|
 toneloke
Stranger
Registered: 11/21/04
Posts: 38
Last seen: 19 years, 1 month
|
 Cigarettes! 
#3394530 - 11/21/04 08:24 PM (19 years, 4 months ago) |
|
|
To smoke or not to smoke, that is the question.
|
lilbil
republican hippy(only one)
Registered: 10/09/04
Posts: 114
Loc: Montana, usa
Last seen: 19 years, 3 months
|
Re: Cigarettes! [Re: toneloke]
#3394602 - 11/21/04 08:39 PM (19 years, 4 months ago) |
|
|
what!!!!!! cig are the shit, fuck you guys if you dont want them, give them to me 
--------------------
----------------------------------------------
if ignorance is bliss, then sadly my mom and dad are very happy......
|
Anonymous
|
Re: Cigarettes! [Re: toneloke]
#3396610 - 11/23/04 12:54 AM (19 years, 4 months ago) |
|
|
This poll is a little extreme. Everything in moderation, I say.
|
 silversoul7
Chill the FuckOut!
Registered: 10/10/02
Posts: 27,301
Loc: mndfreeze's puppet army
|
Re: Cigarettes! [Re: ]
#3396875 - 11/23/04 02:24 AM (19 years, 4 months ago) |
|
|
Quote:
Max Headroom said:
This poll is a little extreme. Everything in moderation, I say.
--------------------
 
"It is dangerous to be right when the government is wrong."--Voltaire
|
Super_Blunt
Candyman
Registered: 10/25/04
Posts: 3,140
|
|
I don't know I'd smoke 10 cigarettes at once if i had the money 
at $9.00 a pack, this is only a fantasy of mine.
--------------------
|
Locus
Registered: 03/11/04
Posts: 6,112
Last seen: 3 years, 20 days
|
Re: Cigarettes! [Re: toneloke]
#3396994 - 11/23/04 03:30 AM (19 years, 4 months ago) |
|
|
to me, they're stupid and no point really in smoking them, no offense to the smokers though.
--------------------
The important thing is not to stop questioning. Curiosity has its own reason for existing. One cannot help but be in awe when he contemplates the mysteries of eternity, of life, of the marvelous structure of reality. It is enough if one tries merely to comprehend a little of this mystery every day. Never lose a holy curiosity. ~ Albert Einstein
"Fear is the great barrier to human growth." ~ Dr. Robert Monroe
~~~*Dosis sola facit venenum*~~~
*Check my profile to listen to my music* 
|
Psilostylin
Captain Save Em'
Registered: 03/13/04
Posts: 678
Loc: New Orleans!
|
Re: Cigarettes! [Re: Locus]
#3397137 - 11/23/04 05:14 AM (19 years, 4 months ago) |
|
|
$9 a pack! christ, dude, why even smoke? you could get a bag of weed for the price of 2 packs. around here cigarettes are from $2.75 to $4.00. i smoke way too much. i hate cigarettes.
a good addition to this poll would be... 'what brand of cigarettes do you smoke?' personally i smoke camel...but normally when i'm low on funds (which is most of the time), i smoke bronco's. a cheap columbian brand of smokes sold at $2.00 a pack. horible quality, but, when ya need a joe, it does the trick.
|
CaRnAgECaNdY
Tool's groupie
Registered: 04/09/04
Posts: 11,505
Loc: Billy Howerdel's closet 
Last seen: 9 months, 8 days
|
Re: Cigarettes! [Re: toneloke]
#3397312 - 11/23/04 07:39 AM (19 years, 4 months ago) |
|
|
I used to smoke. I quit awhile back. I don't miss them at all, then again I didn't smoke that much to begin with. I only would smoke about 3 cigs a day.
--------------------
The secret to being funny is to say smart things stupidly, or is it stupid things smartly? Whatever..it's not rocket surgery...or something like that.
|
XbollweevilX
Student
Registered: 04/09/06
Posts: 174
Last seen: 12 years, 2 months
|
|
It's a love hate relationship.
--------------------
There is no such thing as a civilian.
|
whatever123
Whatever I did, I'm sorry
Registered: 04/07/05
Posts: 2,613
Loc: San Diego, CA
Last seen: 5 years, 9 months
|
Re: Cigarettes! [Re: toneloke]
#5712206 - 06/04/06 06:20 PM (17 years, 10 months ago) |
|
|
Christ, I really dislike these polls. How about this?
If you don't smoke, don't vote in the second poll.
--------------------
Koala Koolio said:
there should be a 3 month waiting period between registration and posting. 
Edited by whatever123 (06/04/06 06:21 PM)
|
Le_Canard
The Duk Abides
Registered: 05/16/03
Posts: 94,392
Loc: Earthfarm 1 
|
Re: Cigarettes! [Re: toneloke]
#5713054 - 06/04/06 10:12 PM (17 years, 10 months ago) |
|
|
I smoke 'em. Wish I didn't though. I'm hooked like a big dog. 
|
whatever123
Whatever I did, I'm sorry
Registered: 04/07/05
Posts: 2,613
Loc: San Diego, CA
Last seen: 5 years, 9 months
|
Re: Cigarettes! [Re: Le_Canard]
#5713584 - 06/05/06 12:34 AM (17 years, 10 months ago) |
|
|
My poll > your poll
--------------------
Koala Koolio said:
there should be a 3 month waiting period between registration and posting.
|
PSylopHiLe
stoner
Registered: 06/04/06
Posts: 86
Last seen: 17 years, 4 months
|
|
I am a former smoker and i have been clean for a month with no desire for a cigarette. All i can say is that it is a nasty, expensive habit.
--------------------
"Try not to let your mind wander, it might not come back"
|
deadheadjpc2000
Blade
Registered: 02/27/06
Posts: 1,277
Loc: Emerald Triangle, U.S.A.
Last seen: 15 years, 8 months
|
|
And former smokers are the worst...
|
Koala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG
Registered: 01/07/04
Posts: 7,752
|
|
Yeah, that first poll was damn terrible.
How about a "have you ever tried to quit? how the hell did that go?" poll.
--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!
|
Maverick
Lover of Earwigs!
Registered: 12/18/05
Posts: 13,443
Loc: Valleys of Willamette
Last seen: 1 day, 11 hours
|
|
I finally quit smoking I think. I quit about a week ago. Should I pick it up again? ;P
|
Ekstaza
stranger than most
Registered: 04/10/03
Posts: 4,324
Loc: Around the corner
Last seen: 1 year, 15 days
|
Re: Cigarettes! [Re: Maverick]
#5747651 - 06/13/06 10:19 PM (17 years, 10 months ago) |
|
|
Let's see, I started smoking at about age 12 and quit for a year when I was in high school. I started back because I wanted to date this chick who smoked. Real DUMB. I smoked from then on(except for 2 months when Uncle Sam had control of it) to the age of about 25 when I used the nicotine lozenges to kick the habit for another year. New Years Eve '03 was a blast. Lots of X and plenty of smokes. Newports go so well with MDMA. It's been off and on since then sometimes making it to the 6 month point only to give in while drunk. At the moment, I'm off of them with every intention of staying quitter. That reminds me, I NEED ANOTHER NICOTINE LOZENGE!
True Story
--------------------
YOUR EXPERIENCE WITH ANY GIVEN DRUG ISN'T THE DEFINITIVE MEASURE OF THE DRUGS EFFECTS.
|
vintage_gonzo
Stranger
Registered: 04/08/06
Posts: 457
Last seen: 16 years, 1 month
|
Re: Cigarettes! [Re: Ekstaza]
#5747670 - 06/13/06 10:24 PM (17 years, 10 months ago) |
|
|
i smoke cloves. they give a much greater buzz that marlboro lights ever did and taste better
|
Koala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG
Registered: 01/07/04
Posts: 7,752
|
|
... and are much worse for you.
--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!
|
Iamthewalrus
every evening Idied and everynight I wasreborn
Registered: 03/24/04
Posts: 3,744
Loc: Ontario
Last seen: 15 years, 6 months
|
|
I smoke but want to quit
|
|
Threaded
Previous
Index
Next
Autoflowering Cannabis Seeds, Bulk Cannabis Seeds 
Golden Teacher Liquid Culture For Sale
Edit 
Reply 
1 2 all )
Lifenergy
Effed
TheHateCamel
lilbil
TODAY
Jackal
ZippoZ
Ravus