Home | Community | Message Board

Original Seeds Store
This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Shop: Unfolding Nature Unfolding Nature: Being in the Implicate Order   North Spore North Spore Mushroom Grow Kits & Cultivation Supplies   PhytoExtractum Buy Bali Kratom Powder   Original Sensible Seeds Bulk Cannabis Seeds   Mushroom-Hut Substrate Bags   Left Coast Kratom Buy Kratom Extract   Bridgetown Botanicals Bridgetown Botanicals

Jump to first unread post Pages: 1
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
Offlinejohndoeradio
Voice in theClouds
Male User Gallery

Registered: 05/21/06
Posts: 41
Last seen: 16 years, 11 months
BAD COMPANY
    #5731036 - 06/09/06 02:54 PM (17 years, 7 months ago)

Check out this email i got from univesity scientific, sporebabk, etc . I only post it because i want everyone to know what kind of crappy company they are. And for the record my order WAS incomplete......... STAY WITH SHROOMERY SPONSORS.

Their response to my 3rd concerned email"
"PLEASE DO tell as many people as you can about our company. After reading
through this ticket, I've decided to give you an "A+" for ASSHOLE. There's no
making you happy, you're just one of those kinds of people. Sometimes you even
have to fire CLIENTS. You're FIRED!

You have a radio show?! Bullshit, you're too stupid to have a job."


My show will address this, and it does reach over 30,000 listeners daily.


Extras: Filter Print Post Top
InvisibleRoadkillM
Retired Shroomery Mod
Male User Gallery

Registered: 12/11/01
Posts: 22,674
Loc: Montana
Re: BAD COMPANY [Re: johndoeradio]
    #5731056 - 06/09/06 02:59 PM (17 years, 7 months ago)

lolzz

you gonna tell your listeners that you grow shrooms?

you have more balls than me...my friend!~

and I'm pretty open about my life style.



tc


--------------------
Laterz, Road

Who the hell you callin crazy?
You wouldn't know what crazy was if Charles Manson was eating froot loops on your front porch!


Brainiac said:
PM the names with on there names, that means they have mushrooms for sale.



Extras: Filter Print Post Top
Offlinejohndoeradio
Voice in theClouds
Male User Gallery

Registered: 05/21/06
Posts: 41
Last seen: 16 years, 11 months
Re: BAD COMPANY [Re: Roadkill]
    #5731069 - 06/09/06 03:02 PM (17 years, 7 months ago)

COME ON ROADKILL!!!! im smarter than that, i just was looking for consumer related info. Going through the motions, I NEVER EVER said i grow, to the listeners.

But i do have some big balls, you gotta to HOLD UP OUR FREEDOMS.

Ijust wish i could find a good valid phone number for these guys. I might even fly to one of their offices on the company dime. These guys are horrible. Ive never, in the thousands of consumer studies ive done had a return answer from a company like that.


Edited by johndoeradio (06/09/06 03:04 PM)


Extras: Filter Print Post Top
Offlinejohndoeradio
Voice in theClouds
Male User Gallery

Registered: 05/21/06
Posts: 41
Last seen: 16 years, 11 months
Re: BAD COMPANY [Re: johndoeradio]
    #5731364 - 06/09/06 04:38 PM (17 years, 7 months ago)

just got this back from em.....

JOHNDOE,

The only thing that you're able to reach is your prick. Is everybody else that
you run into either in person or online, actually impressed when you tell them
that you have a radio program? Nobody here is phased either way. You come off
sounding like a kid that's out to sound like he's a BIG SHOT. Really man, go
back to your cable access radio buddies and pick another subject to talk about
there, or go ahead and harp on this subject. It doesn't really matter, now does
it?

Now, just for shits and grins, what kind of ciculation does your radio show get?
Let me know and if it's worth our while, I'll phone you during A LIVE SHOW and
go toe to toe with your simple ass. I'd be more than happy to explain our
company's position on your laughable attempt to play reporter. Go play
somewhere else.

Bye, JohnDoe.


ps..... I guess im not a real reporter, ah welll. HAHA. anyone wanting info can contact me or can ask for my contributions to many news agencies, including THE Associated Press (AP) i prolly wont even give these people the time of day anymore. They are just too unprofessional, itll bring me down.


Edited by johndoeradio (06/09/06 04:57 PM)


Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: BAD COMPANY [Re: johndoeradio]
    #5731970 - 06/09/06 08:07 PM (17 years, 7 months ago)

Besides your security, I simply wouldn't bring more public attention to the issue of mushroom spores online, etc.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Extras: Filter Print Post Top
InvisibleBurke Dennings
baby merchant

Registered: 11/29/04
Posts: 81,641
Re: BAD COMPANY [Re: johndoeradio]
    #5733015 - 06/10/06 01:51 AM (17 years, 7 months ago)

While you're at it, you should get MycoShackJ and MycoShackC on your radio show.


Extras: Filter Print Post Top
OfflinemotamanM
old hand
 User Gallery
Registered: 12/18/02
Posts: 6,047
Last seen: 12 days, 6 hours
Re: BAD COMPANY [Re: johndoeradio]
    #5733180 - 06/10/06 03:22 AM (17 years, 7 months ago)

Then next time this US crap comes up afer i lock this thread, untill I discuss this with my coleages, will receve a warning.. :smirk:


--------------------
http://heffter.org


Extras: Filter Print Post Top
Offlinedoodoomaster
Life's still good
Male User Gallery

Registered: 06/02/06
Posts: 393
Loc: The united states of Gene...
Last seen: 14 years, 1 month
Re: BAD COMPANY [Re: Koala Koolio]
    #5733181 - 06/10/06 03:23 AM (17 years, 7 months ago)

Quote:

Koala Koolio said:
Besides your security, I simply wouldn't bring more public attention to the issue of mushroom spores online, etc.





This is all that is going through my mind. Let it go, they will get what is coming to them.


--------------------
For all you passive aggressive types.  Fuck you, kind of.


Extras: Filter Print Post Top
OfflinemotamanM
old hand
 User Gallery
Registered: 12/18/02
Posts: 6,047
Last seen: 12 days, 6 hours
Re: BAD COMPANY [Re: johndoeradio]
    #5733189 - 06/10/06 03:27 AM (17 years, 7 months ago)

This thread has been closed.

Reason:
z


Extras: Filter Print Post Top
Jump to top Pages: 1

Shop: Unfolding Nature Unfolding Nature: Being in the Implicate Order   North Spore North Spore Mushroom Grow Kits & Cultivation Supplies   PhytoExtractum Buy Bali Kratom Powder   Original Sensible Seeds Bulk Cannabis Seeds   Mushroom-Hut Substrate Bags   Left Coast Kratom Buy Kratom Extract   Bridgetown Botanicals Bridgetown Botanicals


Similar ThreadsPosterViewsRepliesLast post
* syringe company cheech101 1,756 13 06/11/03 02:46 PM
by cheech101
* Whats a reputable company to order spore syringes from?
( 1 2 all )
newbie420 3,895 26 05/23/03 09:24 PM
by Roadkill
* NEW SPORE COMPANY...$3 each + FREE TRADE!!! shane67 2,979 1 08/08/02 06:09 PM
by Anno
* Bad Vendor Alert mjshroomer 1,995 13 09/05/02 09:13 PM
by Jammer
* Bad luck mike 914 8 01/28/03 04:26 PM
by Snobrdr311
* The mushroom company Semilanceata 570 3 12/27/03 01:59 AM
by Semilanceata
* Vendor bad batch question? egolesss 2,209 16 04/24/02 08:00 PM
by Anonymous
* bad trader forum- GaNjAShRooM 1,276 5 04/11/02 09:22 PM
by LSD_4me

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: geokills, motaman
947 topic views. 0 members, 2 guests and 0 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2024 Mind Media. Some rights reserved.

Generated in 0.021 seconds spending 0.007 seconds on 14 queries.