Home | Community | Message Board

MagicBag Grow Bags
This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Shop: North Spore North Spore Mushroom Grow Kits & Cultivation Supplies   Left Coast Kratom Buy Kratom Extract, Kratom Powder For Sale   Original Sensible Seeds Autoflowering Cannabis Seeds, Bulk Cannabis Seeds

Jump to first unread post Pages: < Back | 1 | 2 | 3 | Next >  [ show all ]
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
InvisibleAtheist
Stranger
Male User Gallery

Registered: 01/24/06
Posts: 13,705
Loc: USA
Re: Assholes lacing weed? [Re: Coaster]
    #5718351 - 06/06/06 09:43 AM (17 years, 7 months ago)

you never smoked coke right?


Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: Assholes lacing weed? [Re: Atheist]
    #5718575 - 06/06/06 11:20 AM (17 years, 7 months ago)

Zasabi - It would be wise to stop posting here until people forget about you, learn how to write a sentence (and get a good grasp of simple words), and try to come back and start fresh.

I'll give you lesson one: No1 likes to read the number 1 substituted into words to replace the word one.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Extras: Filter Print Post Top
Invisibletoole
white-thumb (Onewhackmycophiliac)
 User Gallery

Folding@home Statistics
Registered: 05/01/06
Posts: 500
Loc: spore #1203 - bas 2.34 - ...
Re: Assholes lacing weed? [Re: Koala Koolio]
    #5718607 - 06/06/06 11:30 AM (17 years, 7 months ago)

haha wow zasabi..post some more bullshit..it compliments your "CENTANSE STRUKSURE"..

Go read or something..


--------------------
-the adventures of suse and prescott.9-

..and the neverending triscut of doom !


Extras: Filter Print Post Top
Invisiblekaniz
That one, overthere.
Male

Registered: 07/23/04
Posts: 4,166
Loc: Ontario
Re: Assholes lacing weed? [Re: toole]
    #5718628 - 06/06/06 11:36 AM (17 years, 7 months ago)

This weekend while in Montreal, ended up hooking up with a bunch of people from the states. They couldnt bring weed over the border, and I ended up smoking them up.

One of them asked 'is this shit really weed, I am SOOO fucked right now', I had to reassure him it was just weed and not laced or soomething else :P


Edited by kaniz (06/06/06 11:37 AM)


Extras: Filter Print Post Top
Offlineimpgl
CrimethINCspecial agent
 User Gallery
Registered: 02/07/06
Posts: 2,462
Loc: california!
Last seen: 7 years, 4 months
Re: Assholes lacing weed? [Re: colimon]
    #5718659 - 06/06/06 11:47 AM (17 years, 7 months ago)

Quote:

colimon said:
The other day me and my friend went to smoke the usual session. After smoking a gram we were extremely high. I saw blurryness and I seemed to like everybody in a dirty way. I began to think there was acid in my weed (which is alright, i would like a warning first though...) anyways, I found out the guy had put ecsatacy in it! I was outraged! I don't buy it anymore, but I may want to in the future.. Who can I trust?


  :dielaughing:


Extras: Filter Print Post Top
OfflineThreePieceSuit
disastrophe
Male User Gallery

Registered: 04/26/06
Posts: 5,003
Loc: East Coast of Canada
Last seen: 11 years, 11 months
Re: Assholes lacing weed? [Re: impgl]
    #5719035 - 06/06/06 01:36 PM (17 years, 7 months ago)

This is a fairly common myth among drug haters. Cops around here like to tell kids they'll get "addicted to weed" because the dealer will "sprinkle some cocaine in it." Cocaine is 80 bucks a gram here. Pot is around 10. :wink:They also like to employ the fact that mushroom and LSD tolerance develops quickly, so you "need more to get your same high." They forget to mention that tolerance also diminishes quickly.  :frown:

"Wet" here refers to pot sprayed with Windex. PCP isn't common, so our friendly neighborhood drug dealers decided to come up with something cheaper. Not my cup of tea at all.


--------------------
:mafioso:
I'm so lucrative, even my birthday suit is in three pieces.


Extras: Filter Print Post Top
OfflineTrippy_Search
I'm trippin' man
Male
Registered: 12/09/05
Posts: 201
Loc: TX
Last seen: 17 years, 3 months
Re: Assholes lacing weed? [Re: ThreePieceSuit]
    #5719073 - 06/06/06 01:58 PM (17 years, 7 months ago)

damn sounds like some good buds


--------------------


Extras: Filter Print Post Top
Offlinedarkstar45
inquisitivetraveler
Male User Gallery

Registered: 04/14/05
Posts: 427
Last seen: 13 years, 11 months
Re: Assholes lacing weed? [Re: Trippy_Search]
    #5721451 - 06/07/06 12:24 AM (17 years, 7 months ago)

maybe it had an rc on it like foxy, but i doubt it.


--------------------
There he goes...
One of God's own prototypes.
A high powered mutant of some kind never even considered for mass production.
Too weird to live and too rare to die.


Extras: Filter Print Post Top
Invisiblekaniz
That one, overthere.
Male

Registered: 07/23/04
Posts: 4,166
Loc: Ontario
Re: Assholes lacing weed? [Re: darkstar45]
    #5722040 - 06/07/06 05:52 AM (17 years, 7 months ago)

People just dont sell laced weed. Weed is cheap and easy enough to get/sell, that adding anything to it to either make it stronger, or 'hook people' would simply be eating into their profits.

The only time I have seen 'laced weed', is when people knowingly lace it themselves. ie: was at a friends place, he likes meth, he had sprinkled a bit of crystal ontop of his pipe, he went to offer me a smoke, but then followed up "Oh ya, I put some meth on there" .. in which I decided not to smoke any.

I could see someone being at a party, forgetting/not thinking 'hey, I put some shit on there' and offering a smoke to someone and someone smoking laced stuff unknowingly that way. But as for lacing stuff to sell? it doesnt happen, and if it does - it'd be pretty damn rare.

Weed IS a psychedelic on it's own, and strong weed can simply knock you flat on your ass if you smoke enough of it.


Extras: Filter Print Post Top
InvisibleRhysaboveit
Day Tripper
Female

Registered: 05/26/06
Posts: 218
Loc: Miami Fl
Re: Assholes lacing weed? [Re: colimon]
    #5722276 - 06/07/06 09:33 AM (17 years, 7 months ago)

i've heard from a friend who lives in Jersey that he was once sold weed laced with EMBALMING FLUID. Needless to say he had to be taken to a hospital.
WTF? I've heard of spraying down buds with Coca Cola to make them heavier but that's weird as fuck.
But things like XTC and Coke laced into your 10 sack by Joe Shmoe the dealing hoe is very unlikely. It would cost him more than he'd be making profit.


--------------------
No point in mentioning these bats, I thought. Poor bastard will see them soon enough

"There's a uh, big machine in the sky, some kind of, I dunno, electric snake, coming straight at us."
"Shoot it."
"Not yet, I want to study its habits. "


Extras: Filter Print Post Top
Offlinejohn706
C12H17N2O4P
 User Gallery
Registered: 11/03/02
Posts: 638
Last seen: 4 years, 11 months
Re: Assholes lacing weed? [Re: Rhysaboveit]
    #5722883 - 06/07/06 01:35 PM (17 years, 7 months ago)

HAHAHAH. this kind of thread always shows up.

NOONE laces weed with X or acid, you CANNOT smoke acid, and E is expensive, if someone did lace weed with it, they would present it as such and sell it for more money. but i dont even understand how you can lace weed with powder, IT WOULD JUST FALL OFF. anytime ive seen powder being put on weed, it was by the person planning to smoke it.


Wet is weed or mint leaves laced with PCP. PCP is sometimes called embalming fluid because it has an acrid chemical smell not unlike embalming fluid. NOONE is lacing weed with real embalming fluid, it was just a slang way of talking about it and people started taking it seriously.

sometimes in more lower class areas, weed does get laced with things like windex and raid. why? cuz ppl can pretend like its laced with pcp or some real drug that ppl would actually buy. and because those things are ..... CHEAP. they dont cost top dollar black market street prices, you can get a bottle of windex for $2 and spray down a pound of weed.


--------------------


Extras: Filter Print Post Top
Invisiblepac_man
~
Registered: 05/01/06
Posts: 200
Re: Assholes lacing weed? [Re: john706]
    #5722905 - 06/07/06 01:43 PM (17 years, 7 months ago)

.


Edited by pac_man (06/17/06 09:28 AM)


Extras: Filter Print Post Top
Offlinejpa23245
Stranger
Registered: 12/25/10
Posts: 10
Last seen: 7 years, 10 months
Re: Assholes lacing weed? [Re: kaniz]
    #21270091 - 02/13/15 06:17 PM (8 years, 11 months ago)

It can be economic for dealers to lace weed with meth or pcp. Think about it.. How many people do you know smoke weed versus how many you know that do meth or Pcp. If someone has a batch of meth that no ones buying.. Might as well put it in some weed to get people addicted and what not. It is a dick thing to do but im sure it happens.


Extras: Filter Print Post Top
OfflineApexNightmare
Retired Psychonaut
Male


Registered: 05/22/14
Posts: 1,075
Loc: Netherrealm
Last seen: 3 years, 5 months
Re: Assholes lacing weed? [Re: jpa23245] * 2
    #21270117 - 02/13/15 06:23 PM (8 years, 11 months ago)

I was a freshmen when this thread was posted.^

:jokerclap:


--------------------
Psychedelics experienced:
LSD, Mushrooms, LSA, THC, Salvia Divinorum, DMT



Extras: Filter Print Post Top
InvisibleLSDylan
bass music enjoyer
Male


Registered: 05/26/10
Posts: 4,992
Loc: Michigan
Re: Assholes lacing weed? [Re: ApexNightmare] * 1
    #21270153 - 02/13/15 06:33 PM (8 years, 11 months ago)

Quote:

AndyCP said:
I was a freshmen when this thread was posted.^

:jokerclap:




Me too! lol

Not to mention, what he said is just totally wrong.


--------------------
DanceSafe | Voluntaryism


Extras: Filter Print Post Top
InvisibleChasingBliss
.
 User Gallery

Folding@home Statistics
Registered: 11/23/13
Posts: 4,759
Loc: Los Santos
Re: Assholes lacing weed? [Re: jpa23245] * 1
    #21270173 - 02/13/15 06:39 PM (8 years, 11 months ago)

Quote:

jpa23245 said:
It can be economic for dealers to lace weed with meth or pcp. Think about it.. How many people do you know smoke weed versus how many you know that do meth or Pcp. If someone has a batch of meth that no ones buying.. Might as well put it in some weed to get people addicted and what not. It is a dick thing to do but im sure it happens.



:facepalm:


--------------------
:leaf:


Extras: Filter Print Post Top
InvisibleChasingBliss
.
 User Gallery

Folding@home Statistics
Registered: 11/23/13
Posts: 4,759
Loc: Los Santos
Re: Assholes lacing weed? [Re: ChasingBliss] * 1
    #21270183 - 02/13/15 06:42 PM (8 years, 11 months ago)

Quote:

ChasingBliss said:
Quote:

jpa23245 said:
It can be economic for dealers to lace weed with meth or pcp. Think about it.. How many people do you know smoke weed versus how many you know that do meth or Pcp. If someone has a batch of meth that no ones buying.. Might as well put it in some weed to get people addicted and what not. It is a dick thing to do but im sure it happens.



:facepalm:



:picard:

Sorry, one facepalm wasn't enough.


--------------------
:leaf:


Extras: Filter Print Post Top
OfflineApexNightmare
Retired Psychonaut
Male


Registered: 05/22/14
Posts: 1,075
Loc: Netherrealm
Last seen: 3 years, 5 months
Re: Assholes lacing weed? [Re: ChasingBliss] * 1
    #21270194 - 02/13/15 06:47 PM (8 years, 11 months ago)

Hold up, my math is off haha. Eight years ago I was about to be 17, so that'd make me a junior XD

Still though. :facepalm:


--------------------
Psychedelics experienced:
LSD, Mushrooms, LSA, THC, Salvia Divinorum, DMT



Extras: Filter Print Post Top
Offlinealer
♡♤♤♡
Male


Registered: 07/29/13
Posts: 753
Loc: USA Flag
Last seen: 8 years, 5 months
Re: Assholes lacing weed? [Re: ApexNightmare]
    #21271433 - 02/14/15 12:25 AM (8 years, 11 months ago)

If anything it was laced with a synthetic cannabanoid or spice.
Or maybe it's your first time ever smoking a sativa dominant strain witch will get you high af.


--------------------


Extras: Filter Print Post Top
OfflineDayTripper1
We are one!
Male User Gallery


Registered: 01/28/07
Posts: 2,258
Loc: Krusty Krab Flag
Last seen: 1 year, 1 month
Re: Assholes lacing weed? [Re: aler]
    #21271931 - 02/14/15 06:21 AM (8 years, 11 months ago)

The most likely additive is something inexpensive to add weight.


--------------------
________________
This just isn't working the way the manual paints it.


Extras: Filter Print Post Top
Jump to top Pages: < Back | 1 | 2 | 3 | Next >  [ show all ]

Shop: North Spore North Spore Mushroom Grow Kits & Cultivation Supplies   Left Coast Kratom Buy Kratom Extract, Kratom Powder For Sale   Original Sensible Seeds Autoflowering Cannabis Seeds, Bulk Cannabis Seeds


Similar ThreadsPosterViewsRepliesLast post
* IS this weed laced?
( 1 2 all )
ph30n1x 3,830 30 03/05/06 12:06 AM
by indica
* How often is weed laced?
( 1 2 all )
ilikeeggs 4,076 26 08/11/08 08:42 AM
by PsilocybinLuvin
* Smoked Laced Marijuana
( 1 2 3 all )
Chaos_ult 7,018 53 03/04/05 10:06 AM
by Locus
* How do ppl lace MJ and other drugs?
( 1 2 all )
hpnotiq 3,080 36 01/03/05 10:48 PM
by Dark_Star
* Crazy weed, dmt laced?
( 1 2 all )
mikeownow 16,082 29 02/19/06 02:15 PM
by Koala Koolio
* Question on lacing
( 1 2 all )
PigsOnTheWing 3,043 35 09/17/05 01:08 AM
by puwtrip
* Strongest most mind bending weed ever
( 1 2 all )
mikeyboy 3,375 23 05/13/05 12:55 AM
by Adden
* Weed "trip" report...was it laced? Tyrone_C 1,832 11 07/14/05 08:52 PM
by Tyrone_C

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: psilocybinjunkie, Rose, mushboy, LogicaL Chaos, Northerner, bodhisatta
5,335 topic views. 5 members, 57 guests and 19 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2024 Mind Media. Some rights reserved.

Generated in 0.029 seconds spending 0.007 seconds on 13 queries.