Home | Community | Message Board

MushroomCube.com
This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Shop: Original Sensible Seeds Autoflowering Cannabis Seeds   Bridgetown Botanicals Bridgetown Botanicals   Left Coast Kratom Buy Kratom Extract   Kraken Kratom Red Vein Kratom   North Spore North Spore Mushroom Grow Kits & Cultivation Supplies

Jump to first unread post Pages: 1 | 2 | 3  [ show all ]
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
Offlinecolimon
DingoDogBoy
Male

Registered: 04/22/06
Posts: 396
Last seen: 9 years, 7 months
Assholes lacing weed?
    #5716256 - 06/05/06 07:17 PM (17 years, 7 months ago)

The other day me and my friend went to smoke the usual session. After smoking a gram we were extremely high. I saw blurryness and I seemed to like everybody in a dirty way. I began to think there was acid in my weed (which is alright, i would like a warning first though...) anyways, I found out the guy had put ecsatacy in it! I was outraged! I don't buy it anymore, but I may want to in the future.. Who can I trust?


--------------------
I believe with the advent of acid we discovered new way to think and it had to
do with piecing together new thoughts of mind. Why is it that people think it's
so evil? What is it about it that there is scares people so deeply? Because
they are afraid that there is more to reality than they have ever confronted.
That there are doors that they're afraid to go in and they don't want us to go
in there either because if we go in, there we might learn something that they
don't know. And that makes us a little out of their control.


Extras: Filter Print Post Top
Invisibletrauma47645
The MushroomKing
Male User Gallery

Registered: 02/09/06
Posts: 771
Loc: Somewhere in this place c...
Re: Assholes lacing weed? [Re: colimon] * 1
    #5716276 - 06/05/06 07:22 PM (17 years, 7 months ago)

E in weed? that doesnt sound right.. who in there right mind would do that.. E goes for 15 - 20 a pill and weed goes for about 5 - 10 a gram out here.. doenst seem like it makes much sense


Extras: Filter Print Post Top
OfflineInTheFlesh714
Drunk
Male User Gallery
Registered: 10/19/05
Posts: 958
Loc: (714)
Last seen: 9 years, 2 months
Re: Assholes lacing weed? [Re: trauma47645] * 1
    #5716305 - 06/05/06 07:28 PM (17 years, 7 months ago)

Hahahahaha :rotfl: You thought it was laced with acid :rotfl: it gets destroyed by the heat MUCH easier than THC does on weed. And I doubt its laced with ecstacy.


Extras: Filter Print Post Top
OfflineMauiGanjaMonster
Herbal Pleasures
Male

Registered: 04/26/06
Posts: 474
Loc: 4 acre pot field
Last seen: 16 years, 2 months
Re: Assholes lacing weed? [Re: InTheFlesh714]
    #5716386 - 06/05/06 07:45 PM (17 years, 7 months ago)

It wouldent be acid, I highly doubt E, maybe it was some kronic stuff and you where horny at the time?


--------------------
Trodding through creation in a irie meditation.

As they walk through my garden and steal my fruit, damn devils in a three piece suit.

yeah they walk through my garden and eat my fruit damn puppets, the boys in blue.


Extras: Filter Print Post Top
InvisibleAtheist
Stranger
Male User Gallery

Registered: 01/24/06
Posts: 13,705
Loc: USA
Re: Assholes lacing weed? [Re: MauiGanjaMonster] * 2
    #5716464 - 06/05/06 08:10 PM (17 years, 7 months ago)

MAYBE YOU WERE JUST FUCKING BAKED


Extras: Filter Print Post Top
OfflineVico
Grasshopper
 User Gallery

Registered: 05/13/06
Posts: 107
Last seen: 17 years, 2 months
Re: Assholes lacing weed? [Re: Atheist]
    #5716655 - 06/05/06 08:51 PM (17 years, 7 months ago)

Ackems Raisor?


--------------------
Ill make you eat your parents.


Extras: Filter Print Post Top
Offlineleery11
I Tell You What!

Registered: 06/24/05
Posts: 5,998
Last seen: 8 years, 9 months
Re: Assholes lacing weed? [Re: Vico]
    #5716676 - 06/05/06 08:56 PM (17 years, 7 months ago)

how do you KNOW they laced it?

you can trip balls on herb.


--------------------
I am the MacDaddy of Heimlich County, I play it Straight Up Yo!

....I embrace my desire to feel the rhythm, to feel connected enough to step aside and weep like a widow, to feel inspired, to fathom the power, to witness the beauty, to bathe in the fountain, to swing on the spiral of our divinity and still be a human......
Om Namah Shivaya, I tell you What!


Extras: Filter Print Post Top
InvisibleDIRTYMAN
Jesusdon'tcomethrough thecotton.
Female
Registered: 11/18/05
Posts: 18,558
Loc: CZ NIGGUH
Re: Assholes lacing weed? [Re: colimon] * 1
    #5716743 - 06/05/06 09:14 PM (17 years, 7 months ago)

Quote:

colimon said:
I saw blurryness and I seemed to like everybody in a dirty way. I began to think there was acid in my weed



It wasn't laced, you were just stoned. That doesn't sound like LSD or MDMA to me either. You'd have to smoke a lot of pure e to get rolled from what I've read, and LSD degrades really fast under heat, especially direct flame.

The only thing bud could effectively (practical and cost wise) be laced with is sugar. Some guy sold a very sweet smelling eigth, and when another guy smoked it it tasted exactly like caramel. After investigation the guy admitted to wetting chronic with sugar water and fan drying it to make it a little heavier. What a dick huh?


--------------------
I'm racist.                http://k-k-k.com/


Extras: Filter Print Post Top
Invisibleking_cobra
Stranger
 User Gallery

Registered: 02/27/05
Posts: 2,752
Re: Assholes lacing weed? [Re: trauma47645] * 1
    #5716780 - 06/05/06 09:23 PM (17 years, 7 months ago)

it's called dank.


--------------------


Extras: Filter Print Post Top
OfflineTrancedShroom
Mr. Hanky
Male User Gallery

Registered: 03/08/06
Posts: 8,002
Loc: Rippin Waves
Last seen: 12 years, 4 months
Re: Assholes lacing weed? [Re: king_cobra]
    #5716801 - 06/05/06 09:28 PM (17 years, 7 months ago)

Drug dealers do not spend more money than they can make to get people high.

Go back to the guy and buy more of this so-called laced weed. It is good quality bud, I promise.


--------------------


Extras: Filter Print Post Top
Offlinepantsboy
I troll because I care.
Female User Gallery

Registered: 10/28/04
Posts: 13,002
Loc: 8====D ~o
Last seen: 1 year, 27 days
Re: Assholes lacing weed? [Re: TrancedShroom]
    #5717446 - 06/05/06 11:48 PM (17 years, 7 months ago)

Yeah shit like that has happend to me before. Weed can do weird stuff sometimes. I went completely blind after smoking bowl once, but the loss of vision only lasted for five mintues. It was still fucking scary as shit though.


--------------------
Acid doesn't hurt when you're on fire. :frown:




"Mushrooms are only similar to penises in their appearance." - LeBron James (2013)

ToiletDuk said:
"Bus squelching is not to be laughed at."


Extras: Filter Print Post Top
OfflineWakeUpScreaming
Stranger
 User Gallery

Registered: 08/01/05
Posts: 44
Loc: boise
Last seen: 16 years, 4 months
Re: Assholes lacing weed? [Re: DIRTYMAN]
    #5717480 - 06/05/06 11:56 PM (17 years, 7 months ago)

Quote:

DIRTYMAN said:
Quote:

colimon said:
I saw blurryness and I seemed to like everybody in a dirty way. I began to think there was acid in my weed



It wasn't laced, you were just stoned. That doesn't sound like LSD or MDMA to me either. You'd have to smoke a lot of pure e to get rolled from what I've read, and LSD degrades really fast under heat, especially direct flame.

The only thing bud could effectively (practical and cost wise) be laced with is sugar. Some guy sold a very sweet smelling eigth, and when another guy smoked it it tasted exactly like caramel. After investigation the guy admitted to wetting chronic with sugar water and fan drying it to make it a little heavier. What a dick huh?




PCP laced weed (wet) works too but nobody would sell you wet without you knowing because its pretty expensive


--------------------
Have you ever thought as a hearse drives by
That someday soon you to will die
They wrap you up in a bloody sheet
and toss you down 1000 feet.
The worms crawl in the worms crawl out
The ant play pennuckle in your snout
The big black bug with big red eyes crawls in your innards
And out your sides
You squish him up, spread him on bread
That's what you eat when you are dead


Extras: Filter Print Post Top
OfflineFestivus
Resident Lurker
Male

Registered: 03/24/06
Posts: 142
Last seen: 15 years, 1 month
Re: Assholes lacing weed? [Re: Vico] * 1
    #5717504 - 06/06/06 12:03 AM (17 years, 7 months ago)

Quote:

Vico said:
Ackems Raisor?




Occam's razor.

</anal retentive>


Extras: Filter Print Post Top
InvisibleAtheist
Stranger
Male User Gallery

Registered: 01/24/06
Posts: 13,705
Loc: USA
Re: Assholes lacing weed? [Re: pantsboy] * 1
    #5717522 - 06/06/06 12:13 AM (17 years, 7 months ago)

Quote:

pantsboy said:
Yeah shit like that has happend to me before. Weed can do weird stuff sometimes. I went completely blind after smoking bowl once, but the loss of vision only lasted for five mintues. It was still fucking scary as shit though.




thats fucked up man i can only imagine how scared you were


Extras: Filter Print Post Top
Offlinedanlennon3
LivingIsEasyWithEyesClosed.....
Male User Gallery

Registered: 10/29/02
Posts: 19,246
Loc: usa Flag
Last seen: 1 year, 12 days
Re: Assholes lacing weed? [Re: Atheist] * 1
    #5717630 - 06/06/06 12:55 AM (17 years, 7 months ago)

when your dealer heard you thought his shit was laced, he thought it would be funny to tell you it WAS actually laced with soemthing... but it was just some good shit


--------------------
"Psychedelics should be used not to escape reality, but to embrace it"



Extras: Filter Print Post Top
OfflineCoaster
Baʿal
Male User Gallery

Registered: 05/22/06
Posts: 33,501
Loc: Deep in the Valley
Last seen: 12 years, 3 months
Re: Assholes lacing weed? [Re: danlennon3] * 2
    #5717697 - 06/06/06 01:14 AM (17 years, 7 months ago)

u cant smoke acid or e wtf u newber


--------------------


Extras: Filter Print Post Top
InvisibleMoo456
Pied_Piper

Registered: 03/03/06
Posts: 4,591
Re: Assholes lacing weed? [Re: Coaster]
    #5717902 - 06/06/06 03:33 AM (17 years, 7 months ago)

says in this FAQ that xtc can be smoked
http://www.erowid.org/chemicals/mdma/mdma_faq.shtml


Extras: Filter Print Post Top
OfflineCoaster
Baʿal
Male User Gallery

Registered: 05/22/06
Posts: 33,501
Loc: Deep in the Valley
Last seen: 12 years, 3 months
Re: Assholes lacing weed? [Re: Moo456]
    #5718258 - 06/06/06 09:01 AM (17 years, 7 months ago)

i dunno if i belive that u can smoke a pill, or a powder i mean. no1 does that shti i doubt it has the same effex.


--------------------


Extras: Filter Print Post Top
InvisibleAtheist
Stranger
Male User Gallery

Registered: 01/24/06
Posts: 13,705
Loc: USA
Re: Assholes lacing weed? [Re: Coaster]
    #5718261 - 06/06/06 09:03 AM (17 years, 7 months ago)

Quote:

Zasabi said:
i dunno if i belive that u can smoke a pill, or a powder i mean. no1 does that shti i doubt it has the same effex.




Wrong.


Extras: Filter Print Post Top
OfflineCoaster
Baʿal
Male User Gallery

Registered: 05/22/06
Posts: 33,501
Loc: Deep in the Valley
Last seen: 12 years, 3 months
Re: Assholes lacing weed? [Re: Atheist]
    #5718327 - 06/06/06 09:33 AM (17 years, 7 months ago)

not wron no1 fukin smokes that shit is inefiicient like smokin mushies or coke


--------------------


Extras: Filter Print Post Top
InvisibleAtheist
Stranger
Male User Gallery

Registered: 01/24/06
Posts: 13,705
Loc: USA
Re: Assholes lacing weed? [Re: Coaster]
    #5718351 - 06/06/06 09:43 AM (17 years, 7 months ago)

you never smoked coke right?


Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: Assholes lacing weed? [Re: Atheist]
    #5718575 - 06/06/06 11:20 AM (17 years, 7 months ago)

Zasabi - It would be wise to stop posting here until people forget about you, learn how to write a sentence (and get a good grasp of simple words), and try to come back and start fresh.

I'll give you lesson one: No1 likes to read the number 1 substituted into words to replace the word one.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Extras: Filter Print Post Top
Invisibletoole
white-thumb (Onewhackmycophiliac)
 User Gallery

Folding@home Statistics
Registered: 05/01/06
Posts: 500
Loc: spore #1203 - bas 2.34 - ...
Re: Assholes lacing weed? [Re: Koala Koolio]
    #5718607 - 06/06/06 11:30 AM (17 years, 7 months ago)

haha wow zasabi..post some more bullshit..it compliments your "CENTANSE STRUKSURE"..

Go read or something..


--------------------
-the adventures of suse and prescott.9-

..and the neverending triscut of doom !


Extras: Filter Print Post Top
Invisiblekaniz
That one, overthere.
Male

Registered: 07/23/04
Posts: 4,166
Loc: Ontario
Re: Assholes lacing weed? [Re: toole]
    #5718628 - 06/06/06 11:36 AM (17 years, 7 months ago)

This weekend while in Montreal, ended up hooking up with a bunch of people from the states. They couldnt bring weed over the border, and I ended up smoking them up.

One of them asked 'is this shit really weed, I am SOOO fucked right now', I had to reassure him it was just weed and not laced or soomething else :P


Edited by kaniz (06/06/06 11:37 AM)


Extras: Filter Print Post Top
Offlineimpgl
CrimethINCspecial agent
 User Gallery
Registered: 02/07/06
Posts: 2,462
Loc: california!
Last seen: 7 years, 4 months
Re: Assholes lacing weed? [Re: colimon]
    #5718659 - 06/06/06 11:47 AM (17 years, 7 months ago)

Quote:

colimon said:
The other day me and my friend went to smoke the usual session. After smoking a gram we were extremely high. I saw blurryness and I seemed to like everybody in a dirty way. I began to think there was acid in my weed (which is alright, i would like a warning first though...) anyways, I found out the guy had put ecsatacy in it! I was outraged! I don't buy it anymore, but I may want to in the future.. Who can I trust?


  :dielaughing:


Extras: Filter Print Post Top
OfflineThreePieceSuit
disastrophe
Male User Gallery

Registered: 04/26/06
Posts: 5,003
Loc: East Coast of Canada
Last seen: 11 years, 11 months
Re: Assholes lacing weed? [Re: impgl]
    #5719035 - 06/06/06 01:36 PM (17 years, 7 months ago)

This is a fairly common myth among drug haters. Cops around here like to tell kids they'll get "addicted to weed" because the dealer will "sprinkle some cocaine in it." Cocaine is 80 bucks a gram here. Pot is around 10. :wink:They also like to employ the fact that mushroom and LSD tolerance develops quickly, so you "need more to get your same high." They forget to mention that tolerance also diminishes quickly.  :frown:

"Wet" here refers to pot sprayed with Windex. PCP isn't common, so our friendly neighborhood drug dealers decided to come up with something cheaper. Not my cup of tea at all.


--------------------
:mafioso:
I'm so lucrative, even my birthday suit is in three pieces.


Extras: Filter Print Post Top
OfflineTrippy_Search
I'm trippin' man
Male
Registered: 12/09/05
Posts: 201
Loc: TX
Last seen: 17 years, 3 months
Re: Assholes lacing weed? [Re: ThreePieceSuit]
    #5719073 - 06/06/06 01:58 PM (17 years, 7 months ago)

damn sounds like some good buds


--------------------


Extras: Filter Print Post Top
Offlinedarkstar45
inquisitivetraveler
Male User Gallery

Registered: 04/14/05
Posts: 427
Last seen: 13 years, 11 months
Re: Assholes lacing weed? [Re: Trippy_Search]
    #5721451 - 06/07/06 12:24 AM (17 years, 7 months ago)

maybe it had an rc on it like foxy, but i doubt it.


--------------------
There he goes...
One of God's own prototypes.
A high powered mutant of some kind never even considered for mass production.
Too weird to live and too rare to die.


Extras: Filter Print Post Top
Invisiblekaniz
That one, overthere.
Male

Registered: 07/23/04
Posts: 4,166
Loc: Ontario
Re: Assholes lacing weed? [Re: darkstar45]
    #5722040 - 06/07/06 05:52 AM (17 years, 7 months ago)

People just dont sell laced weed. Weed is cheap and easy enough to get/sell, that adding anything to it to either make it stronger, or 'hook people' would simply be eating into their profits.

The only time I have seen 'laced weed', is when people knowingly lace it themselves. ie: was at a friends place, he likes meth, he had sprinkled a bit of crystal ontop of his pipe, he went to offer me a smoke, but then followed up "Oh ya, I put some meth on there" .. in which I decided not to smoke any.

I could see someone being at a party, forgetting/not thinking 'hey, I put some shit on there' and offering a smoke to someone and someone smoking laced stuff unknowingly that way. But as for lacing stuff to sell? it doesnt happen, and if it does - it'd be pretty damn rare.

Weed IS a psychedelic on it's own, and strong weed can simply knock you flat on your ass if you smoke enough of it.


Extras: Filter Print Post Top
InvisibleRhysaboveit
Day Tripper
Female

Registered: 05/26/06
Posts: 218
Loc: Miami Fl
Re: Assholes lacing weed? [Re: colimon]
    #5722276 - 06/07/06 09:33 AM (17 years, 7 months ago)

i've heard from a friend who lives in Jersey that he was once sold weed laced with EMBALMING FLUID. Needless to say he had to be taken to a hospital.
WTF? I've heard of spraying down buds with Coca Cola to make them heavier but that's weird as fuck.
But things like XTC and Coke laced into your 10 sack by Joe Shmoe the dealing hoe is very unlikely. It would cost him more than he'd be making profit.


--------------------
No point in mentioning these bats, I thought. Poor bastard will see them soon enough

"There's a uh, big machine in the sky, some kind of, I dunno, electric snake, coming straight at us."
"Shoot it."
"Not yet, I want to study its habits. "


Extras: Filter Print Post Top
Offlinejohn706
C12H17N2O4P
 User Gallery
Registered: 11/03/02
Posts: 638
Last seen: 4 years, 11 months
Re: Assholes lacing weed? [Re: Rhysaboveit]
    #5722883 - 06/07/06 01:35 PM (17 years, 7 months ago)

HAHAHAH. this kind of thread always shows up.

NOONE laces weed with X or acid, you CANNOT smoke acid, and E is expensive, if someone did lace weed with it, they would present it as such and sell it for more money. but i dont even understand how you can lace weed with powder, IT WOULD JUST FALL OFF. anytime ive seen powder being put on weed, it was by the person planning to smoke it.


Wet is weed or mint leaves laced with PCP. PCP is sometimes called embalming fluid because it has an acrid chemical smell not unlike embalming fluid. NOONE is lacing weed with real embalming fluid, it was just a slang way of talking about it and people started taking it seriously.

sometimes in more lower class areas, weed does get laced with things like windex and raid. why? cuz ppl can pretend like its laced with pcp or some real drug that ppl would actually buy. and because those things are ..... CHEAP. they dont cost top dollar black market street prices, you can get a bottle of windex for $2 and spray down a pound of weed.


--------------------


Extras: Filter Print Post Top
Invisiblepac_man
~
Registered: 05/01/06
Posts: 200
Re: Assholes lacing weed? [Re: john706]
    #5722905 - 06/07/06 01:43 PM (17 years, 7 months ago)

.


Edited by pac_man (06/17/06 09:28 AM)


Extras: Filter Print Post Top
Offlinejpa23245
Stranger
Registered: 12/25/10
Posts: 10
Last seen: 7 years, 10 months
Re: Assholes lacing weed? [Re: kaniz]
    #21270091 - 02/13/15 06:17 PM (8 years, 11 months ago)

It can be economic for dealers to lace weed with meth or pcp. Think about it.. How many people do you know smoke weed versus how many you know that do meth or Pcp. If someone has a batch of meth that no ones buying.. Might as well put it in some weed to get people addicted and what not. It is a dick thing to do but im sure it happens.


Extras: Filter Print Post Top
OfflineApexNightmare
Retired Psychonaut
Male


Registered: 05/22/14
Posts: 1,075
Loc: Netherrealm
Last seen: 3 years, 5 months
Re: Assholes lacing weed? [Re: jpa23245] * 2
    #21270117 - 02/13/15 06:23 PM (8 years, 11 months ago)

I was a freshmen when this thread was posted.^

:jokerclap:


--------------------
Psychedelics experienced:
LSD, Mushrooms, LSA, THC, Salvia Divinorum, DMT



Extras: Filter Print Post Top
InvisibleLSDylan
bass music enjoyer
Male


Registered: 05/26/10
Posts: 4,992
Loc: Michigan
Re: Assholes lacing weed? [Re: ApexNightmare] * 1
    #21270153 - 02/13/15 06:33 PM (8 years, 11 months ago)

Quote:

AndyCP said:
I was a freshmen when this thread was posted.^

:jokerclap:




Me too! lol

Not to mention, what he said is just totally wrong.


--------------------
DanceSafe | Voluntaryism


Extras: Filter Print Post Top
InvisibleChasingBliss
.
 User Gallery

Folding@home Statistics
Registered: 11/23/13
Posts: 4,759
Loc: Los Santos
Re: Assholes lacing weed? [Re: jpa23245] * 1
    #21270173 - 02/13/15 06:39 PM (8 years, 11 months ago)

Quote:

jpa23245 said:
It can be economic for dealers to lace weed with meth or pcp. Think about it.. How many people do you know smoke weed versus how many you know that do meth or Pcp. If someone has a batch of meth that no ones buying.. Might as well put it in some weed to get people addicted and what not. It is a dick thing to do but im sure it happens.



:facepalm:


--------------------
:leaf:


Extras: Filter Print Post Top
InvisibleChasingBliss
.
 User Gallery

Folding@home Statistics
Registered: 11/23/13
Posts: 4,759
Loc: Los Santos
Re: Assholes lacing weed? [Re: ChasingBliss] * 1
    #21270183 - 02/13/15 06:42 PM (8 years, 11 months ago)

Quote:

ChasingBliss said:
Quote:

jpa23245 said:
It can be economic for dealers to lace weed with meth or pcp. Think about it.. How many people do you know smoke weed versus how many you know that do meth or Pcp. If someone has a batch of meth that no ones buying.. Might as well put it in some weed to get people addicted and what not. It is a dick thing to do but im sure it happens.



:facepalm:



:picard:

Sorry, one facepalm wasn't enough.


--------------------
:leaf:


Extras: Filter Print Post Top
OfflineApexNightmare
Retired Psychonaut
Male


Registered: 05/22/14
Posts: 1,075
Loc: Netherrealm
Last seen: 3 years, 5 months
Re: Assholes lacing weed? [Re: ChasingBliss] * 1
    #21270194 - 02/13/15 06:47 PM (8 years, 11 months ago)

Hold up, my math is off haha. Eight years ago I was about to be 17, so that'd make me a junior XD

Still though. :facepalm:


--------------------
Psychedelics experienced:
LSD, Mushrooms, LSA, THC, Salvia Divinorum, DMT



Extras: Filter Print Post Top
Offlinealer
♡♤♤♡
Male


Registered: 07/29/13
Posts: 753
Loc: USA Flag
Last seen: 8 years, 5 months
Re: Assholes lacing weed? [Re: ApexNightmare]
    #21271433 - 02/14/15 12:25 AM (8 years, 11 months ago)

If anything it was laced with a synthetic cannabanoid or spice.
Or maybe it's your first time ever smoking a sativa dominant strain witch will get you high af.


--------------------


Extras: Filter Print Post Top
OfflineDayTripper1
We are one!
Male User Gallery


Registered: 01/28/07
Posts: 2,258
Loc: Krusty Krab Flag
Last seen: 1 year, 1 month
Re: Assholes lacing weed? [Re: aler]
    #21271931 - 02/14/15 06:21 AM (8 years, 11 months ago)

The most likely additive is something inexpensive to add weight.


--------------------
________________
This just isn't working the way the manual paints it.


Extras: Filter Print Post Top
Offlinenicechrisman
Interdimensional space wizard
Male User Gallery


Registered: 11/07/03
Posts: 33,241
Last seen: 4 years, 6 months
Re: Assholes lacing weed? [Re: jpa23245]
    #21271939 - 02/14/15 06:26 AM (8 years, 11 months ago)

:zombie:


--------------------
"Cosmic Love is absolutelely ruthless and highly indifferent:
it teaches its lessons whether you like/dislike them or not."

John C. Lily

 


Extras: Filter Print Post Top
Offlinethoraxx
Wizard
Male User Gallery

Registered: 12/27/13
Posts: 580
Loc: Bavaria
Last seen: 4 years, 10 months
Re: Assholes lacing weed? [Re: nicechrisman]
    #21272352 - 02/14/15 09:02 AM (8 years, 11 months ago)

Cant wait for the 10 year anniversary ITT


Extras: Filter Print Post Top
OfflineMitchyDee
Stranger

Registered: 08/22/13
Posts: 137
Loc: Washington State
Last seen: 5 years, 4 months
Re: Assholes lacing weed? [Re: thoraxx]
    #21272579 - 02/14/15 10:01 AM (8 years, 11 months ago)

Edit: just realized this is an 8 year old thread lmao my bad.


Edited by MitchyDee (02/14/15 10:03 AM)


Extras: Filter Print Post Top
Offlinegamesguru
 User Gallery


Registered: 05/28/13
Posts: 170
Last seen: 4 months, 23 days
Re: Assholes lacing weed? [Re: aler]
    #21272677 - 02/14/15 10:27 AM (8 years, 11 months ago)

Quote:

aler said:
If anything it was laced with a synthetic cannabinoid or spice.
Or maybe it's your first time ever smoking a sativa dominant strain witch will get you high af.


This is where the paranoia really should be, especially seeing how prolific synthetic weed has become in the last 8 years.  Many synthetic cannabinoids are cheap, colorless, tasteless, and when sprinkled/sprayed in tiny amounts, do not noticeably alter the quality of the high.  Lacing this way wouldn't affect the weight (maybe 1%), but would increase potency up to 10-20%.  To test your suspicions you'd have to more or less send it to a lab.  Most dealers probably know better than to risk their reputation, but I would be surprised if some were not lacing theirs.


Extras: Filter Print Post Top
OfflineTripsurfer
Bring Back Asante!
Male


Registered: 08/01/12
Posts: 7,129
Loc: West of Windward Flag
Last seen: 3 months, 27 days
Re: Assholes lacing weed? [Re: gamesguru]
    #21273204 - 02/14/15 01:01 PM (8 years, 11 months ago)

I believe I have gotten laced weed one time in my life. We bought a prerolled joint from a shady coffee-shop and shared it between the three of us. 15 minutes later we all passed out for a solid two hours.

Never before or after has anything like that happened to me, and I have smoked lots


--------------------
Ach en wee ben ik de klos, met mijn boog schoot ik een albatros...

A philosopher is a person who knows less and less about more and more, until he knows nothing about everything.



Extras: Filter Print Post Top
Offlinejpa23245
Stranger
Registered: 12/25/10
Posts: 10
Last seen: 7 years, 10 months
Re: Assholes lacing weed? [Re: ChasingBliss]
    #21273262 - 02/14/15 01:15 PM (8 years, 11 months ago)

Hey. You guys can kiss my ass. I see you all have yet to counter my arguement...


Extras: Filter Print Post Top
Offlinegamesguru
 User Gallery


Registered: 05/28/13
Posts: 170
Last seen: 4 months, 23 days
Re: Assholes lacing weed? [Re: jpa23245] * 1
    #21273287 - 02/14/15 01:21 PM (8 years, 11 months ago)

You countered your argument.

If someone was sitting on a lot of meth, they'd need to be sitting on a lot of weed to lace, and have a lot of undiscerning customers.  1 gram on every ounce of weed would already be enough where even the stupidest of people would say to themselves, dafuq did i just smoke. 
So reasonably, a quarter ounce batch of meth would need to be spread across 14-16oz of bud.  One person is unlikely to have both that much meth and that much weed.  It would probably require sustained cooperation between a meth and pot dealer, which is unlikely.

On top of that, they'd have to charge more for the weed that no one was buying in the first place, or else it would just be bad economics to throw in some free meth.


Extras: Filter Print Post Top
InvisibleOsculateOfDemise
Female User Gallery


Registered: 06/24/05
Posts: 2,879
Re: Assholes lacing weed? [Re: gamesguru]
    #21273303 - 02/14/15 01:26 PM (8 years, 11 months ago)

my weed is laced :burke:


Extras: Filter Print Post Top
Jump to top Pages: 1 | 2 | 3  [ show all ]

Shop: Original Sensible Seeds Autoflowering Cannabis Seeds   Bridgetown Botanicals Bridgetown Botanicals   Left Coast Kratom Buy Kratom Extract   Kraken Kratom Red Vein Kratom   North Spore North Spore Mushroom Grow Kits & Cultivation Supplies


Similar ThreadsPosterViewsRepliesLast post
* IS this weed laced?
( 1 2 all )
ph30n1x 3,830 30 03/05/06 12:06 AM
by indica
* How often is weed laced?
( 1 2 all )
ilikeeggs 4,076 26 08/11/08 08:42 AM
by PsilocybinLuvin
* Smoked Laced Marijuana
( 1 2 3 all )
Chaos_ult 7,018 53 03/04/05 10:06 AM
by Locus
* How do ppl lace MJ and other drugs?
( 1 2 all )
hpnotiq 3,080 36 01/03/05 10:48 PM
by Dark_Star
* Crazy weed, dmt laced?
( 1 2 all )
mikeownow 16,082 29 02/19/06 02:15 PM
by Koala Koolio
* Question on lacing
( 1 2 all )
PigsOnTheWing 3,043 35 09/17/05 01:08 AM
by puwtrip
* Strongest most mind bending weed ever
( 1 2 all )
mikeyboy 3,375 23 05/13/05 12:55 AM
by Adden
* Weed "trip" report...was it laced? Tyrone_C 1,832 11 07/14/05 08:52 PM
by Tyrone_C

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: psilocybinjunkie, Rose, mushboy, LogicaL Chaos, Northerner, bodhisatta
5,335 topic views. 3 members, 60 guests and 14 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2024 Mind Media. Some rights reserved.

Generated in 0.045 seconds spending 0.01 seconds on 14 queries.