|
Amatoxin
Injected With A Poison


Registered: 03/27/05
Posts: 1,934
Loc: Not So Great Britain
|
why are you here???
#5742598 - 06/12/06 04:58 PM (17 years, 7 months ago) |
|
|
explain
--------------------
Sectioned Under The Mental Health Act Sat 20-10-07 to Thurs 01-11-07 for playing TECHNO music
|
pac_man
~
Registered: 05/01/06
Posts: 200
|
Re: why are you here??? [Re: Amatoxin]
#5742603 - 06/12/06 05:00 PM (17 years, 7 months ago) |
|
|
.
Edited by pac_man (06/17/06 09:41 AM)
|
Shroomism
Space Travellin


Registered: 02/13/00
Posts: 66,015
Loc: 9th Dimension
|
Re: why are you here??? [Re: Amatoxin]
#5742611 - 06/12/06 05:00 PM (17 years, 7 months ago) |
|
|
interact, learn, share, evolve. same reasons I live.
--------------------
|
tallgreen
chillin like avillain

Registered: 05/21/06
Posts: 293
Last seen: 17 years, 4 months
|
Re: why are you here??? [Re: Shroomism]
#5742623 - 06/12/06 05:03 PM (17 years, 7 months ago) |
|
|
To learn about mycology, duh.
And also I get bored and just like chatting with weirdos.
-------------------- Nothing you can know that isn't known. Nothing you can see that isn't shown. Nowhere you can be that isn't where you're meant to be. It's easy. All you need is love. - The Beatles
|
UlcerPentacidis
psilophile

Registered: 01/14/04
Posts: 969
Last seen: 16 years, 1 month
|
Re: why are you here??? [Re: Amatoxin]
#5742636 - 06/12/06 05:07 PM (17 years, 7 months ago) |
|
|
To read all the ridiculous posts about excessive drug use, criminal behaviour, betrayal, robbery, and all around dumb-fuckery.
-------------------- µgrammar
|
king_cobra
Stranger


Registered: 02/27/05
Posts: 2,752
|
|
good question.
--------------------
|
Koala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
|
Re: why are you here??? [Re: king_cobra]
#5742651 - 06/12/06 05:14 PM (17 years, 7 months ago) |
|
|
Fuck... I don't know? Very little willpower?
I have things I should be doing. I'm going to leave.
Fuck, no. I probably won't.
-------------------- You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!
|
Papaver
Madmin Emeritus?

Registered: 06/01/02
Posts: 26,880
Loc: Radio Free Tibet!
|
Re: why are you here??? [Re: Amatoxin]
#5742656 - 06/12/06 05:15 PM (17 years, 7 months ago) |
|
|
Here in the Pub? Here at the Shroomery? Or here on this terrestrial plain, this mortal coil, this feast of worms?
Since I don't know, I'll answer the questions in that order...
1a) Today: for all the bitchy posts about how the pub is becoming gay from people who don't make the effort to improve it by actually participating and making it better...
1b) Because it's a cool forum, with cool people, and the necessary yin to OTD's yang. Despite it's sometimes bitchiness, but I guess that's part of being yin especially when its in "red tide" cycle...
2) Originally for mycology; later for fun and fellowship; later for service to this community; now for fun and fellowship...
3) I'm not really sure. Many great mind have speculated about this, but like string theory, which operates on the planck-scale, we do not yet posses the equipment necessary observe the actual phenomena from enough different angles to contextualize it and quantify it...
--------------------
|
Ripple
Ripple



Registered: 05/16/02
Posts: 21,014
Loc: the timbers of Fennario
|
Re: why are you here??? [Re: Papaver]
#5742661 - 06/12/06 05:16 PM (17 years, 7 months ago) |
|
|
I just followed Pappy?
-------------------- The bus came by and I got on that's when it all began!
|
shirley knott
not my real name

Registered: 11/11/02
Posts: 9,105
Loc: London
Last seen: 7 years, 28 days
|
Re: why are you here??? [Re: Amatoxin]
#5742668 - 06/12/06 05:19 PM (17 years, 7 months ago) |
|
|
drugs and drink addled my brain - it's like swiss cheese now - so all i could do was follow pappy toward the lights
-------------------- buh
|
Papaver
Madmin Emeritus?

Registered: 06/01/02
Posts: 26,880
Loc: Radio Free Tibet!
|
|
Ripmeister! 
Hey, Shirl! Long time no see. How's it going?
--------------------
|
Deadmaker
Stranger


Registered: 02/09/05
Posts: 5,471
Last seen: 2 months, 5 days
|
Re: why are you here??? [Re: Amatoxin]
#5742692 - 06/12/06 05:26 PM (17 years, 7 months ago) |
|
|
Because my parents fucked.
|
Snaggletooth
Stranger in a Strange Land


Registered: 10/24/05
Posts: 6,109
Loc: blinks stupidly
Last seen: 6 years, 8 months
|
Re: why are you here??? [Re: Papaver]
#5742697 - 06/12/06 05:27 PM (17 years, 7 months ago) |
|
|
Quote:
Papaver said: 3) I'm not really sure. Many great mind have speculated about this, but like string theory, which operates on the planck-scale, we do not yet posses the equipment necessary observe the actual phenomena from enough different angles to contextualize it and quantify it...
I would have to agree with that, though I couldn't have put it like that or this,
Quote:
"I may not have gone where I intended to go, but I think I have ended up where I intended to be."
--------------------
Atheist Chat
|
PinballWizard
Naive and Gullible as usual

Registered: 03/20/04
Posts: 2,804
Last seen: 9 years, 9 months
|
Re: why are you here??? [Re: Amatoxin]
#5742723 - 06/12/06 05:34 PM (17 years, 7 months ago) |
|
|
Inbreeding
|
Colonel Kurtz Ph.D
What What?

Registered: 07/22/04
Posts: 11,113
Loc: Shadow Moses
|
Re: why are you here??? [Re: Amatoxin]
#5742760 - 06/12/06 05:44 PM (17 years, 7 months ago) |
|
|
Quote:
Amatoxin said: explain
My mommy likes to have sex with older men, and I like to grow mushrooms and trip. All in all great fun, specially for the older men.
--------------------
There's no better way to rock out than with your cock out!!
|
mikeownow
Humungus fungus

Registered: 09/01/05
Posts: 2,856
Loc: WA,USA
Last seen: 17 years, 3 months
|
|
I am here to support terrorism duh
-------------------- No statements made in any post or message by myself should be construed to mean that I am now, or have ever been, participating in or considering participation in any activities in violation of any local, state, or federal laws. All posts are works of fiction.
|
AlteredAgain
Visual Alchemist


Registered: 04/27/06
Posts: 11,181
Loc: Solar Circuit
|
Re: why are you here??? [Re: Amatoxin]
#5744996 - 06/13/06 06:44 AM (17 years, 7 months ago) |
|
|
the flap of a butterfly's wing three millenia ago made the necessary sequence of historical events possible to lead up to a genetic fusion..
but that's not the real reason why i'm here.
--------------------
|
eris
underground


Registered: 11/17/98
Posts: 48,024
Loc: North East, USA
Last seen: 4 months, 18 days
|
Re: why are you here??? [Re: Amatoxin]
#5745006 - 06/13/06 07:07 AM (17 years, 7 months ago) |
|
|
If you have read any of my mycology related posts, you will know why.
Another reason would include to socialize. I do a lot of community posting, which is off of the topic of mushrooms.
-------------------- Immortal / Temporarily Retired The OG Thread Killer My mushroom hunting gallery
|
Mike_yy


Registered: 10/28/05
Posts: 7,253
|
Re: why are you here??? [Re: eris]
#5745101 - 06/13/06 08:37 AM (17 years, 7 months ago) |
|
|
The site is multi functional and relates often to things i am doing.
Whether its drug related information purposes, chilling out, having a rant, sharing things, help after ive been out on a hunt, helping with my new hobby. Its pretty funny too and the people are intelligent.
Its full of people that i relate too so thats why i keep coming back everyday, if it didn't have that it would just be a source of information.
|
ClammyJoe
Azurescen Head



Registered: 11/03/05
Posts: 3,691
Loc: PNW
Last seen: 11 years, 1 month
|
Re: why are you here??? [Re: Amatoxin]
#5745109 - 06/13/06 08:43 AM (17 years, 7 months ago) |
|
|
The people here.
|
|