Home | Community | Message Board

MRCA Tyroler Gluckspilze
This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Shop: Kraken Kratom Red Vein Kratom   PhytoExtractum Maeng Da Thai Kratom Leaf Powder   Unfolding Nature Unfolding Nature: Being in the Implicate Order   Left Coast Kratom Buy Kratom Extract   North Spore Cultivation Supplies   Original Sensible Seeds Bulk Cannabis Seeds

Jump to first unread post Pages: 1 | 2 | Next >  [ show all ]
InvisibleAmatoxin
Injected With A Poison

Folding@home Statistics
Registered: 03/27/05
Posts: 1,934
Loc: Not So Great Britain
why are you here???
    #5742598 - 06/12/06 04:58 PM (17 years, 7 months ago)

explain


--------------------




Sectioned Under The Mental Health Act Sat 20-10-07 to Thurs 01-11-07 for playing TECHNO music


Extras: Filter Print Post Top
Invisiblepac_man
~
Registered: 05/01/06
Posts: 200
Re: why are you here??? [Re: Amatoxin]
    #5742603 - 06/12/06 05:00 PM (17 years, 7 months ago)

.


Edited by pac_man (06/17/06 09:41 AM)


Extras: Filter Print Post Top
InvisibleShroomismM
Space Travellin
Male User Gallery
Folding@home Statistics
Registered: 02/13/00
Posts: 66,015
Loc: 9th Dimension Flag
Re: why are you here??? [Re: Amatoxin]
    #5742611 - 06/12/06 05:00 PM (17 years, 7 months ago)

interact, learn, share, evolve. same reasons I live.


--------------------


Extras: Filter Print Post Top
Offlinetallgreen
chillin like avillain
 User Gallery
Registered: 05/21/06
Posts: 293
Last seen: 17 years, 4 months
Re: why are you here??? [Re: Shroomism]
    #5742623 - 06/12/06 05:03 PM (17 years, 7 months ago)

To learn about mycology, duh.

And also I get bored and just like chatting with weirdos. :psychsplit:


--------------------
Nothing you can know that isn't known.
Nothing you can see that isn't shown.
Nowhere you can be that isn't where you're meant to be.
It's easy.
All you need is love.
- The Beatles


Extras: Filter Print Post Top
OfflineUlcerPentacidis
psilophile

Registered: 01/14/04
Posts: 969
Last seen: 16 years, 1 month
Re: why are you here??? [Re: Amatoxin]
    #5742636 - 06/12/06 05:07 PM (17 years, 7 months ago)

To read all the ridiculous posts about excessive drug use, criminal behaviour, betrayal, robbery, and all around dumb-fuckery.


--------------------
µgrammar


Extras: Filter Print Post Top
Invisibleking_cobra
Stranger
 User Gallery

Registered: 02/27/05
Posts: 2,752
Re: why are you here??? [Re: UlcerPentacidis]
    #5742644 - 06/12/06 05:09 PM (17 years, 7 months ago)

good question.


--------------------


Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: why are you here??? [Re: king_cobra]
    #5742651 - 06/12/06 05:14 PM (17 years, 7 months ago)

Fuck... I don't know? Very little willpower?

I have things I should be doing. I'm going to leave.





Fuck, no. I probably won't.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Extras: Filter Print Post Top
InvisiblePapaverS
Madmin Emeritus?

Registered: 06/01/02
Posts: 26,880
Loc: Radio Free Tibet!
Re: why are you here??? [Re: Amatoxin]
    #5742656 - 06/12/06 05:15 PM (17 years, 7 months ago)

Here in the Pub? Here at the Shroomery? Or here on this terrestrial plain, this mortal coil, this feast of worms?

Since I don't know, I'll answer the questions in that order...

1a) Today: for all the bitchy posts about how the pub is becoming gay from people who don't make the effort to improve it by actually participating and making it better...

1b) Because it's a cool forum, with cool people, and the necessary yin to OTD's yang. Despite it's sometimes bitchiness, but I guess that's part of being yin especially when its in "red tide" cycle...

2) Originally for mycology; later for fun and fellowship; later for service to this community; now for fun and fellowship...

3) I'm not really sure. Many great mind have speculated about this, but like string theory, which operates on the planck-scale, we do not yet posses the equipment necessary observe the actual phenomena from enough different angles to contextualize it and quantify it...


--------------------


Extras: Filter Print Post Top
InvisibleRipple
Ripple
Male User Gallery

Folding@home Statistics
Registered: 05/16/02
Posts: 21,014
Loc: the timbers of Fennario
Re: why are you here??? [Re: Papaver]
    #5742661 - 06/12/06 05:16 PM (17 years, 7 months ago)

I just followed Pappy?


--------------------
The bus came by and I got on that's when it all began!



Extras: Filter Print Post Top
Offlineshirley knott
not my real name
 User Gallery
Registered: 11/11/02
Posts: 9,105
Loc: London Flag
Last seen: 7 years, 28 days
Re: why are you here??? [Re: Amatoxin]
    #5742668 - 06/12/06 05:19 PM (17 years, 7 months ago)

drugs and drink addled my brain - it's like swiss cheese now - so all i could do was follow pappy toward the lights


--------------------
buh


Extras: Filter Print Post Top
InvisiblePapaverS
Madmin Emeritus?

Registered: 06/01/02
Posts: 26,880
Loc: Radio Free Tibet!
Re: why are you here??? [Re: shirley knott]
    #5742681 - 06/12/06 05:22 PM (17 years, 7 months ago)

Ripmeister! :laugh:

Hey, Shirl! Long time no see. How's it going? :smile:


--------------------


Extras: Filter Print Post Top
OfflineDeadmaker
Stranger
Male User Gallery

Registered: 02/09/05
Posts: 5,471
Last seen: 2 months, 5 days
Re: why are you here??? [Re: Amatoxin]
    #5742692 - 06/12/06 05:26 PM (17 years, 7 months ago)

Because my parents fucked.


Extras: Filter Print Post Top
OfflineSnaggletooth
Stranger in a Strange Land
Male User Gallery

Registered: 10/24/05
Posts: 6,109
Loc: blinks stupidly
Last seen: 6 years, 8 months
Re: why are you here??? [Re: Papaver]
    #5742697 - 06/12/06 05:27 PM (17 years, 7 months ago)

Quote:

Papaver said:
3) I'm not really sure. Many great mind have speculated about this, but like string theory, which operates on the planck-scale, we do not yet posses the equipment necessary observe the actual phenomena from enough different angles to contextualize it and quantify it...





I would have to agree with that, though I couldn't have put it like that or this,


Quote:

"I may not have gone where I intended to go, but I think I have ended up where I intended to be."




--------------------


Atheist Chat


Extras: Filter Print Post Top
OfflinePinballWizard
Naive and Gullible as usual

Registered: 03/20/04
Posts: 2,804
Last seen: 9 years, 9 months
Re: why are you here??? [Re: Amatoxin]
    #5742723 - 06/12/06 05:34 PM (17 years, 7 months ago)

Inbreeding


Extras: Filter Print Post Top
InvisibleColonel Kurtz Ph.D
What What?
Male User Gallery
Registered: 07/22/04
Posts: 11,113
Loc: Shadow Moses
Re: why are you here??? [Re: Amatoxin]
    #5742760 - 06/12/06 05:44 PM (17 years, 7 months ago)

Quote:

Amatoxin said:
explain




My mommy likes to have sex with older men, and I like to grow mushrooms and trip. All in all great fun, specially for the older men.


--------------------
:whatwhat:

There's no better way to rock out than with your cock out!!


Extras: Filter Print Post Top
Offlinemikeownow
Humungus fungus

Registered: 09/01/05
Posts: 2,856
Loc: WA,USA
Last seen: 17 years, 3 months
Re: why are you here??? [Re: Colonel Kurtz Ph.D]
    #5742905 - 06/12/06 06:20 PM (17 years, 7 months ago)

I am here to support terrorism duh


--------------------
No statements made in any post or message by myself should be construed to mean that I am now, or have ever been, participating in or considering participation in any activities in violation of any local, state, or federal laws. All posts are works of fiction.


Extras: Filter Print Post Top
InvisibleAlteredAgain
Visual Alchemist
 User Gallery

Registered: 04/27/06
Posts: 11,181
Loc: Solar Circuit
Re: why are you here??? [Re: Amatoxin]
    #5744996 - 06/13/06 06:44 AM (17 years, 7 months ago)

the flap of a butterfly's wing three millenia ago made the necessary sequence of historical events possible to lead up to a genetic fusion..

but that's not the real reason why i'm here.


--------------------


Extras: Filter Print Post Top
Offlineeris
underground
Male User Gallery

Registered: 11/17/98
Posts: 48,024
Loc: North East, USA
Last seen: 4 months, 18 days
Re: why are you here??? [Re: Amatoxin]
    #5745006 - 06/13/06 07:07 AM (17 years, 7 months ago)

If you have read any of my mycology related posts, you will know why.

Another reason would include to socialize. I do a lot of community posting, which is off of the topic of mushrooms.


--------------------
Immortal / Temporarily Retired
The OG Thread Killer
My mushroom hunting gallery


Extras: Filter Print Post Top
InvisibleMike_yy
Male User Gallery

Registered: 10/28/05
Posts: 7,253
Re: why are you here??? [Re: eris]
    #5745101 - 06/13/06 08:37 AM (17 years, 7 months ago)

The site is multi functional and relates often to things i am doing.

Whether its drug related information purposes, chilling out, having a rant, sharing things, help after ive been out on a hunt, helping with my new hobby.
Its pretty funny too and the people are intelligent.

Its full of people that i relate too so thats why i keep coming back everyday, if it didn't have that it would just be a source of information. :smile: :thumbup:


Extras: Filter Print Post Top
OfflineClammyJoe
Azurescen Head
Male

Folding@home Statistics
Registered: 11/03/05
Posts: 3,691
Loc: PNW
Last seen: 11 years, 1 month
Re: why are you here??? [Re: Amatoxin]
    #5745109 - 06/13/06 08:43 AM (17 years, 7 months ago)

The people here.


Extras: Filter Print Post Top
Jump to top Pages: 1 | 2 | Next >  [ show all ]

Shop: Kraken Kratom Red Vein Kratom   PhytoExtractum Maeng Da Thai Kratom Leaf Powder   Unfolding Nature Unfolding Nature: Being in the Implicate Order   Left Coast Kratom Buy Kratom Extract   North Spore Cultivation Supplies   Original Sensible Seeds Bulk Cannabis Seeds


Similar ThreadsPosterViewsRepliesLast post
* Perry Bible Fellowship Konnrade 1,546 15 02/10/06 12:38 AM
by Konnrade
* Perry Bible Fellowship splifner180 992 12 07/25/06 05:19 PM
by drtyfrnk
* CNN.com: "Shroomery - Best Mycological Resource on Net?"
( 1 2 3 4 all )
HB 13,217 72 11/19/03 03:27 PM
by Earth_Droid
* help with mycological site for a 10 year old........ ChromeCrow 2,180 13 12/24/03 07:45 AM
by Ripple
* My mycology professor might crap his pants next week Gumby 2,605 16 02/03/09 11:52 AM
by Gumby
* Mycology? electronicmaji 1,464 12 04/28/08 04:50 PM
by zouden
* mycology career sHrOoMaCiDe 1,485 10 08/13/07 08:25 PM
by badchad
* Unfair treatment of disabled man by a Mycological company owner! Need to read!
( 1 2 all )
truthforall 5,319 31 05/13/08 10:12 AM
by niteowl

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: Entire Staff
716 topic views. 7 members, 56 guests and 49 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2024 Mind Media. Some rights reserved.

Generated in 0.033 seconds spending 0.011 seconds on 16 queries.