingly march through the busy streets of the mind.




LOL okay wise guys....anyway, she was probably just trying to scare me away from trying it. She knows I haven't tried it yet, and want to in the future.


--------------------
Capliberty:

"I'll blow the hinges off your freakin doors with my trips, level 5 been there, I personally like x, bud, acid and shroom oj, altogether, do that combination, and you'll meet some morbid figures, lol
Hell yeah I push the limits and hell yeah thats fucking cool, dope, bad ass and all that, I'm not changing shit, I'm cutting to to the chase and giving u shroom experience report. Real trippers aren't afraid to go beyond there comfort zone "

:rofl:


Extras: Filter Print Post Top
InvisibleUnderNose
all out of bubble gum
 User Gallery

Registered: 03/04/06
Posts: 1,612
Re: 'LSD makes you dumb' [Re: Hank, FTW]
    #5946943 - 08/09/06 10:14 AM (17 years, 5 months ago)

Quote:

alpharedecho said:
Quote:

redgreenvines said:
Quote:

Eraserhead said:
Quote:

redgreenvines said:
Quote:

alpharedecho said:
My mother is convinced it was her lsd use in the 70's that created the legions on her brain that showed up in an MRI scan she took. I have never heard evidence to support this, but I am not sure where else these legions would have come from. Is this possible? or were they created by something else you think?




lesions
not legions
legions are fighting troops
lesions are ripped torn or damaged tissues.
no way lsd makes lesions in brain.




I don't know about that, I've had a few trips where I thought there were legions on my brain....
they usually dissipated with the end of the trip tho, I doubt they'd stick around for an MRI scan to detect them....
I'm defiantly highly convinced LSD causes legions on the brain...



funny that you put it that way.
I get the same impression as well.
but mri's are not tuned to the ephemeral holographic resonance patterns as they fleetingly march through the busy streets of the mind.




LOL okay wise guys....anyway, she was probably just trying to scare me away from trying it. She knows I haven't tried it yet, and want to in the future.




LSD won't make you stupid.
LSD can't cause lesions.
LSD does enhance creativity which can lead to stupid rumors.
Now there is one more.
OMFG


--------------------
LAGM 2.022

:dna::dna:


Extras: Filter Print Post Top
Jump to top Pages: 1 | 2 | Next >  [ show all ]

Shop: Original Sensible Seeds Bulk Cannabis Seeds   North Spore North Spore Mushroom Grow Kits & Cultivation Supplies   PhytoExtractum Buy Bali Kratom Powder   Kraken Kratom Red Vein Kratom


Similar ThreadsPosterViewsRepliesLast post
* Re: -<>- LSD OVERDOSE -<>-
( 1 2 all )
skareo 11,650 37 04/13/01 09:48 AM
by Kid
* Can one empathically affect liquid LSD?
( 1 2 3 4 5 6 all )
BlueMeanie25 14,505 109 09/11/18 12:48 PM
by heatlessbbq
* Captain Al Hubbard, Johnny Appleseed of LSD LearyfanS 7,898 7 11/08/17 04:34 PM
by NOUS333
* Post deleted by Anno
( 1 2 all )
AnnoA 3,805 24 05/11/01 05:43 PM
by Mitchnast
* Does more low quality LSD = high quality LSD?
( 1 2 3 4 all )
LearyfanS 23,830 74 02/03/21 10:50 PM
by Typerwritermonky
* Shrooms vs LSD...how different are they?
( 1 2 all )
Boppity604 22,405 26 07/01/02 04:05 PM
by Anonymous
* lsd, 'shrooms and ocd anonymous_dude 5,966 9 08/04/02 06:58 AM
by NewHunter
* Shrooms make you Schizoid?
( 1 2 all )
ThorA 9,550 31 06/30/01 12:15 AM
by Pynchon

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: psilocybinjunkie, Rose, mushboy, LogicaL Chaos, Northerner, bodhisatta
7,267 topic views. 3 members, 37 guests and 7 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2024 Mind Media. Some rights reserved.

Generated in 0.021 seconds spending 0.004 seconds on 14 queries.