Home | Community | Message Board


This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Shop: Unfolding Nature Unfolding Nature: Being in the Implicate Order   North Spore North Spore Mushroom Grow Kits & Cultivation Supplies   PhytoExtractum Maeng Da Thai Kratom Leaf Powder   Kraken Kratom Red Vein Kratom   Original Sensible Seeds Autoflowering Cannabis Seeds

Jump to first unread post Pages: < Back | 1 | 2 | 3 | 4 | 5 | Next >  [ show all ]
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
InvisibleHanky
wiffle bat.
Male User Gallery
Registered: 08/30/03
Posts: 56,993
Loc: Great Southern Land.
Re: have you ever slipped someone acid? [Re: Telepylus]
    #5755860 - 06/16/06 12:18 AM (17 years, 7 months ago)

Quote:

Telepylus said:
wow.

i never knew you guys were so against peace and love and enlightenment.

yea, you bet your ass i'm leaving this community.


laters




That combined with your first post reminds me why I hate most hippies.


--------------------
Coaster is an idiot...
[quote]Coaster said:
but i thnk everything thats pure is white?
[/quote]




Extras: Filter Print Post Top
Offlinestemmer
Stranger
 User Gallery

Registered: 09/08/05
Posts: 2,672
Last seen: 17 years, 6 months
Re: have you ever slipped someone acid? [Re: Hanky]
    #5755864 - 06/16/06 12:21 AM (17 years, 7 months ago)

ya, its pretty sad.


Extras: Filter Print Post Top
Offlinehippie_cune
Nowhere Man
Registered: 06/13/06
Posts: 166
Last seen: 16 years, 4 months
Re: have you ever slipped someone acid? [Re: stemmer]
    #5755888 - 06/16/06 12:30 AM (17 years, 7 months ago)

the whole world does need to be slipped acid.

no ive never done it..

but we did tell some guys that smokin salvia was like weed.
it was ok cause they were doin it with us right there and then we told them about it when the uncontrolable laughter kicked in.

"oh yeah, its not as much like weed as it is like a 30 sec acid trip that feels like 5 hours."

hahahaha they had fun


Extras: Filter Print Post Top
Offlinestemmer
Stranger
 User Gallery

Registered: 09/08/05
Posts: 2,672
Last seen: 17 years, 6 months
Re: have you ever slipped someone acid? [Re: hippie_cune]
    #5755907 - 06/16/06 12:40 AM (17 years, 7 months ago)

Thats fucked up too.

You dont know how fragile the human brain is obviously. If they didnt ask for it, dont give them ANY dose.

Its sad how the people who claim to know these drugs would fuck with eachothers brain chemistry like that.

A slim few ignorant people would dose anybody, even one person.

Its just a fucked up thing to do. Thats makes you a criminal, and one very sad asshole. If you do that to someone you know NOTHING about hallucinogens.
Even back in the day when I could take massive doses of anything by myself. If someone dosed me like that Id be closer to kicking anyones ass as I ever have been in my life. I would be SO VERY MAD about it.

Fuck all you who push it on other people for kicks.

Ignorant twits.


Edited by stemmer (06/16/06 12:42 AM)


Extras: Filter Print Post Top
OfflineDucky
Governor ofRhythm
Male

Registered: 05/09/06
Posts: 71
Loc: on a boat somewhere
Last seen: 17 years, 5 months
Re: have you ever slipped someone acid? [Re: stemmer]
    #5755923 - 06/16/06 12:46 AM (17 years, 7 months ago)

Telepuss, is it possible you were that baby that went into convulsions and you just want to share your misfortune with everyone else?


--------------------
"Whoa! ...did you just see that too?"


Extras: Filter Print Post Top
InvisibleHanky
wiffle bat.
Male User Gallery
Registered: 08/30/03
Posts: 56,993
Loc: Great Southern Land.
Re: have you ever slipped someone acid? [Re: Ducky]
    #5755925 - 06/16/06 12:48 AM (17 years, 7 months ago)

We know why she's now his EX wife.


--------------------
Coaster is an idiot...
[quote]Coaster said:
but i thnk everything thats pure is white?
[/quote]




Extras: Filter Print Post Top
InvisibleUnderNose
all out of bubble gum
 User Gallery

Registered: 03/04/06
Posts: 1,612
Re: have you ever slipped someone acid? [Re: Hanky]
    #5755961 - 06/16/06 01:02 AM (17 years, 7 months ago)

http://en.wikipedia.org/wiki/MKULTRA

The Deputy Director of the CIA revealed that over 30 universities and institutions were involved in an 'extensive testing and experimentation' program which included covert drug tests on unwitting citizens 'at all social levels, high and low, native Americans and foreign.' Several of these tests involved the administration of LSD to 'unwitting subjects in social situations.' At least one death, that of Dr. Olson, resulted from these activities. The Agency itself acknowledged that these tests made little scientific sense. The agents doing the monitoring were not qualified scientific observers


--------------------
LAGM 2.022

:dna::dna:


Extras: Filter Print Post Top
InvisibleUnderNose
all out of bubble gum
 User Gallery

Registered: 03/04/06
Posts: 1,612
Re: have you ever slipped someone acid? [Re: UnderNose]
    #5755968 - 06/16/06 01:04 AM (17 years, 7 months ago)

Who knows how many people have already been slipped some acid


--------------------
LAGM 2.022

:dna::dna:


Extras: Filter Print Post Top
Offlinestemmer
Stranger
 User Gallery

Registered: 09/08/05
Posts: 2,672
Last seen: 17 years, 6 months
Re: have you ever slipped someone acid? [Re: UnderNose]
    #5755970 - 06/16/06 01:04 AM (17 years, 7 months ago)

Slipping people anything is a no deal in my books.  There is no act in the world that can say how little one knows about hallucinogens.

The fact that anyone can level with this garbage makes me sick.

We always thought it would be funny when I was in college to put a shattered gel tab into the teachers coffee before class and then get to see him run to the nurses office(s) when he started to get all crazy during a lecture.  We never actually did that, though we could have.  I would have known enough about hallucinogens as a junior in highschool to know that that just was not worth the fun.

    SOme people apparently are just that stupid though, and I cant help that.  Good luck treating hallucinogens like candy and slipping it to anyone you please.    :rolleyes:


Extras: Filter Print Post Top
OfflineLysergic_Milkman
Dr. Fist
Male

Registered: 10/21/04
Posts: 1,676
Loc: ATL
Last seen: 7 years, 1 month
Re: have you ever slipped someone acid? [Re: stemmer]
    #5755981 - 06/16/06 01:09 AM (17 years, 7 months ago)

Quote:

mellowrubberduck said:
Excuse me if you would, but obviously I failed to portray my ideas clearly....




that is an admirable thing to say in light of the flaming you received  :smile: :thumbup:. Please stay with our community and contribute to our wealth of knowledge, we need more people like you; this thread does not represent the character of the Shroomery.

Quote:

stemmer said:
Thats me.........  The asshole who knows his shit.





You really think so? I don't want to be the culprit of flaming here, but I want you to know that I could pull up numerous examples confirming your first claim and putting to shame the second.
As a famous philosopher once said (non-verbatim):
"He thought that he knew something, but really he knew nothing. I, however, know nothing, and know that I know nothing. This, I believe, puts me at a distinct advantage."
This is my main philosophy and I live by it every day. I suggest that everyone else do the same.

Please stop this nonsense and have a constructive debate for once. (speaking of nonsense stopping, where are the mod's on this one?)

I do [partially] agree with you, stemmer, in that slipping LSD to unknowing victims is a terrible thing to do. However, you must understand the counter-argument (which I also agree with), which is the 'unwillingness' factor. If one is unknowing as well as unwilling, then there is no doubt that they should be left in peace. But, as was described in the scenario above, there are situations in which a hidden dose of acid can be a good thing.


Edited by Lysergic_Milkman (06/16/06 01:14 AM)


Extras: Filter Print Post Top
Invisiblehoboblues
Male
Registered: 03/26/06
Posts: 610
Re: have you ever slipped someone acid? [Re: Telepylus]
    #5755994 - 06/16/06 01:13 AM (17 years, 7 months ago)

Quote:

Telepylus said:
wow.

i never knew you guys were so against peace and love and enlightenment.

yea, you bet your ass i'm leaving this community.


laters




You sir are a prick.  With your logic, you're no better than Adolf Hitler.  You can't play god.  You don't know what's best for everyone.  Against peace, love, and enlightenment are we?  What about yourself?  You're so at peace with everyone that you have to change them?  What's wrong with diversity?  We sure as hell wouldn't get anything done on this planet with out it.  Yeah, you love, I'm sure, as long as everything is going your way you fucking elitist.  Can we call you Bush?  Bush, how's this for enlightenment.. While your mom was pregnant with you, someone like you spiked her paralament, and no, it wasn't dipped in acid, jack, the word I'm getting to here is crack.

Sorry about that last part.  I've been listening to a lot of Eminem lately.  :laugh:  It's probably not true.


--------------------


Edited by hoboblues (06/16/06 06:54 PM)


Extras: Filter Print Post Top
Offlinestemmer
Stranger
 User Gallery

Registered: 09/08/05
Posts: 2,672
Last seen: 17 years, 6 months
Re: have you ever slipped someone acid? [Re: hoboblues]
    #5756212 - 06/16/06 03:14 AM (17 years, 7 months ago)

Lysergic_Milkman......... that was below the belt.

You are a shame......

This thread is about dosing people without them knowing..

Dosing people without them knowing is a crime.  That is the truth.

So grow up those who cant simply read what someone said and get the simple point. Good lord............ :confused:

Milkman......thanks for the enlightenment!
and thanks for that objective point of view :shocked:

You want a constructive debate given this subject?  Really???????

Well you have my take on it.  Hope you dont go dose some friend for fun...

You have confused me.  Not a big fan of logic ay?


Edited by stemmer (06/16/06 03:30 AM)


Extras: Filter Print Post Top
Offlinechaos05
Stranger

Registered: 08/16/05
Posts: 290
Last seen: 1 year, 10 months
Re: have you ever slipped someone acid? [Re: Telepylus]
    #5756229 - 06/16/06 03:34 AM (17 years, 7 months ago)

You sir are a penis, as are anyone else that in some fucked up logic believes its ok. All I can say I that I pray you get spiked with some extremely nasty research chemical and fry your brains beyond belief.

I cant believe this board lately (yes im a lurker) but the level of chat is that of twelve year olds, who've obviously no idea.

I thought this place was meant to be informative not just plain stupid


Extras: Filter Print Post Top
InvisibleAsante
Mage
Male User Gallery

Registered: 02/06/02
Posts: 86,795
Re: have you ever slipped someone acid? [Re: chaos05]
    #5756240 - 06/16/06 04:02 AM (17 years, 7 months ago)





All please remember that some people's sole pleasure on the internet is to yell something controversial on a forum and sit back with a beer watching the regulars going upset.

Recently the psychology department of Harvard university has done groundbreaking research that demonstrated clearly that these men in fact have no penis.


Giving someone a drug without informed consent, especially a psychedelic able to do psychological damage, is a felony, and to slip it to someone who has stopped using it is not just without consent but also deliberately against their will.

So, what's next?

Will you admit to being a troll and display, despite being devoid of a penis, that you at least have teh gonads to say it like it is, or will you instead defend a lowlife attitude on the sinking ship that is this thread?

My advice is to let this thread blow over in silence and to think your moves through when you want to post another one.


--------------------
Omnicyclion.org
higher knowledge starts here


Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: have you ever slipped someone acid? [Re: Lysergic_Milkman]
    #5756270 - 06/16/06 04:37 AM (17 years, 7 months ago)

Quote:

Lysergic_Milkman said:
Quote:

mellowrubberduck said:
Excuse me if you would, but obviously I failed to portray my ideas clearly....




that is an admirable thing to say in light of the flaming you received  :smile: :thumbup:. Please stay with our community and contribute to our wealth of knowledge, we need more people like you; this thread does not represent the character of the Shroomery.





You're both right that I came off a bit harsh on mr. rubberduck. It was displaced frustration which originated from the original poster, and I apologize. While he made the claim that dosing people without their knowledge can indeed be bad, he dosed someone who quit tripping because she didn't like it. In my opinion, his actions do not show evidence of actually realizing that these actions are wrong, despite being able to pick out certain situations he recognizes as wrong.

Mr Brown:
You can respond the way you best see fit, and I will respond the way I feel appropriate. I'm sorry if I fit an internet cliche for you. Is it really that important? You said I made good points. I posted the way I did knowing the way I would come off and the message was still recieved. He felt the need to slip something down someone's throat, but I guess I needed to jam my response down his for now. (My responses don't fit in peanut butter sandwiches nearly as well as a hit of liquid does :wink: )

As far as this thread representing the character of the shroomery (Milkman), you mean the original post, or the entire thing? I assume the second. I think it represents the site in ways that many threads don't. We've got a situation that is generally looked down upon by members here (my take after having seen a number of these threads), and a whole array of different ways to respond to it, as well as the opinions of the opposing methods. I think it's a nice thread, in that way. Most of us have the same answer, but I'll be damned if we can find the same way to say it.

"But, as was described in the scenario above, there are situations in which a hidden dose of acid can be a good thing."

I don't want to come across as disagreeing with this idea. There's a time, and a place it can be done. My judgement for this situation is on the fact that she quit tripping because she didn't like it, and he said "she needed it". If someone told me I needed a trip, when in a stage of my life where I know I do not, I would explain it to them or shrug it off. If they persisited, I would be frustrated that they can't accept *my* interpretation of my psyche at the moment. If instead of telling me I needed a trip, they decided they'd 'tell me' by putting acid in my food, I would be extremely upset with them. There is no bigger disrespect to me than someone assuming that they know my current consciousness better than myself to this much of an extreme.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Extras: Filter Print Post Top
Invisiblekaniz
That one, overthere.
Male

Registered: 07/23/04
Posts: 4,166
Loc: Ontario
Re: have you ever slipped someone acid? [Re: Koala Koolio]
    #5756354 - 06/16/06 06:02 AM (17 years, 7 months ago)

Heres a story about someone who got slipped acid at a party and didnt know it. I've told this story before. I wasnt at this party myself, and dont know who was responsible for doing it, but I used to know the victem.

- Guy was at a party, having a grand ol time. Never done LSD or shrooms before, maybe smoked a bit of pot and drank a bit.
- Some guys thought "Hey, wouldnt it be funny to slip him some acid?", and put a rather large ammount of LSD into my friends drink
- My friend, then starts to go into a total freakout. Apparently he just totatly lost his shit, total terror trip
- My friend, then dropped off of the face of the earth for about a year. He went to a different school than me (a bunch of my other freinds went to the same school as him though), and they said they'd just see him wandering around the halls, looking spaced, not talking to anyone -- just totaly withdrawn

The kid now has some serious emotional issues, has NEVER been the same since. He may or may not of had some 'mental issues' before he was dosed - but he sure does now.

For awhile, he sort of 'came back' for a bit and started to hangout again, and then after a few years, he dropped off the face of the earth again, and the last a friend of mine saw him, he was wandering around downtown in sandles, eating almonds and refusing to drink anything but maple syrup because he was convinced it gave him the energy he needed. (btw, was the middle of winter - sanldes arnt exactly the most appopiate footwear)

yes, slipping people drugs is funny!


Edited by kaniz (06/16/06 06:03 AM)


Extras: Filter Print Post Top
Offlinesa_mull
Seeker ofKnowledge
Male User Gallery

Registered: 05/24/06
Posts: 144
Loc: IO
Last seen: 6 years, 3 days
Re: have you ever slipped someone acid? [Re: Telepylus]
    #5756379 - 06/16/06 06:32 AM (17 years, 7 months ago)

i think the key words here are....


Quote:

Telepylus said:
my ex-wife




Extras: Filter Print Post Top
Offlinededjam
Electro Penguin
Male

Folding@home Statistics
Registered: 12/14/05
Posts: 2,139
Loc: Moralton, Statesota
Last seen: 12 years, 8 months
Re: have you ever slipped someone acid? [Re: sa_mull]
    #5756486 - 06/16/06 08:02 AM (17 years, 7 months ago)

This just happened the other day...

Guy slipped his g/f acid without her knowing or doing it before.
The go out cruising around the country side, he is sober and just watching her
They get on the interstate and she starts to act kinda strange, but no real problems.
5 minutes later she just started screaming and jumped out the window at 65mph. The guy slams on his breaks and goes and picks up his bloody and almost dead g/f off the road and takes her to the hospital.

As of this morning she was still in a medically induced coma because of the head trauma, and they are pretty sure she is going to have some severe brain damage from hitting the pavement head first at 65mph.

Ask him if it was fun to slip someone acid without them knowing...

Idiots like this are why drugs are and need to remain illegal.


Extras: Filter Print Post Top
InvisibleEntropymancer
 User Gallery
Registered: 07/16/05
Posts: 10,207
Re: have you ever slipped someone acid? [Re: dedjam]
    #5756547 - 06/16/06 08:24 AM (17 years, 7 months ago)

Quote:

gopenguins said:
Idiots like this are why drugs are and need to remain illegal.




Yes, dosing someone without their knowledge is generally wrong, but the fact that people are irresponsible with drugs is no reason to make/keep them illegal. Is it really your government's job to make sure you tie your shoelaces, wipe your ass, look both ways before you cross the street, and always wear your seatbelt (oh wait we already legislated that last one). If you really believe this, I sincerely hope that you aren't a registered voter, and have no children. I ain't down with the government policing my brain.

More related to the original post, my roommate accidentally dosed himself earlier this year. At the back of a box of sugarcubes was one with acid on it (it looked very different from the others due to spending some time in the freezer). Anyway, one morning after drinking a few cups of coffee, he started acting a little off, and said that the coffee was affecting him like a legitimate psychedelic. We both thought he was getting some kind of abnormal reaction from the caffeine he'd drank (he'd proably had 7 or 8 cups of coffee, as I recall). Against his beter jusdgement, he went to his two hour lecture class He managed to sit through most of the class, while things proceeded to get weirder, until he decided he couldn't take it any more and was going to leave early. When he got back home, he was able to enjoy riding the rest of it out, and I remember him saying a couple times "I think this is what it would be like to get randomly dosed with acid." Anyway, a couple months later I was thinking about taking that last acid cube, went looking for it, and figured out what had happened when I saw that it was missing. We both had a good laugh over that one.


Extras: Filter Print Post Top
Offlineva_shroomer
Beginning grower
Male

Registered: 06/04/06
Posts: 135
Loc: Charlottesville
Last seen: 17 years, 5 months
Re: have you ever slipped someone acid? [Re: kaniz]
    #5756606 - 06/16/06 08:59 AM (17 years, 7 months ago)

Quote:

kaniz said:
Heres a story about someone who got slipped acid at a party and didnt know it. I've told this story before. I wasnt at this party myself, and dont know who was responsible for doing it, but I used to know the victem.

- Guy was at a party, having a grand ol time. Never done LSD or shrooms before, maybe smoked a bit of pot and drank a bit.
- Some guys thought "Hey, wouldnt it be funny to slip him some acid?", and put a rather large ammount of LSD into my friends drink
- My friend, then starts to go into a total freakout. Apparently he just totatly lost his shit, total terror trip
- My friend, then dropped off of the face of the earth for about a year. He went to a different school than me (a bunch of my other freinds went to the same school as him though), and they said they'd just see him wandering around the halls, looking spaced, not talking to anyone -- just totaly withdrawn

The kid now has some serious emotional issues, has NEVER been the same since. He may or may not of had some 'mental issues' before he was dosed - but he sure does now.

For awhile, he sort of 'came back' for a bit and started to hangout again, and then after a few years, he dropped off the face of the earth again, and the last a friend of mine saw him, he was wandering around downtown in sandles, eating almonds and refusing to drink anything but maple syrup because he was convinced it gave him the energy he needed. (btw, was the middle of winter - sanldes arnt exactly the most appopiate footwear)

yes, slipping people drugs is funny!




Yeah, that's why it's so despicable to slip people drugs, and especially psychedelics. If you were just sitting there, had never tripped before, and suddenly everything started to breathe and you talk to aliens or whatever . . . what would you think? That can really screw a person up.


--------------------
Do what thou wilt shall be the whole of the law
Love is the law, love under will
--Frater Baphomet


Extras: Filter Print Post Top
Jump to top Pages: < Back | 1 | 2 | 3 | 4 | 5 | Next >  [ show all ]

Shop: Unfolding Nature Unfolding Nature: Being in the Implicate Order   North Spore North Spore Mushroom Grow Kits & Cultivation Supplies   PhytoExtractum Maeng Da Thai Kratom Leaf Powder   Kraken Kratom Red Vein Kratom   Original Sensible Seeds Autoflowering Cannabis Seeds


Similar ThreadsPosterViewsRepliesLast post
* shrooms vs. acid
( 1 2 3 4 all )
starkes 128,617 65 10/27/12 10:10 AM
by Dimethyltryptamine
* Chances of fake acid?
( 1 2 all )
Raiden333 9,019 24 07/17/05 12:21 PM
by archetypal
* J. Coltrane on acid stemmer 2,716 11 09/27/05 06:04 PM
by WillieTomg
* First time acid trip? I don't want to wait. Sherman901 717 10 09/15/05 02:43 PM
by stemmer
* FINALLY I'VE GOT ACID!!!
( 1 2 all )
KidgardFromSRQ 2,219 20 08/01/05 12:08 PM
by icculus_
* Paranoia on ACID?
( 1 2 all )
liftedoff420 5,154 37 08/02/03 09:32 PM
by Gog
* acid revelations HB 7,001 17 10/12/05 09:24 AM
by Apadravya
* 10 hours, 5 hits of acid, Cross texas trip trip.
( 1 2 all )
Evangeliontx 7,415 23 04/22/11 11:03 PM
by occollegeboi

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: psilocybinjunkie, Rose, mushboy, LogicaL Chaos, Northerner, bodhisatta
9,216 topic views. 3 members, 43 guests and 14 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2024 Mind Media. Some rights reserved.

Generated in 0.029 seconds spending 0.009 seconds on 15 queries.