Home | Community | Message Board

Sporeworks
This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Shop: Kraken Kratom Kratom Capsules for Sale   PhytoExtractum Buy Bali Kratom Powder   North Spore North Spore Mushroom Grow Kits & Cultivation Supplies   Left Coast Kratom Buy Kratom Extract   Unfolding Nature Unfolding Nature: Being in the Implicate Order   Original Sensible Seeds Autoflowering Cannabis Seeds

Jump to first unread post Pages: 1 | 2 | 3 | 4 | 5  [ show all ]
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
OfflineTelepylus
Babyman
 User Gallery

Registered: 05/22/06
Posts: 996
Loc: Seattle
Last seen: 17 years, 3 months
have you ever slipped someone acid?
    #5755456 - 06/15/06 09:59 PM (17 years, 7 months ago)

me and my ex-wife use to trip alot together, but then, after awhile she just didn't like it anymore and quit doing it.

but sometimes i would sneak some in her food, lol.


have you ever done that to anyone?


i think it's funny.


Extras: Filter Print Post Top
Offlinestemmer
Stranger
 User Gallery

Registered: 09/08/05
Posts: 2,672
Last seen: 17 years, 6 months
Re: have you ever slipped someone acid? [Re: Telepylus]
    #5755470 - 06/15/06 10:03 PM (17 years, 7 months ago)

No you fucking doink.

Wouldnt do that to anybody.

Youre a shmuck...........and I hope your kidding after making such a shitty post.  :rolleyes:

I really dont know what it takes to be as stupid as yourself.  That certainly is pathetic, and I feel sorry for her you douchebag.


Edited by stemmer (06/15/06 10:06 PM)


Extras: Filter Print Post Top
Offlinestemmer
Stranger
 User Gallery

Registered: 09/08/05
Posts: 2,672
Last seen: 17 years, 6 months
Re: have you ever slipped someone acid? [Re: stemmer]
    #5755489 - 06/15/06 10:09 PM (17 years, 7 months ago)

No, im going to troll and call you a shitty person who doesnt respect psychedelics.

NO really!!! You simple little shit. I dont care if I get banned for saying that. You are one very sad kid..........


Extras: Filter Print Post Top
Offlinemellowrubberduck
NDE on 7/8/06
Male User Gallery

Registered: 06/11/06
Posts: 241
Loc: Pennsylvania, USA
Last seen: 14 years, 4 months
Re: have you ever slipped someone acid? [Re: stemmer]
    #5755497 - 06/15/06 10:12 PM (17 years, 7 months ago)

I wouldn't mind if someone slipped me some acid, shit's too hard to find around here. Everyone that used to be around is in jail.


Extras: Filter Print Post Top
OfflineTelepylus
Babyman
 User Gallery

Registered: 05/22/06
Posts: 996
Loc: Seattle
Last seen: 17 years, 3 months
Re: have you ever slipped someone acid? [Re: mellowrubberduck]
    #5755508 - 06/15/06 10:17 PM (17 years, 7 months ago)

i wish someone would slip me some acid

that'd be great.


one time my brother was trippin on mescaline for 3 days
and he just wanted to come down
and someone slipped him acid, and that wasn't cool


but my wife didn't really mind

it was good for her

she needed it

in fact, i'll go one further, and say
I THINK THE WHOLE WORLD NEEDS TO BE SLIPPED SOME ACID.


and, i think anyone who's actually done acid would agree.


Extras: Filter Print Post Top
OfflineTelepylus
Babyman
 User Gallery

Registered: 05/22/06
Posts: 996
Loc: Seattle
Last seen: 17 years, 3 months
Re: have you ever slipped someone acid? [Re: Telepylus]
    #5755517 - 06/15/06 10:18 PM (17 years, 7 months ago)

ooo, i have a horror story too.

one time i was at this rainbow gathering, back in the day when you could get sheets for 50 bucks.

but, this is sad, some deadhead slipped this little baby acid, and it went into convulsions.
shit like that is bad, i agree.

but slipping a hit of acid to an old time acid head-
that's just doin' them a favor.


Extras: Filter Print Post Top
InvisibleAlteredAgain
Visual Alchemist
 User Gallery

Registered: 04/27/06
Posts: 11,181
Loc: Solar Circuit
Re: have you ever slipped someone acid? [Re: Telepylus]
    #5755554 - 06/15/06 10:31 PM (17 years, 7 months ago)

Quote:

Telepylus said:
I THINK THE WHOLE WORLD NEEDS TO BE SLIPPED SOME ACID.





sometimes a grandiose cultural shock is required to isolate defective belief systems and replace them with blank slates of possibility.

:mushroom2:


--------------------


Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: have you ever slipped someone acid? [Re: Telepylus]
    #5755572 - 06/15/06 10:35 PM (17 years, 7 months ago)

Don't be a dipshit.

Anyone who believes the whole world needs to be (without knowing) slipped acid needs to lay off the fucking drugs.

You are *not* going to get a good response from this site on the subject of slipping people drugs without them knowing.

"but slipping a hit of acid to an old time acid head-
that's just doin' them a favor. "

Okay, that's one thing. But you said she stopped doing it because she didn't like it. What the fuck is wrong with you? Just because someone did something in the past, the lose their free will?

"Oh yeah, he was an alcoholic for years anyway. I mean, he went to rehab and quit, but I slipped him some vodka. Shit, I mean he used to do it anyway."

Just because there are situations where you'll luck out and the person will be happy with the trip doesn't mean it's the right thing to do.

And this doesn't even seem like one of those cases. "but my wife didn't really mind" Didn't really? That means she's nice enough not to fucking slap you. If she liked it, you would've said so.

"it was good for her
she needed it"
According to... you? You are scum.

We can all judge the situations where it's okay to slip somebody some. Like, if you and a group of friends trip a lot... a carefree summer with little responsibility, no job to sober up for right away, etc. When the person is already thinking, "man... I could go for some acid!" and would be pleasantly surprised by a trip out of the blue. There are times when I would be cool with that, if a very close friend knew the time was right. But there are times in my life where the last thing I want to do is trip. If someone forced me to do it then? I would probably never speak to them again, or beat the shit out of them depending on how badly they 'inconvenienced' me.

Also, if your brother was tripping on mescaline for a few days, it was because he kept taking more and more mescaline. Please don't try to explain to us that he had a 3 day mescaline trip from a single dose. No one here is stupid enough to believe that.

If you're going to post stupid shit like this again, look for the countless other tools who get bashed for talking about dosing people and animals against their will on substances.

You're a disgrace to the community.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Extras: Filter Print Post Top
OfflineTelepylus
Babyman
 User Gallery

Registered: 05/22/06
Posts: 996
Loc: Seattle
Last seen: 17 years, 3 months
Re: have you ever slipped someone acid? [Re: Koala Koolio]
    #5755580 - 06/15/06 10:37 PM (17 years, 7 months ago)

wow.

i never knew you guys were so against peace and love and enlightenment.

yea, you bet your ass i'm leaving this community.


laters


Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: have you ever slipped someone acid? [Re: Telepylus]
    #5755603 - 06/15/06 10:43 PM (17 years, 7 months ago)

Yeah, nothing like a forced coinflip between peave love enlightment, or pure terror and hell. Who the hell are you to pretend that the psychedelic experience is subjectively positive for everyone at anytime, so long as they dose some acid?


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Extras: Filter Print Post Top
Offlinemellowrubberduck
NDE on 7/8/06
Male User Gallery

Registered: 06/11/06
Posts: 241
Loc: Pennsylvania, USA
Last seen: 14 years, 4 months
Re: have you ever slipped someone acid? [Re: Koala Koolio]
    #5755641 - 06/15/06 10:59 PM (17 years, 7 months ago)

I'm not quite sure that the internet is the place that people to look to to be convinced by other people that their own idea is garbage. If you really think about it, things can be taken out of context because it's hard to portray emphasis in speech with text. But if what was said was meant, what's the big deal? It's just an idea, an expression, not something that's gonna truly be done. Millions of people in the next couple days aren't gonna be given acid unknowingly, no epidemic is here. Relax. Thoughts are thoughts.


Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: have you ever slipped someone acid? [Re: mellowrubberduck]
    #5755743 - 06/15/06 11:29 PM (17 years, 7 months ago)

What the hell are you talking about? Of the little bit of your post that contained any content, you're suggesting that his post is simply text, with no connection to reality? Words represents ideas, yes, and in this case, actions. I'm not sure what kind of emphasis you want to use to spin "I dosed my wife without her knowing", but I'd like to hear some form that changes the meaning.

What does the lack of an epidemic have to do with anything? How is that remotely on topic? What does the frequency of these actions have to do with the morality of them?


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Extras: Filter Print Post Top
Offlinemellowrubberduck
NDE on 7/8/06
Male User Gallery

Registered: 06/11/06
Posts: 241
Loc: Pennsylvania, USA
Last seen: 14 years, 4 months
Re: have you ever slipped someone acid? [Re: Koala Koolio]
    #5755772 - 06/15/06 11:39 PM (17 years, 7 months ago)

Excuse me if you would, but obviously I failed to portray my ideas clearly. Since he posted more than once, and correct me if I'm wrong, are you suggesting that I said he *didn't* dose his wife? In his second one or whatever, he said it was bad to slip it to just *anyone*, which means a conscience does exist. And yes, discretion probably could be used and from what I got from it was the implication of slipping the acid. Hopefully that clears things up, but if not, that's the last out of me. Well, come to think of it, it was never said that his brother tripped on mescaline three days on one dose. But if he did mean that, forgive me, but I read just as much as you did but came up with an entirely different conclusion. Goodnight.


Extras: Filter Print Post Top
OfflineMr_Brown
Regulator

Registered: 06/07/06
Posts: 49
Last seen: 17 years, 6 months
Re: have you ever slipped someone acid? [Re: Koala Koolio]
    #5755773 - 06/15/06 11:39 PM (17 years, 7 months ago)

Slipping people drugs is wrong. Koala you are making many good points but you are still coming off like an asshole. Take it down a notch. Dont be so cliche with mad ranting flames on an internet chat. Dont insult people who havent insulted you.


Extras: Filter Print Post Top
InvisibleRhysaboveit
Day Tripper
Female

Registered: 05/26/06
Posts: 218
Loc: Miami Fl
Re: have you ever slipped someone acid? [Re: mellowrubberduck]
    #5755780 - 06/15/06 11:41 PM (17 years, 7 months ago)

Yes, its just an idea/thought.
But its not a very good one.

I can understand the idea " alot of people could benefit from doing acid" but not EVERYONE.

I can understand what someone said above about close friends, carefree summer and a dose.

but if you quit, you quit for a reason and its not fair for someone to force it on you IMO.


--------------------
No point in mentioning these bats, I thought. Poor bastard will see them soon enough

"There's a uh, big machine in the sky, some kind of, I dunno, electric snake, coming straight at us."
"Shoot it."
"Not yet, I want to study its habits. "


Extras: Filter Print Post Top
Offlinestemmer
Stranger
 User Gallery

Registered: 09/08/05
Posts: 2,672
Last seen: 17 years, 6 months
Re: have you ever slipped someone acid? [Re: Rhysaboveit]
    #5755825 - 06/16/06 12:00 AM (17 years, 7 months ago)

Koala Koolio hit the nail on the head.

Its no discussion. Id be the instant asshole in real life to.

Not "just text" HAHA

No acid for anyone who didnt want it. If you gave it to me or any metally ill person you almost deserve to be stoned to death.

So dont blame Koala K for making a good point.


Edited by stemmer (06/16/06 12:03 AM)


Extras: Filter Print Post Top
OfflineMr_Brown
Regulator

Registered: 06/07/06
Posts: 49
Last seen: 17 years, 6 months
Re: have you ever slipped someone acid? [Re: Mr_Brown]
    #5755829 - 06/16/06 12:03 AM (17 years, 7 months ago)

I bet. After you were such a nice guy in the Da Vinci thread. Koala can make his point without jamming it down the threadstarters throat.


Edited by Mr_Brown (06/16/06 12:21 AM)


Extras: Filter Print Post Top
Offlinestemmer
Stranger
 User Gallery

Registered: 09/08/05
Posts: 2,672
Last seen: 17 years, 6 months
Re: have you ever slipped someone acid? [Re: Mr_Brown]
    #5755832 - 06/16/06 12:05 AM (17 years, 7 months ago)

Thats me.........  The asshole who knows his shit.

Could you have found a thread that had less to do with the price of LSD my little friend???? :rolleyes:

Thats fucking pathetic.  Not as bad as dosing someone though.
To dose someone without there knowing is actually a crime in my mind,  but being an asshole to simple folk like yourself is not.

Everyone should read that thread in which try to make an unrelated example of me by getting off topic.  I was dicussing the price of lsd in the US.  When you buy 500 you get it cheap, that is if you are not getting it in the ass.


Edited by stemmer (06/16/06 12:11 AM)


Extras: Filter Print Post Top
OfflineMr_Brown
Regulator

Registered: 06/07/06
Posts: 49
Last seen: 17 years, 6 months
Re: have you ever slipped someone acid? [Re: stemmer] * 1
    #5755844 - 06/16/06 12:10 AM (17 years, 7 months ago)

Shows how much character you have.


Extras: Filter Print Post Top
Offlinestemmer
Stranger
 User Gallery

Registered: 09/08/05
Posts: 2,672
Last seen: 17 years, 6 months
Re: have you ever slipped someone acid? [Re: Mr_Brown]
    #5755848 - 06/16/06 12:13 AM (17 years, 7 months ago)

You are moron............
This thread is about slipping people lsd, and you turn it into" was or was stemmer not a jerk to some guy for paying 3250 dollars for 500 hits of acid"........

You simple dipshit.
Try to keep the subject intact you vindictive little ninny.


Extras: Filter Print Post Top
InvisibleHanky
wiffle bat.
Male User Gallery
Registered: 08/30/03
Posts: 56,993
Loc: Great Southern Land.
Re: have you ever slipped someone acid? [Re: Telepylus]
    #5755860 - 06/16/06 12:18 AM (17 years, 7 months ago)

Quote:

Telepylus said:
wow.

i never knew you guys were so against peace and love and enlightenment.

yea, you bet your ass i'm leaving this community.


laters




That combined with your first post reminds me why I hate most hippies.


--------------------
Coaster is an idiot...
[quote]Coaster said:
but i thnk everything thats pure is white?
[/quote]




Extras: Filter Print Post Top
Offlinestemmer
Stranger
 User Gallery

Registered: 09/08/05
Posts: 2,672
Last seen: 17 years, 6 months
Re: have you ever slipped someone acid? [Re: Hanky]
    #5755864 - 06/16/06 12:21 AM (17 years, 7 months ago)

ya, its pretty sad.


Extras: Filter Print Post Top
Offlinehippie_cune
Nowhere Man
Registered: 06/13/06
Posts: 166
Last seen: 16 years, 4 months
Re: have you ever slipped someone acid? [Re: stemmer]
    #5755888 - 06/16/06 12:30 AM (17 years, 7 months ago)

the whole world does need to be slipped acid.

no ive never done it..

but we did tell some guys that smokin salvia was like weed.
it was ok cause they were doin it with us right there and then we told them about it when the uncontrolable laughter kicked in.

"oh yeah, its not as much like weed as it is like a 30 sec acid trip that feels like 5 hours."

hahahaha they had fun


Extras: Filter Print Post Top
Offlinestemmer
Stranger
 User Gallery

Registered: 09/08/05
Posts: 2,672
Last seen: 17 years, 6 months
Re: have you ever slipped someone acid? [Re: hippie_cune]
    #5755907 - 06/16/06 12:40 AM (17 years, 7 months ago)

Thats fucked up too.

You dont know how fragile the human brain is obviously. If they didnt ask for it, dont give them ANY dose.

Its sad how the people who claim to know these drugs would fuck with eachothers brain chemistry like that.

A slim few ignorant people would dose anybody, even one person.

Its just a fucked up thing to do. Thats makes you a criminal, and one very sad asshole. If you do that to someone you know NOTHING about hallucinogens.
Even back in the day when I could take massive doses of anything by myself. If someone dosed me like that Id be closer to kicking anyones ass as I ever have been in my life. I would be SO VERY MAD about it.

Fuck all you who push it on other people for kicks.

Ignorant twits.


Edited by stemmer (06/16/06 12:42 AM)


Extras: Filter Print Post Top
OfflineDucky
Governor ofRhythm
Male

Registered: 05/09/06
Posts: 71
Loc: on a boat somewhere
Last seen: 17 years, 5 months
Re: have you ever slipped someone acid? [Re: stemmer]
    #5755923 - 06/16/06 12:46 AM (17 years, 7 months ago)

Telepuss, is it possible you were that baby that went into convulsions and you just want to share your misfortune with everyone else?


--------------------
"Whoa! ...did you just see that too?"


Extras: Filter Print Post Top
InvisibleHanky
wiffle bat.
Male User Gallery
Registered: 08/30/03
Posts: 56,993
Loc: Great Southern Land.
Re: have you ever slipped someone acid? [Re: Ducky]
    #5755925 - 06/16/06 12:48 AM (17 years, 7 months ago)

We know why she's now his EX wife.


--------------------
Coaster is an idiot...
[quote]Coaster said:
but i thnk everything thats pure is white?
[/quote]




Extras: Filter Print Post Top
InvisibleUnderNose
all out of bubble gum
 User Gallery

Registered: 03/04/06
Posts: 1,612
Re: have you ever slipped someone acid? [Re: Hanky]
    #5755961 - 06/16/06 01:02 AM (17 years, 7 months ago)

http://en.wikipedia.org/wiki/MKULTRA

The Deputy Director of the CIA revealed that over 30 universities and institutions were involved in an 'extensive testing and experimentation' program which included covert drug tests on unwitting citizens 'at all social levels, high and low, native Americans and foreign.' Several of these tests involved the administration of LSD to 'unwitting subjects in social situations.' At least one death, that of Dr. Olson, resulted from these activities. The Agency itself acknowledged that these tests made little scientific sense. The agents doing the monitoring were not qualified scientific observers


--------------------
LAGM 2.022

:dna::dna:


Extras: Filter Print Post Top
InvisibleUnderNose
all out of bubble gum
 User Gallery

Registered: 03/04/06
Posts: 1,612
Re: have you ever slipped someone acid? [Re: UnderNose]
    #5755968 - 06/16/06 01:04 AM (17 years, 7 months ago)

Who knows how many people have already been slipped some acid


--------------------
LAGM 2.022

:dna::dna:


Extras: Filter Print Post Top
Offlinestemmer
Stranger
 User Gallery

Registered: 09/08/05
Posts: 2,672
Last seen: 17 years, 6 months
Re: have you ever slipped someone acid? [Re: UnderNose]
    #5755970 - 06/16/06 01:04 AM (17 years, 7 months ago)

Slipping people anything is a no deal in my books.  There is no act in the world that can say how little one knows about hallucinogens.

The fact that anyone can level with this garbage makes me sick.

We always thought it would be funny when I was in college to put a shattered gel tab into the teachers coffee before class and then get to see him run to the nurses office(s) when he started to get all crazy during a lecture.  We never actually did that, though we could have.  I would have known enough about hallucinogens as a junior in highschool to know that that just was not worth the fun.

    SOme people apparently are just that stupid though, and I cant help that.  Good luck treating hallucinogens like candy and slipping it to anyone you please.    :rolleyes:


Extras: Filter Print Post Top
OfflineLysergic_Milkman
Dr. Fist
Male

Registered: 10/21/04
Posts: 1,676
Loc: ATL
Last seen: 7 years, 1 month
Re: have you ever slipped someone acid? [Re: stemmer]
    #5755981 - 06/16/06 01:09 AM (17 years, 7 months ago)

Quote:

mellowrubberduck said:
Excuse me if you would, but obviously I failed to portray my ideas clearly....




that is an admirable thing to say in light of the flaming you received  :smile: :thumbup:. Please stay with our community and contribute to our wealth of knowledge, we need more people like you; this thread does not represent the character of the Shroomery.

Quote:

stemmer said:
Thats me.........  The asshole who knows his shit.





You really think so? I don't want to be the culprit of flaming here, but I want you to know that I could pull up numerous examples confirming your first claim and putting to shame the second.
As a famous philosopher once said (non-verbatim):
"He thought that he knew something, but really he knew nothing. I, however, know nothing, and know that I know nothing. This, I believe, puts me at a distinct advantage."
This is my main philosophy and I live by it every day. I suggest that everyone else do the same.

Please stop this nonsense and have a constructive debate for once. (speaking of nonsense stopping, where are the mod's on this one?)

I do [partially] agree with you, stemmer, in that slipping LSD to unknowing victims is a terrible thing to do. However, you must understand the counter-argument (which I also agree with), which is the 'unwillingness' factor. If one is unknowing as well as unwilling, then there is no doubt that they should be left in peace. But, as was described in the scenario above, there are situations in which a hidden dose of acid can be a good thing.


Edited by Lysergic_Milkman (06/16/06 01:14 AM)


Extras: Filter Print Post Top
Invisiblehoboblues
Male
Registered: 03/26/06
Posts: 610
Re: have you ever slipped someone acid? [Re: Telepylus]
    #5755994 - 06/16/06 01:13 AM (17 years, 7 months ago)

Quote:

Telepylus said:
wow.

i never knew you guys were so against peace and love and enlightenment.

yea, you bet your ass i'm leaving this community.


laters




You sir are a prick.  With your logic, you're no better than Adolf Hitler.  You can't play god.  You don't know what's best for everyone.  Against peace, love, and enlightenment are we?  What about yourself?  You're so at peace with everyone that you have to change them?  What's wrong with diversity?  We sure as hell wouldn't get anything done on this planet with out it.  Yeah, you love, I'm sure, as long as everything is going your way you fucking elitist.  Can we call you Bush?  Bush, how's this for enlightenment.. While your mom was pregnant with you, someone like you spiked her paralament, and no, it wasn't dipped in acid, jack, the word I'm getting to here is crack.

Sorry about that last part.  I've been listening to a lot of Eminem lately.  :laugh:  It's probably not true.


--------------------


Edited by hoboblues (06/16/06 06:54 PM)


Extras: Filter Print Post Top
Offlinestemmer
Stranger
 User Gallery

Registered: 09/08/05
Posts: 2,672
Last seen: 17 years, 6 months
Re: have you ever slipped someone acid? [Re: hoboblues]
    #5756212 - 06/16/06 03:14 AM (17 years, 7 months ago)

Lysergic_Milkman......... that was below the belt.

You are a shame......

This thread is about dosing people without them knowing..

Dosing people without them knowing is a crime.  That is the truth.

So grow up those who cant simply read what someone said and get the simple point. Good lord............ :confused:

Milkman......thanks for the enlightenment!
and thanks for that objective point of view :shocked:

You want a constructive debate given this subject?  Really???????

Well you have my take on it.  Hope you dont go dose some friend for fun...

You have confused me.  Not a big fan of logic ay?


Edited by stemmer (06/16/06 03:30 AM)


Extras: Filter Print Post Top
Offlinechaos05
Stranger

Registered: 08/16/05
Posts: 290
Last seen: 1 year, 10 months
Re: have you ever slipped someone acid? [Re: Telepylus]
    #5756229 - 06/16/06 03:34 AM (17 years, 7 months ago)

You sir are a penis, as are anyone else that in some fucked up logic believes its ok. All I can say I that I pray you get spiked with some extremely nasty research chemical and fry your brains beyond belief.

I cant believe this board lately (yes im a lurker) but the level of chat is that of twelve year olds, who've obviously no idea.

I thought this place was meant to be informative not just plain stupid


Extras: Filter Print Post Top
InvisibleAsante
Mage
Male User Gallery

Registered: 02/06/02
Posts: 86,795
Re: have you ever slipped someone acid? [Re: chaos05]
    #5756240 - 06/16/06 04:02 AM (17 years, 7 months ago)





All please remember that some people's sole pleasure on the internet is to yell something controversial on a forum and sit back with a beer watching the regulars going upset.

Recently the psychology department of Harvard university has done groundbreaking research that demonstrated clearly that these men in fact have no penis.


Giving someone a drug without informed consent, especially a psychedelic able to do psychological damage, is a felony, and to slip it to someone who has stopped using it is not just without consent but also deliberately against their will.

So, what's next?

Will you admit to being a troll and display, despite being devoid of a penis, that you at least have teh gonads to say it like it is, or will you instead defend a lowlife attitude on the sinking ship that is this thread?

My advice is to let this thread blow over in silence and to think your moves through when you want to post another one.


--------------------
Omnicyclion.org
higher knowledge starts here


Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: have you ever slipped someone acid? [Re: Lysergic_Milkman]
    #5756270 - 06/16/06 04:37 AM (17 years, 7 months ago)

Quote:

Lysergic_Milkman said:
Quote:

mellowrubberduck said:
Excuse me if you would, but obviously I failed to portray my ideas clearly....




that is an admirable thing to say in light of the flaming you received  :smile: :thumbup:. Please stay with our community and contribute to our wealth of knowledge, we need more people like you; this thread does not represent the character of the Shroomery.





You're both right that I came off a bit harsh on mr. rubberduck. It was displaced frustration which originated from the original poster, and I apologize. While he made the claim that dosing people without their knowledge can indeed be bad, he dosed someone who quit tripping because she didn't like it. In my opinion, his actions do not show evidence of actually realizing that these actions are wrong, despite being able to pick out certain situations he recognizes as wrong.

Mr Brown:
You can respond the way you best see fit, and I will respond the way I feel appropriate. I'm sorry if I fit an internet cliche for you. Is it really that important? You said I made good points. I posted the way I did knowing the way I would come off and the message was still recieved. He felt the need to slip something down someone's throat, but I guess I needed to jam my response down his for now. (My responses don't fit in peanut butter sandwiches nearly as well as a hit of liquid does :wink: )

As far as this thread representing the character of the shroomery (Milkman), you mean the original post, or the entire thing? I assume the second. I think it represents the site in ways that many threads don't. We've got a situation that is generally looked down upon by members here (my take after having seen a number of these threads), and a whole array of different ways to respond to it, as well as the opinions of the opposing methods. I think it's a nice thread, in that way. Most of us have the same answer, but I'll be damned if we can find the same way to say it.

"But, as was described in the scenario above, there are situations in which a hidden dose of acid can be a good thing."

I don't want to come across as disagreeing with this idea. There's a time, and a place it can be done. My judgement for this situation is on the fact that she quit tripping because she didn't like it, and he said "she needed it". If someone told me I needed a trip, when in a stage of my life where I know I do not, I would explain it to them or shrug it off. If they persisited, I would be frustrated that they can't accept *my* interpretation of my psyche at the moment. If instead of telling me I needed a trip, they decided they'd 'tell me' by putting acid in my food, I would be extremely upset with them. There is no bigger disrespect to me than someone assuming that they know my current consciousness better than myself to this much of an extreme.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Extras: Filter Print Post Top
Invisiblekaniz
That one, overthere.
Male

Registered: 07/23/04
Posts: 4,166
Loc: Ontario
Re: have you ever slipped someone acid? [Re: Koala Koolio]
    #5756354 - 06/16/06 06:02 AM (17 years, 7 months ago)

Heres a story about someone who got slipped acid at a party and didnt know it. I've told this story before. I wasnt at this party myself, and dont know who was responsible for doing it, but I used to know the victem.

- Guy was at a party, having a grand ol time. Never done LSD or shrooms before, maybe smoked a bit of pot and drank a bit.
- Some guys thought "Hey, wouldnt it be funny to slip him some acid?", and put a rather large ammount of LSD into my friends drink
- My friend, then starts to go into a total freakout. Apparently he just totatly lost his shit, total terror trip
- My friend, then dropped off of the face of the earth for about a year. He went to a different school than me (a bunch of my other freinds went to the same school as him though), and they said they'd just see him wandering around the halls, looking spaced, not talking to anyone -- just totaly withdrawn

The kid now has some serious emotional issues, has NEVER been the same since. He may or may not of had some 'mental issues' before he was dosed - but he sure does now.

For awhile, he sort of 'came back' for a bit and started to hangout again, and then after a few years, he dropped off the face of the earth again, and the last a friend of mine saw him, he was wandering around downtown in sandles, eating almonds and refusing to drink anything but maple syrup because he was convinced it gave him the energy he needed. (btw, was the middle of winter - sanldes arnt exactly the most appopiate footwear)

yes, slipping people drugs is funny!


Edited by kaniz (06/16/06 06:03 AM)


Extras: Filter Print Post Top
Offlinesa_mull
Seeker ofKnowledge
Male User Gallery

Registered: 05/24/06
Posts: 144
Loc: IO
Last seen: 6 years, 3 days
Re: have you ever slipped someone acid? [Re: Telepylus]
    #5756379 - 06/16/06 06:32 AM (17 years, 7 months ago)

i think the key words here are....


Quote:

Telepylus said:
my ex-wife




Extras: Filter Print Post Top
Offlinededjam
Electro Penguin
Male

Folding@home Statistics
Registered: 12/14/05
Posts: 2,139
Loc: Moralton, Statesota
Last seen: 12 years, 8 months
Re: have you ever slipped someone acid? [Re: sa_mull]
    #5756486 - 06/16/06 08:02 AM (17 years, 7 months ago)

This just happened the other day...

Guy slipped his g/f acid without her knowing or doing it before.
The go out cruising around the country side, he is sober and just watching her
They get on the interstate and she starts to act kinda strange, but no real problems.
5 minutes later she just started screaming and jumped out the window at 65mph. The guy slams on his breaks and goes and picks up his bloody and almost dead g/f off the road and takes her to the hospital.

As of this morning she was still in a medically induced coma because of the head trauma, and they are pretty sure she is going to have some severe brain damage from hitting the pavement head first at 65mph.

Ask him if it was fun to slip someone acid without them knowing...

Idiots like this are why drugs are and need to remain illegal.


Extras: Filter Print Post Top
InvisibleEntropymancer
 User Gallery
Registered: 07/16/05
Posts: 10,207
Re: have you ever slipped someone acid? [Re: dedjam]
    #5756547 - 06/16/06 08:24 AM (17 years, 7 months ago)

Quote:

gopenguins said:
Idiots like this are why drugs are and need to remain illegal.




Yes, dosing someone without their knowledge is generally wrong, but the fact that people are irresponsible with drugs is no reason to make/keep them illegal. Is it really your government's job to make sure you tie your shoelaces, wipe your ass, look both ways before you cross the street, and always wear your seatbelt (oh wait we already legislated that last one). If you really believe this, I sincerely hope that you aren't a registered voter, and have no children. I ain't down with the government policing my brain.

More related to the original post, my roommate accidentally dosed himself earlier this year. At the back of a box of sugarcubes was one with acid on it (it looked very different from the others due to spending some time in the freezer). Anyway, one morning after drinking a few cups of coffee, he started acting a little off, and said that the coffee was affecting him like a legitimate psychedelic. We both thought he was getting some kind of abnormal reaction from the caffeine he'd drank (he'd proably had 7 or 8 cups of coffee, as I recall). Against his beter jusdgement, he went to his two hour lecture class He managed to sit through most of the class, while things proceeded to get weirder, until he decided he couldn't take it any more and was going to leave early. When he got back home, he was able to enjoy riding the rest of it out, and I remember him saying a couple times "I think this is what it would be like to get randomly dosed with acid." Anyway, a couple months later I was thinking about taking that last acid cube, went looking for it, and figured out what had happened when I saw that it was missing. We both had a good laugh over that one.


Extras: Filter Print Post Top
Offlineva_shroomer
Beginning grower
Male

Registered: 06/04/06
Posts: 135
Loc: Charlottesville
Last seen: 17 years, 5 months
Re: have you ever slipped someone acid? [Re: kaniz]
    #5756606 - 06/16/06 08:59 AM (17 years, 7 months ago)

Quote:

kaniz said:
Heres a story about someone who got slipped acid at a party and didnt know it. I've told this story before. I wasnt at this party myself, and dont know who was responsible for doing it, but I used to know the victem.

- Guy was at a party, having a grand ol time. Never done LSD or shrooms before, maybe smoked a bit of pot and drank a bit.
- Some guys thought "Hey, wouldnt it be funny to slip him some acid?", and put a rather large ammount of LSD into my friends drink
- My friend, then starts to go into a total freakout. Apparently he just totatly lost his shit, total terror trip
- My friend, then dropped off of the face of the earth for about a year. He went to a different school than me (a bunch of my other freinds went to the same school as him though), and they said they'd just see him wandering around the halls, looking spaced, not talking to anyone -- just totaly withdrawn

The kid now has some serious emotional issues, has NEVER been the same since. He may or may not of had some 'mental issues' before he was dosed - but he sure does now.

For awhile, he sort of 'came back' for a bit and started to hangout again, and then after a few years, he dropped off the face of the earth again, and the last a friend of mine saw him, he was wandering around downtown in sandles, eating almonds and refusing to drink anything but maple syrup because he was convinced it gave him the energy he needed. (btw, was the middle of winter - sanldes arnt exactly the most appopiate footwear)

yes, slipping people drugs is funny!




Yeah, that's why it's so despicable to slip people drugs, and especially psychedelics. If you were just sitting there, had never tripped before, and suddenly everything started to breathe and you talk to aliens or whatever . . . what would you think? That can really screw a person up.


--------------------
Do what thou wilt shall be the whole of the law
Love is the law, love under will
--Frater Baphomet


Extras: Filter Print Post Top
OfflineHeadTripVertigo
at least I'm housebroken
Male User Gallery

Folding@home Statistics
Registered: 05/07/06
Posts: 10,788
Last seen: 5 years, 10 months
Re: have you ever slipped someone acid? [Re: stemmer]
    #5756867 - 06/16/06 10:49 AM (17 years, 7 months ago)

Quote:

stemmer said:
Lysergic_Milkman......... that was below the belt.

You are a shame......

This thread is about dosing people without them knowing..

Dosing people without them knowing is a crime.  That is the truth.

So grow up those who cant simply read what someone said and get the simple point. Good lord............ :confused:

Milkman......thanks for the enlightenment!
and thanks for that objective point of view :shocked:

You want a constructive debate given this subject?  Really???????

Well you have my take on it.  Hope you dont go dose some friend for fun...

You have confused me.  Not a big fan of logic ay?



is it just me, or is practically every post you make rather judgemental and unnecessarily harsh and overbearing?  Obviously the OP shouldn't be slipping people drugs without their knowing, but you don't need to flame him and call him an asshole, basically.  he's gone now anyway, so what's your deal?


--------------------
TACOS LIKE A MOTHERFUCKER


Extras: Filter Print Post Top
OfflineLazyCrash
I like gas.
Male User Gallery

Registered: 07/02/05
Posts: 896
Loc: T-Town
Last seen: 9 years, 5 months
Re: have you ever slipped someone acid? [Re: stemmer]
    #5756897 - 06/16/06 11:02 AM (17 years, 7 months ago)

I don't see why everyone has to be such an asshole to this guy. All this flaming, even AFTER he already said he was leaving this community. Jobs done, lay off. Everyone just wants a turn to flame the guy who has no idea how to treat drugs. Its retarded. I agree with the flames, but you guys just come off like asses the way you say it.

Quote:

stemmer said:
You have confused me. Not a big fan of logic ay?




If anyone re-reads this thread, the Da Vinci thread, this guys stream of PMs to me, or if you want to dig back as long as almost a year ago, you will see that Stemmer is the one who is not a fan of logic. All his posts are weighted heavily with emotion, which is totally illogical by definition. Come on, you even admitted you were trolling this guy. For logical purposes I assume?


--------------------
:mallow:


Extras: Filter Print Post Top
Offlinethe_psychonaut
psychonaut
 User Gallery
Registered: 01/09/05
Posts: 394
Last seen: 8 years, 5 months
Re: have you ever slipped someone acid? [Re: LazyCrash]
    #5757146 - 06/16/06 12:31 PM (17 years, 7 months ago)

i never have, but would looooove to dose this one person with like 100 liquid hits unexpectedly. he robbed many of my close friends


--------------------
never be afraid to let your mind explore, just know what you are getting into b4 you jump in the deep end, and do your research on this site and erowid.com


Extras: Filter Print Post Top
OfflineBMArts
Stranger
Registered: 01/07/06
Posts: 215
Last seen: 16 years, 11 months
Re: have you ever slipped someone acid? [Re: the_psychonaut]
    #5757387 - 06/16/06 01:40 PM (17 years, 7 months ago)

A friend of mine who used to be in on the drug scene in the city I (and he as well) come from has told me some crazy stories... one way certain dealers would treat ppl who couldn't pay up was to stuff a 10 strip in their mouths and lock them in the trunk of a car. Drive them out into a dark forest and throw them out of the car and drive off again, leaving them in their state... not few of the ppl who went through this came out somewhat damdged...


--------------------
Everything I post on this board is pure fiction. Nothing in the post above is real. It is all made up...


May the source be with GNU


Extras: Filter Print Post Top
OfflineCody69
Stranger
Registered: 05/03/06
Posts: 110
Last seen: 16 years, 8 months
Re: have you ever slipped someone acid? [Re: HeadTripVertigo]
    #5757410 - 06/16/06 01:46 PM (17 years, 7 months ago)

now we know why she is your ex-wife


Extras: Filter Print Post Top
OfflineIamthewalrus
every evening Idied and everynight I wasreborn
Male User Gallery

Registered: 03/24/04
Posts: 3,744
Loc: Ontario
Last seen: 15 years, 3 months
Re: have you ever slipped someone acid? [Re: Telepylus]
    #5757554 - 06/16/06 02:23 PM (17 years, 7 months ago)

thats pretty sick dude...especially considering that shes your wife and obviously made the decision to not dose


Extras: Filter Print Post Top
OfflineAA2277
Resident DiphHead
Male User Gallery

Registered: 05/06/06
Posts: 699
Last seen: 16 years, 1 month
sorry i couldnt read it all but [Re: Iamthewalrus]
    #5757688 - 06/16/06 03:07 PM (17 years, 7 months ago)

I dont think anyone who hasn't already or who isn't ready to have a good deep look at themselves raw shouldn't be forced too, some people just aren't ready for that, and more power to them.

edit: i dont think i would wish this on anyone who didnt want it, even a drug person. i know what its like to be on the wrong end of a situation like that and its not fun


--------------------


Edited by AA2277 (06/16/06 03:11 PM)


Extras: Filter Print Post Top
InvisibleNoetical
Flip Horrorshow

Registered: 11/28/04
Posts: 9,230
Re: sorry i couldnt read it all but [Re: AA2277]
    #5758046 - 06/16/06 04:49 PM (17 years, 7 months ago)

wafflecopter


Extras: Filter Print Post Top
Offlinestemmer
Stranger
 User Gallery

Registered: 09/08/05
Posts: 2,672
Last seen: 17 years, 6 months
Re: have you ever slipped someone acid? [Re: HeadTripVertigo]
    #5758183 - 06/16/06 05:35 PM (17 years, 7 months ago)

Quote:

HeadTripVertigo said:
Quote:

stemmer said:
Lysergic_Milkman......... that was below the belt.

You are a shame......

This thread is about dosing people without them knowing..

Dosing people without them knowing is a crime.  That is the truth.

So grow up those who cant simply read what someone said and get the simple point. Good lord............ :confused:

Milkman......thanks for the enlightenment!
and thanks for that objective point of view :shocked:

You want a constructive debate given this subject?  Really???????

Well you have my take on it.  Hope you dont go dose some friend for fun...

You have confused me.  Not a big fan of logic ay?



is it just me, or is practically every post you make rather judgemental and unnecessarily harsh and overbearing?  Obviously the OP shouldn't be slipping people drugs without their knowing, but you don't need to flame him and call him an asshole, basically.  he's gone now anyway, so what's your deal?




Sorry id still rather just call him an asshole and be as harsh as I was.  If I was going to flame anyone without provocation it would be that guy and anyone who has a problem with that.
  Its best if dumbasses like himself know they have their head up their ass.  Its just better that way.


So sorry if I offended anyone besides the type of people my bad attitude was actually directed toward.


Edited by stemmer (06/16/06 05:43 PM)


Extras: Filter Print Post Top
OfflineAVShroomer
LSD enthusiast
I'm a teapot User Gallery

Registered: 05/19/03
Posts: 832
Last seen: 7 months, 9 days
Re: have you ever slipped someone acid? [Re: stemmer]
    #5758226 - 06/16/06 05:47 PM (17 years, 7 months ago)

All i have to say to the original poster is that ur a fucking retard. Why would u slip someone drugs thats such a horrible thing to do to sumones.


--------------------


'It's not a war on drugs its a war on personal freedom'
>**My Trip Journal**<


Extras: Filter Print Post Top
OfflineNashbar
just strange.... on drugs
Male User Gallery
Registered: 07/16/05
Posts: 3,536
Loc: strawberry field
Last seen: 6 years, 3 months
Re: have you ever slipped someone acid? [Re: Telepylus]
    #5758240 - 06/16/06 05:52 PM (17 years, 7 months ago)

Quote:

Telepylus said:
one time my brother was trippin on mescaline for 3 days





I call bullshit or shenanigans or whatever.

edit: fine no shenanigans, mescaline is long, 24-36 hours max and that's not tripping though. I'm wrong, whatever, I just wanted join the flame wagon for slipping his wife acid


Edited by Nashbar (06/16/06 06:55 PM)


Extras: Filter Print Post Top
Offlinestemmer
Stranger
 User Gallery

Registered: 09/08/05
Posts: 2,672
Last seen: 17 years, 6 months
Re: have you ever slipped someone acid? [Re: Nashbar]
    #5758260 - 06/16/06 05:59 PM (17 years, 7 months ago)

HAHA......... shenanigans.

Mescaline lasts a long ass time for me, 3 days is a bit much.
For some people the after effects can make it feel like a 2 or 3 day long trip if you take enough of it.


Edited by stemmer (06/16/06 06:00 PM)


Extras: Filter Print Post Top
InvisibleTHE KRAT BARON
one-eyed willie
Registered: 07/08/03
Posts: 42,409
Re: have you ever slipped someone acid? [Re: Telepylus]
    #5758276 - 06/16/06 06:12 PM (17 years, 7 months ago)

IMHO you're a little fucking nutty.

:emo:


--------------------
m00nshine is currently vacationing in Maui. Rumor has it he got rolled by drunken natives and is currently prostituting himself in order to pay for airfare back to the mainland but he's having trouble juggling a hairon addiction. He won't be back for a long while.


Extras: Filter Print Post Top
OfflineNashbar
just strange.... on drugs
Male User Gallery
Registered: 07/16/05
Posts: 3,536
Loc: strawberry field
Last seen: 6 years, 3 months
Re: have you ever slipped someone acid? [Re: THE KRAT BARON]
    #5758375 - 06/16/06 06:56 PM (17 years, 7 months ago)

Quote:

mattzdope said:
you're a little fucking nutty.





like squirrel shit


Extras: Filter Print Post Top
OfflineLysergic_Milkman
Dr. Fist
Male

Registered: 10/21/04
Posts: 1,676
Loc: ATL
Last seen: 7 years, 1 month
Re: have you ever slipped someone acid? [Re: stemmer]
    #5758382 - 06/16/06 06:57 PM (17 years, 7 months ago)

Quote:

stemmer said:
Quote:

HeadTripVertigo said:
Quote:

stemmer said:
Lysergic_Milkman......... that was below the belt.

You are a shame......

This thread is about dosing people without them knowing..

Dosing people without them knowing is a crime.  That is the truth.

So grow up those who cant simply read what someone said and get the simple point. Good lord............ :confused:

Milkman......thanks for the enlightenment!
and thanks for that objective point of view :shocked:

You want a constructive debate given this subject?  Really???????

Well you have my take on it.  Hope you dont go dose some friend for fun...

You have confused me.  Not a big fan of logic ay?



is it just me, or is practically every post you make rather judgemental and unnecessarily harsh and overbearing?  Obviously the OP shouldn't be slipping people drugs without their knowing, but you don't need to flame him and call him an asshole, basically.  he's gone now anyway, so what's your deal?




Sorry id still rather just call him an asshole and be as harsh as I was.  If I was going to flame anyone without provocation it would be that guy and anyone who has a problem with that.
  Its best if dumbasses like himself know they have their head up their ass.  Its just better that way.


So sorry if I offended anyone besides the type of people my bad attitude was actually directed toward. 




Hold on... are you calling me an asshole?
well, I'm sorry to disappoint you, but I did't find yourpost offensive at all.
Go ahead and blow some steam on me if it makes you feel better, that is what I'm here for after all.

Also, the 'above scenario' that I was referring to was not the original post, but rather the post about slipping a friendsome acid who would be willing and is planning on having a good time in a peaceful setting anyway. However, on further reflection, I feel that it would be better just to tell them that you have a few hits for them instead of going off and making it a big surprise.


Extras: Filter Print Post Top
Invisibletruekimbo2
Cya later, friends.
Male User Gallery

Registered: 12/08/02
Posts: 9,234
Loc: ny Flag
Re: have you ever slipped someone acid? [Re: Lysergic_Milkman]
    #5758562 - 06/16/06 08:06 PM (17 years, 7 months ago)

i agree this person should be repeatedly flamed, so that anyone reading this thread understands how serious it is. this thread should be stickied and should become 500 pages of flaming.
i'm more afraid of drugs being used as weapons than i am of weapons.
also, drugs as fun candy is a very bad decision.

i think only one person mentioned this, but if you think psychedelics are instant love and enlightenment you should consider how you'd feel if someone for fun slipped you 50mg 5-meo-amt. i've seen that happen with the poeple not telling thier friend's what drug they were giving them. it led to a psychotic break for the duration of the trip (about 2 days).

i saw this kid i was traveling with for a couple months experiance a long term (a week or more) psychotic break. we still don't know what happened to him, but we found him taking off his clothes, stealing random things from poeple, and generally breaking shit. we watched him for 2 days because the poeple running the festival said they were going to tie him to a tree if we didn't. after the festival ended we had to pass him off to some friends on day 4 and he still wasn't talking. i don't know what happened to him but it was certainly drug induced

back in the day you could have given me a gram and a half of dxm (uh, somehow without me knowning) and i would have thought i was in heaven, but i'm still terrified of getting dosed with acid whenever i'm around serious drug use. you get the point? not only do not all psychedelics lead to enlightenment or happiness, but there is no single chemical that is right for everyone.


--------------------
You can check the last post in my journal for contact info.


Extras: Filter Print Post Top
OfflineNgalyod
Stranger
 User Gallery

Registered: 09/29/05
Posts: 494
Loc: Australia
Last seen: 11 years, 10 months
Re: have you ever slipped someone acid? [Re: truekimbo2]
    #5758641 - 06/16/06 08:33 PM (17 years, 7 months ago)

After reading through this thread I'm still confused about a couple of things. Is giving acid to a baby bad? Or is it bad to give acid to a convulsing baby?


Extras: Filter Print Post Top
OfflineEquilibriuM
dream stalker

Registered: 07/17/05
Posts: 2,323
Last seen: 16 years, 7 months
Re: have you ever slipped someone acid? [Re: Ngalyod]
    #5758692 - 06/16/06 08:48 PM (17 years, 7 months ago)

Quote:

Ngalyod said:
After reading through this thread I'm still confused about a couple of things. Is giving acid to a baby bad? Or is it bad to give acid to a convulsing baby?




Its ok to give acid to your moms baby


--------------------
HELP!!!!!!!!!


Extras: Filter Print Post Top
OfflineLysergic_Milkman
Dr. Fist
Male

Registered: 10/21/04
Posts: 1,676
Loc: ATL
Last seen: 7 years, 1 month
Re: have you ever slipped someone acid? [Re: EquilibriuM]
    #5758945 - 06/16/06 10:11 PM (17 years, 7 months ago)

Dosing a baby on LSD is definitely bad, whether it's convulsing or not. The infant mind is in constant growth and is susceptible to any and all drugs that work on the brain. whether LSD would change a baby's brain for the better or worse we don't know, and it would be inhumane to try and find out. The mind of a small child consumes about 60% of it's energy (about 20% for everyone else), and LSD most likely increases the brains energy consumption. If a brain that is already taking up more than half the body's energy suddenly starts sucking up more energy, the consequences could be fatal.


Extras: Filter Print Post Top
Offlinestemmer
Stranger
 User Gallery

Registered: 09/08/05
Posts: 2,672
Last seen: 17 years, 6 months
Re: have you ever slipped someone acid? [Re: Lysergic_Milkman]
    #5758979 - 06/16/06 10:23 PM (17 years, 7 months ago)

Good point, its a VERY bad idea to give a baby lsd.

My point, its VERY bad to give anyone lsd without them knowing.

And no milkman, I was not calling you an asshole. I thought it was pretty obvious what I was talking about this whole time.
Thanks for yet another unnecessary retort though.

Good point about babies on acid though.


Extras: Filter Print Post Top
OfflineAA2277
Resident DiphHead
Male User Gallery

Registered: 05/06/06
Posts: 699
Last seen: 16 years, 1 month
Re: have you ever slipped someone acid? [Re: stemmer]
    #5758983 - 06/16/06 10:25 PM (17 years, 7 months ago)

Could an admin PLEASE CLOSE THIS THREAD UP

its got terrible vibes to it and is horribly unconstructive. just flaming here, its pointless and angry

if you really think its useful could we get some sort of regular check up on it?

just being a little angry...


--------------------


Extras: Filter Print Post Top
Offlinestemmer
Stranger
 User Gallery

Registered: 09/08/05
Posts: 2,672
Last seen: 17 years, 6 months
Re: have you ever slipped someone acid? [Re: AA2277]
    #5759016 - 06/16/06 10:36 PM (17 years, 7 months ago)

Why?????? This is the dont slip people or babies lsd thread


Extras: Filter Print Post Top
OfflineNgalyod
Stranger
 User Gallery

Registered: 09/29/05
Posts: 494
Loc: Australia
Last seen: 11 years, 10 months
Re: have you ever slipped someone acid? [Re: Lysergic_Milkman]
    #5759125 - 06/16/06 11:11 PM (17 years, 7 months ago)

Quote:

Lysergic_Milkman said:
Dosing a baby on LSD is definitely bad, whether it's convulsing or not. The infant mind is in constant growth and is susceptible to any and all drugs that work on the brain. whether LSD would change a baby's brain for the better or worse we don't know, and it would be inhumane to try and find out. The mind of a small child consumes about 60% of it's energy (about 20% for everyone else), and LSD most likely increases the brains energy consumption. If a brain that is already taking up more than half the body's energy suddenly starts sucking up more energy, the consequences could be fatal.




But uuugh giving acid to a convulsing baby should be, like, cool ... right?


Extras: Filter Print Post Top
OfflineNgalyod
Stranger
 User Gallery

Registered: 09/29/05
Posts: 494
Loc: Australia
Last seen: 11 years, 10 months
Re: have you ever slipped someone acid? [Re: Ngalyod]
    #5759131 - 06/16/06 11:13 PM (17 years, 7 months ago)

:grin:


Extras: Filter Print Post Top
Offlinehoopershroomer
Bonafide Oneironaut
Male User Gallery

Registered: 03/30/06
Posts: 1,704
Loc: WA
Last seen: 8 years, 2 months
Re: have you ever slipped someone acid? [Re: Ngalyod]
    #5759305 - 06/16/06 11:54 PM (17 years, 7 months ago)

i must say this thread is quite funny. of course despite the fact that the original poster thought it was a good idea to slip some unknowing person some acid. that, is just plain ignorance. the poster must be like 12 or something, seriously


--------------------
"Life lived in the absence of the psychedelic experience that primordial shamanism is based on is life trivialized, life denied, life enslaved to the ego."

"You teach the world how to treat you, by showing the world how you treat yourself."

A well developed sense of humor is far superior to any religion"

"Everything you could want and could be, you already have and are."

:peace: & :heart:


Extras: Filter Print Post Top
OfflineIamthewalrus
every evening Idied and everynight I wasreborn
Male User Gallery

Registered: 03/24/04
Posts: 3,744
Loc: Ontario
Last seen: 15 years, 3 months
Re: have you ever slipped someone acid? [Re: hoopershroomer]
    #5759416 - 06/17/06 12:18 AM (17 years, 7 months ago)

why are we even discussing dosing a baby? truely lol


Extras: Filter Print Post Top
Offlinestemmer
Stranger
 User Gallery

Registered: 09/08/05
Posts: 2,672
Last seen: 17 years, 6 months
Re: have you ever slipped someone acid? [Re: Iamthewalrus]
    #5759438 - 06/17/06 12:24 AM (17 years, 7 months ago)

No shit. I was not about to read the last pages to see why this is being discussed.

Infact, this whole thread is a bad idea.

I cant think of one reason to come here but to say that those who dose anybody without them knowing are making a dreadfully stupid mistake.

Interesting sidenote: In some SA indian tribes they give babies one large drop of an ayahuasca brew to ward off sickness.
I know the healing powers of ayahuasca both physical and mental.
Although I would not give such a small dose to my child, it is an interesting idea. I dont blame them for believing that. I dont think that is very stupid, unlike the discussion about dosing babies..


Edited by stemmer (06/17/06 12:27 AM)


Extras: Filter Print Post Top
Invisiblehoboblues
Male
Registered: 03/26/06
Posts: 610
Re: have you ever slipped someone acid? [Re: AA2277]
    #5759463 - 06/17/06 12:31 AM (17 years, 7 months ago)

Quote:

AA2277 said:
Could an admin PLEASE CLOSE THIS THREAD UP

its got terrible vibes to it and is horribly unconstructive. just flaming here, its pointless and angry

if you really think its useful could we get some sort of regular check up on it?

just being a little angry...




Close this thread up because it's got bad vibes and is angry?  Yeah, ok man. :rolleyes:  What percentage of threads here are not pointless?  It's a message board.  It's angry because people are getting involved and are actually moved by what the thread starter had to say.  Nothing wrong with some conflicting opinions.  So why not add your opinion to the matter and not get all sensitive to some angry posts.  The thread starter asked for it if you ask me.  If he can't handle an onslaught of conflicting opinions, let him go.


--------------------


Extras: Filter Print Post Top
InvisibleAlteredAgain
Visual Alchemist
 User Gallery

Registered: 04/27/06
Posts: 11,181
Loc: Solar Circuit
Re: have you ever slipped someone acid? [Re: stemmer]
    #5759493 - 06/17/06 12:38 AM (17 years, 7 months ago)

Quote:

stemmer said:

I cant think of one reason to come here but to say that those who dose anybody without them knowing are making a dreadfully stupid mistake.





Haven't you already gotten that point across?

:rolleyes:


--------------------


Extras: Filter Print Post Top
Invisiblehoboblues
Male
Registered: 03/26/06
Posts: 610
Re: have you ever slipped someone acid? [Re: AlteredAgain]
    #5759504 - 06/17/06 12:42 AM (17 years, 7 months ago)

Quote:

AlteredAgain said:
Quote:

stemmer said:

I cant think of one reason to come here but to say that those who dose anybody without them knowing are making a dreadfully stupid mistake.





Haven't you already gotten that point across?

:rolleyes:




can't be said enough


--------------------


Extras: Filter Print Post Top
Offlinestemmer
Stranger
 User Gallery

Registered: 09/08/05
Posts: 2,672
Last seen: 17 years, 6 months
Re: have you ever slipped someone acid? [Re: AlteredAgain]
    #5759505 - 06/17/06 12:42 AM (17 years, 7 months ago)

I suppose so, just wanted to drive that point into the ground since a few people seemed to have a problem with my harsh opinion.

Im just having some fun.

Oh ya and the main point was to sum up the thread a bit for those who are getting all sensative about peoples harsh opinions.
and to say this:
In some SA indian tribes they give babies one large drop of an ayahuasca brew to ward off sickness.
I know the healing powers of ayahuasca both physical and mental.
Although I would not give such a small dose to my child, it is an interesting idea. I dont blame them for believing that. I dont think that is very stupid, unlike the discussion about dosing babies..

So sorry, if you dont want to read a redundant thread, dont come here.


Extras: Filter Print Post Top
InvisibleAlteredAgain
Visual Alchemist
 User Gallery

Registered: 04/27/06
Posts: 11,181
Loc: Solar Circuit
Re: have you ever slipped someone acid? [Re: stemmer]
    #5759512 - 06/17/06 12:48 AM (17 years, 7 months ago)

Wouldn't post here if i didn't want to. :smirk:


--------------------


Extras: Filter Print Post Top
Offlinestemmer
Stranger
 User Gallery

Registered: 09/08/05
Posts: 2,672
Last seen: 17 years, 6 months
Re: have you ever slipped someone acid? [Re: AlteredAgain]
    #5759516 - 06/17/06 12:49 AM (17 years, 7 months ago)

Well thats obvious.

So deal with this "department of the redundancy department" we have here girl friend.


Edited by stemmer (06/17/06 12:51 AM)


Extras: Filter Print Post Top
OfflineTyrone_C
Stranger

Registered: 07/13/05
Posts: 426
Last seen: 17 years, 6 months
Re: have you ever slipped someone acid? [Re: Telepylus]
    #5760111 - 06/17/06 09:21 AM (17 years, 7 months ago)

Quote:

Telepylus said:
me and my ex-wife





No need to explain.


Extras: Filter Print Post Top
OfflineCrestfallen
some kindasomethin'

Registered: 07/23/04
Posts: 324
Last seen: 17 years, 2 months
Re: have you ever slipped someone acid? [Re: Tyrone_C]
    #5760408 - 06/17/06 11:47 AM (17 years, 7 months ago)

I'll share a story about an old friend who got dosed one time when he had no idea.

Basically, someone slipped him some acid, and that same night he ran straight through a glass door at a friend's house and was cut up so severely that he had to be taken to the hospital. Guy never was the same (physically or mentally) after that. He would see cops around town and beg them to take him to jail because he was convinced someone was trying to kill him.

This guy had some form of schizophrenia (which his family had a history of), and several years later ended up taking his own life by hanging himself.

- Its a stupid fucking idea to dose someone like that IMO. Deception and secretly dosing people is not what psychedelics are about. Complete openness and free choice should be cultivated for a good experience.


--------------------
The above statement is completely fictional and composed solely for the purpose of entertainment.


Extras: Filter Print Post Top
Offlinejfoster
"That" guy

Registered: 05/14/06
Posts: 294
Last seen: 7 years, 10 months
Re: have you ever slipped someone acid? [Re: Crestfallen]
    #5760505 - 06/17/06 12:34 PM (17 years, 7 months ago)

in my school a couple of years ago someone slipped a teacher that they didn't like some acid. he freaked out and had to be driven to the hospitla because everyone thought he was crazy. he still teaches, and nhow he's paranoid and mumbles to himself sometimes


Extras: Filter Print Post Top
InvisibleTHE KRAT BARON
one-eyed willie
Registered: 07/08/03
Posts: 42,409
Re: have you ever slipped someone acid? [Re: stemmer]
    #5760642 - 06/17/06 01:29 PM (17 years, 7 months ago)

Quote:

stemmer said:
Interesting sidenote: In some SA indian tribes they give babies one large drop of an ayahuasca brew to ward off sickness.
I know the healing powers of ayahuasca both physical and mental.
Although I would not give such a small dose to my child, it is an interesting idea. I dont blame them for believing that. I dont think that is very stupid, unlike the discussion about dosing babies..




Contradict much?


--------------------
m00nshine is currently vacationing in Maui. Rumor has it he got rolled by drunken natives and is currently prostituting himself in order to pay for airfare back to the mainland but he's having trouble juggling a hairon addiction. He won't be back for a long while.


Extras: Filter Print Post Top
OfflineExplosiveMango
HallucinogenusDigitallus
Male User Gallery

Registered: 07/12/05
Posts: 3,222
Last seen: 14 years, 2 months
Re: have you ever slipped someone acid? [Re: Telepylus]
    #5760958 - 06/17/06 03:59 PM (17 years, 7 months ago)

Ok, to start off with, I think the fighting going on in this post is fairly ridiculous.

You're all just yelling your fundamentals at each other as 'cleverly' as you can. No information exchange is taking place. Why?



But off to the subject of what we're actually fighting about...
My view:
Dosing people with psychedelics is always dangerous, whether they know what they're getting into or not.
People will not necessarily like or dislike a psychedelic, whether they know what they're getting into or not.

If you decide you want to dose a person on a psychedelic with or without them knowing, think very fucking hard about what the consequences could be first.

There IS NO fundamental rule "it's bad to dose people when 'blah blah'"

All life is circumstantial.
If I had dosed Hitler on LSD when he was beginning to form his religious roots, thousands of Jews may have been able to avoid horrible deaths.
You will never know the future your actions will cause, but you can rest assured that psychedelics are tremendously powerful.



If you're going to respond by telling me a definite way to/not to use psychedelics, save your breathe. I'm immune to your fundamentals (aka prejudices)










But onto another interesting topic that was only glanced at - 'dosing the whole world'

This seems to remind me of Manson's idea?

Although in my mind it seems absolutely crazy to dose a single unknowing individual with LSD... unfair, chaotic, dangerous...
The implications of being able to dose a large number of people seem very promising to me.

I mean... think about one thing psychedelics reliably do... break barriers in your mind...

North America is suffering tremendously due to mental barriers. We want our way of life regardless of the fact that it's unsustainable... we want to take what the rest of the world has so that we can eat McDonalds every day and take "Hydroxy-cut" pills to not put on weight. We want SUVs, and sounds systems that draw enough energy to feed a starving family.
(point of view of the statistical average only, not any certain individual)

The majority of the world - the suffering world - desperately needs to destroy the barriers we erect around ourselves to ignore their pain.

We choose not to see this. We give their desperation a name... let's call it a "witch" or... a "terrorist"... an excuse to reinforce our walls, to murder the starving who steal our tablescraps...

I say take a fleet of aircraft, load em all up with a ton of LSD, drop it all over our 'civilized world' and watch the walls of fear and hate shatter... to the infinite disappointment of our elite few, and the infinite relief of our suffering masses.

Make our soldiers think about why it's right for them to murder.
Make our businessmen think about why it's right for them to plunder.

Take a good hard look at everything we've taken away for granted.


--------------------
Know your self.
Know your substance.
Know your source.

The most distorted perspective possible is the perspective that yours is not distorted.


Edited by ExplosiveMango (06/17/06 04:05 PM)


Extras: Filter Print Post Top
Offlinestemmer
Stranger
 User Gallery

Registered: 09/08/05
Posts: 2,672
Last seen: 17 years, 6 months
Re: have you ever slipped someone acid? [Re: THE KRAT BARON]
    #5760979 - 06/17/06 04:06 PM (17 years, 7 months ago)

Quote:

mattzdope said:
Quote:

stemmer said:
Interesting sidenote: In some SA indian tribes they give babies one large drop of an ayahuasca brew to ward off sickness.
I know the healing powers of ayahuasca both physical and mental.
Although I would not give such a small dose to my child, it is an interesting idea. I dont blame them for believing that. I dont think that is very stupid, unlike the discussion about dosing babies..




Contradict much?




Read much? The baby wont trip from one droplet. Its for health purposes, not to dose the baby and make the poor little thing trip.


Edited by stemmer (06/17/06 04:08 PM)


Extras: Filter Print Post Top
OfflineGinseng1
Elegant Universe
 User Gallery

Registered: 09/02/04
Posts: 3,310
Last seen: 9 years, 4 months
Re: have you ever slipped someone acid? [Re: ExplosiveMango]
    #5761009 - 06/17/06 04:15 PM (17 years, 7 months ago)

Quote:

ExplosiveMango said:
Ok, to start off with, I think the fighting going on in this post is fairly ridiculous.

You're all just yelling your fundamentals at each other as 'cleverly' as you can. No information exchange is taking place. Why?



But off to the subject of what we're actually fighting about...
My view:
Dosing people with psychedelics is always dangerous, whether they know what they're getting into or not.
People will not necessarily like or dislike a psychedelic, whether they know what they're getting into or not.

If you decide you want to dose a person on a psychedelic with or without them knowing, think very fucking hard about what the consequences could be first.

There IS NO fundamental rule "it's bad to dose people when 'blah blah'"

All life is circumstantial.
If I had dosed Hitler on LSD when he was beginning to form his religious roots, thousands of Jews may have been able to avoid horrible deaths.
You will never know the future your actions will cause, but you can rest assured that psychedelics are tremendously powerful.



If you're going to respond by telling me a definite way to/not to use psychedelics, save your breathe. I'm immune to your fundamentals (aka prejudices)










But onto another interesting topic that was only glanced at - 'dosing the whole world'

This seems to remind me of Manson's idea?

Although in my mind it seems absolutely crazy to dose a single unknowing individual with LSD... unfair, chaotic, dangerous...
The implications of being able to dose a large number of people seem very promising to me.

I mean... think about one thing psychedelics reliably do... break barriers in your mind...

North America is suffering tremendously due to mental barriers. We want our way of life regardless of the fact that it's unsustainable... we want to take what the rest of the world has so that we can eat McDonalds every day and take "Hydroxy-cut" pills to not put on weight. We want SUVs, and sounds systems that draw enough energy to feed a starving family.
(point of view of the statistical average only, not any certain individual)

The majority of the world - the suffering world - desperately needs to destroy the barriers we erect around ourselves to ignore their pain.

We choose not to see this. We give their desperation a name... let's call it a "witch" or... a "terrorist"... an excuse to reinforce our walls, to murder the starving who steal our tablescraps...

I say take a fleet of aircraft, load em all up with a ton of LSD, drop it all over our 'civilized world' and watch the walls of fear and hate shatter... to the infinite disappointment of our elite few, and the infinite relief of our suffering masses.

Make our soldiers think about why it's right for them to murder.
Make our businessmen think about why it's right for them to plunder.

Take a good hard look at everything we've taken away for granted.




nice post


--------------------
Flowing through beginningless time since time without beginning...


Extras: Filter Print Post Top
Invisiblekaniz
That one, overthere.
Male

Registered: 07/23/04
Posts: 4,166
Loc: Ontario
Re: have you ever slipped someone acid? [Re: Ginseng1]
    #5761048 - 06/17/06 04:28 PM (17 years, 7 months ago)

and also end up with a bunch of freak outs, accidents, people getting into terror loops - its a nice fantasy, but a naive one.

Dosing anyone, with anything unknowingly is a horrible thing to do - cognitive liberty applies to our own minds, not to those around us. By doing someone unknowingly - you are taking that away from them.

I like drugs, I love LSD - but if someone dosed me when I didn’t know/didn’t want to - I'd be pissed off. I trip for my own reasons, not someone else's kicks.


Extras: Filter Print Post Top
OfflineExplosiveMango
HallucinogenusDigitallus
Male User Gallery

Registered: 07/12/05
Posts: 3,222
Last seen: 14 years, 2 months
Re: have you ever slipped someone acid? [Re: kaniz]
    #5761102 - 06/17/06 04:46 PM (17 years, 7 months ago)

Quote:

kaniz said:
and also end up with a bunch of freak outs, accidents, people getting into terror loops - its a nice fantasy, but a naive one.

Dosing anyone, with anything unknowingly is a horrible thing to do - cognitive liberty applies to our own minds, not to those around us. By doing someone unknowingly - you are taking that away from them.

I like drugs, I love LSD - but if someone dosed me when I didn’t know/didn’t want to - I'd be pissed off. I trip for my own reasons, not someone else's kicks.





Many would be hurt by this action. Some would be helped. Many would learn to help each other. This is not about the individual, this is about the society, and causing a change based on something other than money. A change which will eventually have to occur in order for our species to survive. This is not a solution, it is a spark.


--------------------
Know your self.
Know your substance.
Know your source.

The most distorted perspective possible is the perspective that yours is not distorted.


Edited by ExplosiveMango (06/19/06 09:48 AM)


Extras: Filter Print Post Top
Offlinestemmer
Stranger
 User Gallery

Registered: 09/08/05
Posts: 2,672
Last seen: 17 years, 6 months
Re: have you ever slipped someone acid? [Re: kaniz]
    #5761113 - 06/17/06 04:49 PM (17 years, 7 months ago)

I am just one example:

I dont trip anymore and if someone dosed me without me knowing they would be changing the composition of my mind further than I have already done to myself. I would also be tripping for about 24 hours on any small to medium dose of lsd, and would have to work with the after effects for more than a year. ( I seriously have tripped that many times and am that sensative)

That person who dosed me would be closer to getting their ass kicked by me than anyone ever before.
I could seriously retaliate and not just simply "learn from it and roll with the punches".

Id probably tie them up after knocking them out, dose the hell out of them, apply water torture and verbally abuse them untill they cry many times by persuading them that they are at the low end of the "stupid chain".
Seems fitting to me...............
I know that sounds extreme, but for a person like me, though I would not do that to somebody, The effects of that dose of lsd would, for me, change the outcome of one year of my life and then some.

I value hallucinogens, and have learned so much from them. I just couldnt fathom some idiot who obviously knows nothing about hallucinogens doing such a thing to me. Insisting that I learn from or adapt to another experience.

And if you cant see the problem with dosing "the whole world", your definately not that bright and have way too much faith in these drugs ability to change anyone everyone.

There are so many problems with the idea of dosing any sized community without them knowing.


Edited by stemmer (06/17/06 05:03 PM)


Extras: Filter Print Post Top
Invisibled4a2n0k
The Dude
Male User Gallery

Registered: 07/23/03
Posts: 742
Re: have you ever slipped someone acid? [Re: Telepylus]
    #5761132 - 06/17/06 04:55 PM (17 years, 7 months ago)

Well I know someone who was dosed on shrooms with out knowing. Some assholes he was living with came back from taco bell and put ground up shrooms in a burrito and gave it to him. He was really drunk at the time and devoured the burrito, then they smoked a bowl and he passed out. Only to wake up in a severely confused state about 30-45 min later. When he went to tell the people who dosed him what was happening, they denied anything and told him the weed must been really good. Well as the night goes on these assholes keep messing with him while hes trying to sleep and forced him to have the worst experience possible! for days after he was convinced he was crazy and in need of help. It wasn't until one of them finally fessed up that he finally came to peace with the whole event. Needless to say none of them are friends any more!


--------------------
Row, row, row your boat,
Gently down the stream.
Merrily, merrily, merrily, merrily,
Life is but a dream.


Extras: Filter Print Post Top
Offlinestemmer
Stranger
 User Gallery

Registered: 09/08/05
Posts: 2,672
Last seen: 17 years, 6 months
Re: have you ever slipped someone acid? [Re: d4a2n0k]
    #5761153 - 06/17/06 05:01 PM (17 years, 7 months ago)

Thats one very fucked up story.

Im not a big fan of mind control and certainly not when some idiot wants to dose the whole world or some similare shit saying things like "dude just think about it, it could work".

  Thats like using weaponized hallucinogens to terrorize people and change the way they think which so very often would not work, would fuck up many people for life.  Lets say we gave Hitler or some murdering gangemember some acid and see if they can get ahold of their destructive ways and turn them into good.  My guess is most people like that would only get a bit more fucked in the head.

Dont try to fuck with what Kaniz said ExplosiveM.
"I think your fantasy- finding safety while living in a world of unimaginable global social tension- is the naive one"...  L O fucking L


Hallucinogens will surely do the trick then.
:rolleyes:


Edited by stemmer (06/17/06 05:08 PM)


Extras: Filter Print Post Top
OfflineExplosiveMango
HallucinogenusDigitallus
Male User Gallery

Registered: 07/12/05
Posts: 3,222
Last seen: 14 years, 2 months
Re: have you ever slipped someone acid? [Re: stemmer]
    #5765172 - 06/18/06 05:47 PM (17 years, 7 months ago)



MOD EDIT: any further flaming posts in this thread will be replaced by cheese.


Edited by Wiccan_Seeker (06/18/06 07:06 PM)


Extras: Filter Print Post Top
Offlinestemmer
Stranger
 User Gallery

Registered: 09/08/05
Posts: 2,672
Last seen: 17 years, 6 months
Re: have you ever slipped someone acid? [Re: ExplosiveMango]
    #5765225 - 06/18/06 06:05 PM (17 years, 7 months ago)



MOD EDIT: any further flaming posts in this thread will be replaced by cheese.


Edited by Wiccan_Seeker (06/18/06 07:07 PM)


Extras: Filter Print Post Top
InvisibleMoo456
Pied_Piper

Registered: 03/03/06
Posts: 4,591
Re: have you ever slipped someone acid? [Re: stemmer]
    #5765449 - 06/18/06 07:15 PM (17 years, 7 months ago)

Ah finally. Im sick of this ongoing stupid subject. Cheese is much better.


Extras: Filter Print Post Top
Offlinestemmer
Stranger
 User Gallery

Registered: 09/08/05
Posts: 2,672
Last seen: 17 years, 6 months
Re: have you ever slipped someone acid? [Re: Moo456]
    #5765514 - 06/18/06 07:33 PM (17 years, 7 months ago)

Yep, its a pretty stupid subject.

Nice edit. I would have rather had him see what I had to say. But you make a good point with the stinky cheese and all. I hope its sharp cheedar.

Its all good. Just dont dose babies, the public, or any one person.

It just happens to say alot about you when you do such a thing.


Extras: Filter Print Post Top
OfflineExplosiveMango
HallucinogenusDigitallus
Male User Gallery

Registered: 07/12/05
Posts: 3,222
Last seen: 14 years, 2 months
Re: have you ever slipped someone acid? [Re: stemmer]
    #5767403 - 06/19/06 09:44 AM (17 years, 7 months ago)

Any person who mistook my idea about causing a massive scale psychedelic disruption as a plan or intention for a real event needs to think about the context for a little longer.

It is not realistically possible to manufacture tons of LSD. It is not realistically possible to acquire a fleet of planes undetected. This is obvious to any person who has a good grasp of reality.



Obviously my argument was ENTIRELY philosophical.



The fact that any person would be so petty as to insult, or personally attack me because of what drug related philosophy I wanted to discuss - on a site intended for this type of discussion no less - is pathetic to say the least.

I wish people would have more respect on this site than to resort to gradeschoool social behaviour when a topic comes up that they don't like.


--------------------
Know your self.
Know your substance.
Know your source.

The most distorted perspective possible is the perspective that yours is not distorted.


Extras: Filter Print Post Top
Offlinemellowrubberduck
NDE on 7/8/06
Male User Gallery

Registered: 06/11/06
Posts: 241
Loc: Pennsylvania, USA
Last seen: 14 years, 4 months
Re: have you ever slipped someone acid? [Re: ExplosiveMango]
    #5767526 - 06/19/06 10:25 AM (17 years, 7 months ago)

I thought we were all adults here too, but it seems as if people's brains aren't developed fully to partake in a discussion. I guess just swearing and calling people names gets the point across nowadays? Sure, one post getting your point across is alright, but going ON and ON about the same exact thing is redundant. Frankly, I dunno how you people carry on conversations in reality, but when it comes to the internet people turn into assholes for no apparent reason.


Extras: Filter Print Post Top
InvisibleAsante
Mage
Male User Gallery

Registered: 02/06/02
Posts: 86,795
Re: have you ever slipped someone acid? [Re: ExplosiveMango]
    #5768558 - 06/19/06 03:47 PM (17 years, 7 months ago)

Actually a small warhead with 5lbs of weaponized LSD will suffice for a small city, that's say a device the size of two buckets stacked on top of eachother. This warhead will fall from the air inaudibly and in its fall scatter into lets say 75 submunitions the size of an orange, which will fall to the ground and softly hiss as they each release a fine mist containing 1 ounce of LSD (1/3 million blotters) dissolved into a solvent with a low odor profile, the cloud dissolving into thin air a yard or so from each submunition. The gentle breeze will carry this colorless, odorless mist through the streets and into the houses.

Most people will be driven beyond 500mcg deeply into the thumbprint range. You can't do that to people, and many people may come away with the life lesson: "don't let your guard down because you're not safe no matter where you go", which is Post Traumatic Stress Disorder.

And to think of the re-intoxications when someone a few days later touches something with LSD sticking to it, and the panic when people see someone tripping out again.

Gassing is for cockroaches.
I seriously think it's more ethical to subject a population to a hard nervegas strike than to insidiously gas them with LSD. I think most people here underestimate the nightmarish scenario of a gas attack with LSD.

Just imagine an old folks home where old frail people in their eighties and nineties are passing the time. Old frail people with heart conditions and arthritis shrieking at the top of their lungs with laughter and utter horror for hours on end. They'll have to cart half off to the mental ward and the other half to the morgue.

LSD should be legally available to adults who want it and seek it out, just like weed and mushrooms are in Holland, you can't force it on people.

Nontheless it makes for interesting discussion, so let's discuss uninformed dosing!


--------------------
Omnicyclion.org
higher knowledge starts here


Edited by Asante (06/19/06 04:08 PM)


Extras: Filter Print Post Top
InvisibleSinbad
Living TheMoment
Male

Registered: 12/23/04
Posts: 2,571
Loc: Under The Bodhi Tree
Re: have you ever slipped someone acid? [Re: mellowrubberduck]
    #5768595 - 06/19/06 03:59 PM (17 years, 7 months ago)

Quote:

mellowrubberduck said:
I thought we were all adults here too, but it seems as if people's brains aren't developed fully to partake in a discussion. I guess just swearing and calling people names gets the point across nowadays? Sure, one post getting your point across is alright, but going ON and ON about the same exact thing is redundant. Frankly, I dunno how you people carry on conversations in reality, but when it comes to the internet people turn into assholes for no apparent reason.




:thumbup: :heart:


--------------------


Extras: Filter Print Post Top
OfflineAshland
Space Cowboy

Registered: 02/03/06
Posts: 315
Loc: North America
Last seen: 16 years, 11 months
Re: have you ever slipped someone acid? [Re: Telepylus]
    #5768624 - 06/19/06 04:06 PM (17 years, 7 months ago)

I think it would be fantastic if somehow, someone could "poison" the water supply with LSD... though I would never intentionally slip an individual a dose... why waste it!?


Extras: Filter Print Post Top
OfflineManianFHS
living in perverty
 User Gallery

Registered: 07/06/04
Posts: 14,741
Last seen: 1 day, 12 hours
Re: have you ever slipped someone acid? [Re: Ashland]
    #5768752 - 06/19/06 04:43 PM (17 years, 7 months ago)

I heard somewhere that if a police officer is dosed with acid (through whatever means) they are required to restrain themselves, with handcuffs and shit, so that nobody would get injured or something as result of their actions. - what a bad fucking trip that could become...

Is this acutally practiced in law enforcement, or is it more one of those old antique laws that dont make a ton of logic...?


--------------------
notapillow said: "you are going about this endeavor all wrong. clear your mind of useless fear and concern. buy the ticket, take the ride, and all that.... "

ChrisWho said: "It's all about the journey, not the destination."


Extras: Filter Print Post Top
Offlinestemmer
Stranger
 User Gallery

Registered: 09/08/05
Posts: 2,672
Last seen: 17 years, 6 months
Re: have you ever slipped someone acid? [Re: ManianFH]
    #5769020 - 06/19/06 05:59 PM (17 years, 7 months ago)

I understand the whole stew of philosophical ideas surrounding the thought of dosing the masses.

I just think the whole Idea is kinda silly. The whole, "just imagine how it could change the world" thing doesnt sit well with me.
You have to want to change and learn to allow psychedelics to do their best work. It also helps to know a bit about psychedelics.

Your every day joe doesnt know what to do with such a temporary but intense change in the way his or her brain works. Nor does a person using these drugs for the first time know what to do with it.
The world is not really ready for a worldwide group hallucination.

Its an interesting but silly idea. I see why some people want to discuss it though. Psychedelics can change the way you look at the world. There are a few figure heads I wouldnt mind seeing dosed into oblivion, just to see if some things changed because of it.
Not that I agree with dosing anyone without their knowing.


Edited by stemmer (06/19/06 06:00 PM)


Extras: Filter Print Post Top
Offlinemellowrubberduck
NDE on 7/8/06
Male User Gallery

Registered: 06/11/06
Posts: 241
Loc: Pennsylvania, USA
Last seen: 14 years, 4 months
Re: have you ever slipped someone acid? [Re: stemmer]
    #5770014 - 06/19/06 09:53 PM (17 years, 7 months ago)

Quote:

stemmer said:
I just think the whole Idea is kinda silly. The whole, "just imagine how it could change the world" thing doesnt sit well with me.


The world is not really ready for a worldwide group hallucination.




The second woodstock pretty much figured that out. I'll blame it on that mindset too that "All You Need is Love", which I'm not saying you Don't, but things can get icky, even when everyone KNEW they were taking drugs.


Extras: Filter Print Post Top
OfflineSapphireCat
Seeker
Male

Registered: 11/29/05
Posts: 613
Loc: Ireland
Last seen: 13 years, 1 month
Re: have you ever slipped someone acid? [Re: mellowrubberduck]
    #5771511 - 06/20/06 05:04 AM (17 years, 7 months ago)

i find dosing the whole world would be just as bad...actually no, worse, than keeping the drugs illegal. at least now the governments stopping us from experiencing something, and stopping an experience is better than forcing an experience imo


--------------------
Beauty of style and harmony and grace and good rhythm depend on Simplicity ~Plato


Extras: Filter Print Post Top
OfflineExplosiveMango
HallucinogenusDigitallus
Male User Gallery

Registered: 07/12/05
Posts: 3,222
Last seen: 14 years, 2 months
Re: have you ever slipped someone acid? [Re: SapphireCat]
    #5771613 - 06/20/06 06:37 AM (17 years, 7 months ago)

I find one of the most frightening things about the populace I live amongst to be their apparent lack of depth. The fact that so many people around me can go through life believing that the only things are money and power- and succeed while doing this- suggests to me that we are in danger of losing our values completely.

The populace I live amongst is so detached from any deeper meaning that they are afraid. Often when an individual tries to explore a realm of any depth, especially an unfamiliar one (psychedelics, foreign worship) they are feared, and often attacked.

The problem with a stalemate between an ignorant intolerant who wishes for war, and a learned individual who wishes for acceptance is that the aggressor is most likely to win. Often by killing the unfamiliar. I don't want to die for my beliefs, nor do I want future generations to be denied the right to free use of chemicals in their own body.


I must admit it would lower the level of the peaceful individual to instigate any attack. (whether the bombs are psychedelic or just explosive)


But what is the solution when the warlike have already declared war on the peaceful? Isn't an attack of forced understanding better than an attack of forced destruction?

At least if our enemies still hate us for what we do, it will not be simply out of prejudice.


--------------------
Know your self.
Know your substance.
Know your source.

The most distorted perspective possible is the perspective that yours is not distorted.


Extras: Filter Print Post Top
InvisibleAsante
Mage
Male User Gallery

Registered: 02/06/02
Posts: 86,795
Re: have you ever slipped someone acid? [Re: ExplosiveMango]
    #5771681 - 06/20/06 07:43 AM (17 years, 7 months ago)

I think the only psychedelic use that can, in some instances, be aggressively put to someone would be that of MDMA.

With MDMA you are fully in control and free to retain your boundaries, but are strongly encouraged to drop your ego defenses.
19/20 people come away touched by the Divine if the session is ran right.

Even so you can't slip someone even MDMA without their knowledge or consent, but with MDMA you can afford a little "evangelizing" because the vast majority of people would want to have had this experience, even if just once in their lifetime.
The problem is that people are so closed-minded that they have to take it before they know they want it.

You can't break this stalemate by convert dosing, but being decently pushy can be justified in some cases.


--------------------
Omnicyclion.org
higher knowledge starts here


Extras: Filter Print Post Top
Jump to top Pages: 1 | 2 | 3 | 4 | 5  [ show all ]

Shop: Kraken Kratom Kratom Capsules for Sale   PhytoExtractum Buy Bali Kratom Powder   North Spore North Spore Mushroom Grow Kits & Cultivation Supplies   Left Coast Kratom Buy Kratom Extract   Unfolding Nature Unfolding Nature: Being in the Implicate Order   Original Sensible Seeds Autoflowering Cannabis Seeds


Similar ThreadsPosterViewsRepliesLast post
* shrooms vs. acid
( 1 2 3 4 all )
starkes 128,617 65 10/27/12 10:10 AM
by Dimethyltryptamine
* Chances of fake acid?
( 1 2 all )
Raiden333 9,019 24 07/17/05 12:21 PM
by archetypal
* J. Coltrane on acid stemmer 2,716 11 09/27/05 06:04 PM
by WillieTomg
* First time acid trip? I don't want to wait. Sherman901 717 10 09/15/05 02:43 PM
by stemmer
* FINALLY I'VE GOT ACID!!!
( 1 2 all )
KidgardFromSRQ 2,219 20 08/01/05 12:08 PM
by icculus_
* Paranoia on ACID?
( 1 2 all )
liftedoff420 5,154 37 08/02/03 09:32 PM
by Gog
* acid revelations HB 7,001 17 10/12/05 09:24 AM
by Apadravya
* 10 hours, 5 hits of acid, Cross texas trip trip.
( 1 2 all )
Evangeliontx 7,415 23 04/22/11 11:03 PM
by occollegeboi

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: psilocybinjunkie, Rose, mushboy, LogicaL Chaos, Northerner, bodhisatta
9,216 topic views. 1 members, 37 guests and 14 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2024 Mind Media. Some rights reserved.

Generated in 0.059 seconds spending 0.012 seconds on 14 queries.