|
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
|
johndoeradio
Voice in theClouds


Registered: 05/21/06
Posts: 41
Last seen: 16 years, 11 months
|
BAD COMPANY
#5731036 - 06/09/06 02:54 PM (17 years, 7 months ago) |
|
|
Check out this email i got from univesity scientific, sporebabk, etc . I only post it because i want everyone to know what kind of crappy company they are. And for the record my order WAS incomplete......... STAY WITH SHROOMERY SPONSORS.
Their response to my 3rd concerned email" "PLEASE DO tell as many people as you can about our company. After reading through this ticket, I've decided to give you an "A+" for ASSHOLE. There's no making you happy, you're just one of those kinds of people. Sometimes you even have to fire CLIENTS. You're FIRED!
You have a radio show?! Bullshit, you're too stupid to have a job."
My show will address this, and it does reach over 30,000 listeners daily.
|
Roadkill
Retired Shroomery Mod


Registered: 12/11/01
Posts: 22,674
Loc: Montana
|
|
lolzz
you gonna tell your listeners that you grow shrooms?
you have more balls than me...my friend!~
and I'm pretty open about my life style.
tc
-------------------- Laterz, Road Who the hell you callin crazy? You wouldn't know what crazy was if Charles Manson was eating froot loops on your front porch! Brainiac said: PM the names with on there names, that means they have mushrooms for sale.
|
johndoeradio
Voice in theClouds


Registered: 05/21/06
Posts: 41
Last seen: 16 years, 11 months
|
Re: BAD COMPANY [Re: Roadkill]
#5731069 - 06/09/06 03:02 PM (17 years, 7 months ago) |
|
|
COME ON ROADKILL!!!! im smarter than that, i just was looking for consumer related info. Going through the motions, I NEVER EVER said i grow, to the listeners.
But i do have some big balls, you gotta to HOLD UP OUR FREEDOMS.
Ijust wish i could find a good valid phone number for these guys. I might even fly to one of their offices on the company dime. These guys are horrible. Ive never, in the thousands of consumer studies ive done had a return answer from a company like that.
Edited by johndoeradio (06/09/06 03:04 PM)
|
johndoeradio
Voice in theClouds


Registered: 05/21/06
Posts: 41
Last seen: 16 years, 11 months
|
|
just got this back from em.....
JOHNDOE,
The only thing that you're able to reach is your prick. Is everybody else that you run into either in person or online, actually impressed when you tell them that you have a radio program? Nobody here is phased either way. You come off sounding like a kid that's out to sound like he's a BIG SHOT. Really man, go back to your cable access radio buddies and pick another subject to talk about there, or go ahead and harp on this subject. It doesn't really matter, now does it?
Now, just for shits and grins, what kind of ciculation does your radio show get? Let me know and if it's worth our while, I'll phone you during A LIVE SHOW and go toe to toe with your simple ass. I'd be more than happy to explain our company's position on your laughable attempt to play reporter. Go play somewhere else.
Bye, JohnDoe.
ps..... I guess im not a real reporter, ah welll. HAHA. anyone wanting info can contact me or can ask for my contributions to many news agencies, including THE Associated Press (AP) i prolly wont even give these people the time of day anymore. They are just too unprofessional, itll bring me down.
Edited by johndoeradio (06/09/06 04:57 PM)
|
Koala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
|
|
Besides your security, I simply wouldn't bring more public attention to the issue of mushroom spores online, etc.
-------------------- You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!
|
Burke Dennings
baby merchant

Registered: 11/29/04
Posts: 81,641
|
|
While you're at it, you should get MycoShackJ and MycoShackC on your radio show.
|
motaman
old hand

Registered: 12/18/02
Posts: 6,047
Last seen: 12 days, 6 hours
|
|
Then next time this US crap comes up afer i lock this thread, untill I discuss this with my coleages, will receve a warning..
-------------------- http://heffter.org
|
doodoomaster
Life's still good


Registered: 06/02/06
Posts: 393
Loc: The united states of Gene...
Last seen: 14 years, 1 month
|
|
Quote:
Koala Koolio said: Besides your security, I simply wouldn't bring more public attention to the issue of mushroom spores online, etc.
This is all that is going through my mind. Let it go, they will get what is coming to them.
-------------------- For all you passive aggressive types. Fuck you, kind of.
|
motaman
old hand

Registered: 12/18/02
Posts: 6,047
Last seen: 12 days, 6 hours
|
|
This thread has been closed.
Reason: z
|
|