Home | Community | Message Board


This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Shop: North Spore North Spore Mushroom Grow Kits & Cultivation Supplies   MagicBag.co All-In-One Bags That Don't Suck   Original Sensible Seeds Bulk Cannabis Seeds   PhytoExtractum Maeng Da Thai Kratom Leaf Powder

Jump to first unread post Pages: 1
InvisibleAsante
Omnicyclion prophet
Male User Gallery

Registered: 02/06/02
Posts: 87,295
Bless you
    #5710368 - 06/04/06 07:03 AM (17 years, 9 months ago)

Bless our posters for posting
Bless our lurkers for lurking

Bless our growers for growing
Bless our users for using

Bless our traders for trading
Bless our raters for rating

Bless our druggies and sobers and philosophers and nihilists and lovers and haters, the helpers helping and the bitches bitching in OTD

Bless all of us here at the shroomery
But most of all: bless you


I love you guys.
If only the Shroomery was a village, it would be the best village in the world.


--------------------
Omnicyclion.org
higher knowledge starts here

Extras: Filter Print Post Top
OfflineKaptKid
Spaced Pirate
Male User Gallery

Registered: 12/11/03
Posts: 6,252
Loc: Bright Side of the Sun
Last seen: 4 years, 1 month
Re: Bless you [Re: Asante]
    #5710374 - 06/04/06 07:13 AM (17 years, 9 months ago)

Quote:

Wiccan_Seeker said:If only the Shroomery was a village, it would be the best village in the world.




Yes it would.


:sun:


--------------------
Child of the 60's, Tripping ever since.


:sun:

Extras: Filter Print Post Top
InvisibleUnderNose
all out of bubble gum
 User Gallery

Registered: 03/04/06
Posts: 1,613
Re: Bless you [Re: KaptKid]
    #5710380 - 06/04/06 07:22 AM (17 years, 9 months ago)

I would add to this but I'm lurking
Heres to the worldwide shroom-village :heart: :mushroom2: :thumbup:


--------------------
LAGM 2.022

:dna::dna:

Edited by UnderNose (06/04/06 07:24 AM)

Extras: Filter Print Post Top
Invisibleking_cobra
Stranger
 User Gallery

Registered: 02/27/05
Posts: 2,752
Re: Bless you [Re: Asante]
    #5710381 - 06/04/06 07:24 AM (17 years, 9 months ago)

amen.


--------------------

Extras: Filter Print Post Top
InvisibleMike_yy
Male User Gallery

Registered: 10/28/05
Posts: 7,253
Re: Bless you [Re: Asante]
    #5710401 - 06/04/06 07:40 AM (17 years, 9 months ago)

Quote:

Wiccan_Seeker said:
If only the Shroomery was a village, it would be the best village in the world.




Thats the best idea ive heard in ages.
I'll go get some bricks !

Extras: Filter Print Post Top
InvisibleTippinthru
contented

Registered: 04/07/05
Posts: 1,131
Loc: "The Garden"...
Re: Bless you [Re: Asante]
    #5710410 - 06/04/06 07:46 AM (17 years, 9 months ago)

Quote:

Wiccan_Seeker said:
Bless our posters for posting
Bless our lurkers for lurking

Bless our growers for growing
Bless our users for using

Bless our traders for trading
Bless our raters for rating

Bless our druggies and sobers and philosophers and nihilists and lovers and haters, the helpers helping and the bitches bitching in OTD

Bless all of us here at the shroomery
But most of all: bless you


I love you guys.
If only the Shroomery was a village, it would be the best village in the world.




Can I get an, Amen Hallelujah brother!


--------------------
Perfection is attained by slow degrees; it requires the hand of time...
[

Extras: Filter Print Post Top
Invisiblevinsue
Grand Old Fart
Male User Gallery

Registered: 02/17/04
Posts: 17,953
Loc: The Garden State(NJ) Flag
Re: Bless you [Re: Mike_yy]
    #5710427 - 06/04/06 07:57 AM (17 years, 9 months ago)

Quote:

I'll go get some bricks !


...Start with some of these...


--------------------

"All mushrooms are edible; but some only once." Croatian proverb. BTW ...
  Have You Rated Ythans Mom Yet ?? ... :taser:  ... HERE'S HOW ... (be nice) .  :mod: ... :peace:

Extras: Filter Print Post Top
InvisibleSimisu
taken by gravity
 User Gallery

Registered: 08/08/03
Posts: 5,435
Loc: Israeli in
Re: Bless you [Re: vinsue]
    #5710434 - 06/04/06 07:59 AM (17 years, 9 months ago)

amen :grin:

:mushroom2:


--------------------
:mushdance::sanpedro::peyote::mushroom2: :heart: Shr:supershroom::supershroom:mery :heart: :mushroom2::peyote::sanpedro::mushdance:
      Visit & Support Free Spore Ring Earth
      :sun: Please help spread live Salvia Divinorum :sun:


Extras: Filter Print Post Top
InvisibleBurke Dennings
baby merchant

Registered: 11/29/04
Posts: 81,641
Re: Bless you [Re: Asante]
    #5710440 - 06/04/06 08:05 AM (17 years, 9 months ago)

Quote:

Wiccan_Seeker said:

the bitches bitching in OTD





I've read a bunch of your posts in the mod forum. There is NO ONE who does as much whining and bitching as you. NO ONE.

Extras: Filter Print Post Top
OfflineCepheus
Balance
Male User Gallery

Folding@home Statistics
Registered: 04/19/06
Posts: 8,266
Loc: the space between reality...
Last seen: 3 hours, 21 minutes
Re: Bless you [Re: Burke Dennings]
    #5710499 - 06/04/06 08:48 AM (17 years, 9 months ago)

If there was a shroomery village it would be a commune. everyone would sit around helping each other with their grow ops while wasted.

life would be sweet.

I want it :frown:


--------------------
"I only ever hope to reach equilibrium, in Nature's matrix, in line with the meridian" ~ Jehst

:sun: "...and I know that I have to keep breathing, as tomorrow the sun will rise, who knows what the tide will bring?" :sun:

Free Spore Ring Europe
Send any spare spore prints you might have and help the distribution :grin:

Open Source. Freedom.  GNU/Linux

Addicting is not a word.

Extras: Filter Print Post Top
InvisibleAsante
Omnicyclion prophet
Male User Gallery

Registered: 02/06/02
Posts: 87,295
Re: Bless you [Re: Burke Dennings]
    #5710514 - 06/04/06 09:05 AM (17 years, 9 months ago)

Quote:

I've read a bunch of your posts in the mod forum. There is NO ONE who does as much whining and bitching as you. NO ONE.





There's a role for every one of us. There should be people like me but its very clear we shouldn't all be like me. Same goes for you too, and it is for us two to accept that that is OK.

I'd like it if you were a bit less rude towards me like that lil morsel in OTD the other day. Don't take me wrong: you don't have to like me but calling me a fat bastard with produce up his arse is stretching it a bit :wink:

Be a Shroomery Supporter and let's rag it out in Anything Goes :smile:


--------------------
Omnicyclion.org
higher knowledge starts here

Edited by Asante (06/04/06 09:10 AM)

Extras: Filter Print Post Top
Offlinecybrbeast
Up, then down, then...
Male User Gallery

Folding@home Statistics
Registered: 01/06/03
Posts: 4,777
Loc: event horizon
Last seen: 7 years, 10 months
Re: Bless you [Re: Asante]
    #5710520 - 06/04/06 09:10 AM (17 years, 9 months ago)

:thumbup:

Extras: Filter Print Post Top
InvisibleAsante
Omnicyclion prophet
Male User Gallery

Registered: 02/06/02
Posts: 87,295
Re: Bless you [Re: Cepheus]
    #5710523 - 06/04/06 09:12 AM (17 years, 9 months ago)

Quote:

life would be sweet.
I want it





There could be 100 of us who'd want to live in Shroomryville. Too bad we're not all Dutch nationals.
I'd be up for it!


--------------------
Omnicyclion.org
higher knowledge starts here

Extras: Filter Print Post Top
InvisibleBurke Dennings
baby merchant

Registered: 11/29/04
Posts: 81,641
Re: Bless you [Re: Asante]
    #5710785 - 06/04/06 11:34 AM (17 years, 9 months ago)

Quote:

Wiccan_Seeker said:

I'd like it if you were a bit less rude towards me




I'd like if you'd stop making threads about me in the mod forum trying to get me forcefully removed from the site. 

Quote:

Wiccan_Seeker said:

Be a Shroomery Supporter and let's rag it out in Anything Goes :smile:




I already am a supporter, but I hate posting in AG.  Why not come down to OTD if you'd like to discuss things?

Extras: Filter Print Post Top
InvisibleAsante
Omnicyclion prophet
Male User Gallery

Registered: 02/06/02
Posts: 87,295
Re: Bless you [Re: Burke Dennings]
    #5710955 - 06/04/06 12:15 PM (17 years, 9 months ago)

Quote:

I'd like if you'd stop making threads about me in the mod forum trying to get me forcefully removed from the site.




I hope you can see past that thing. PMS is a bitch, especially for a guy :grin:

You should not underestimate the effect you have on people, every now and again you sincerely hurt people's feelings. You could blame them for caring, but to me that seems odd.

But how does one Burke Dennings get into the mod forum?

I didn't see the supporter-S but it's great you're one of us :thumbup:

Quote:

I already am a supporter, but I hate posting in AG. Why not come down to OTD if you'd like to discuss things?




I might pick you up on that one later today if you're on and up for it then.


--------------------
Omnicyclion.org
higher knowledge starts here

Edited by Asante (06/04/06 12:17 PM)

Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: Bless you [Re: Asante]
    #5711813 - 06/04/06 04:35 PM (17 years, 9 months ago)

"If only the Shroomery was a village, it would be the best village in the world."

So.. that would make us the village people then?

Quick, someone call construction worker!


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!

Extras: Filter Print Post Top
Jump to top Pages: 1

Shop: North Spore North Spore Mushroom Grow Kits & Cultivation Supplies   MagicBag.co All-In-One Bags That Don't Suck   Original Sensible Seeds Bulk Cannabis Seeds   PhytoExtractum Maeng Da Thai Kratom Leaf Powder


Similar ThreadsPosterViewsRepliesLast post
* The village WARNING SPOILERS Anonymous 1,081 7 08/04/04 01:25 AM
by MOTH
* Midievil Village drSE 549 1 07/28/07 12:56 PM
by DoorsFan
* . dr_gonz 1,107 10 09/27/05 02:32 AM
by Todcasil
* Mystery illness strikes after meteorite hits Peruvian village Mocha Bear 1,111 13 09/18/07 11:29 AM
by Bridgeburner
* Bless you all!
( 1 2 all )
Asante 2,168 27 01/15/07 02:17 PM
by Koala Koolio
* The Assortment - "Bless Our Hippy Home" (mp3) LearyfanS 6,370 13 10/21/05 12:19 AM
by Learyfan
* Police Ticket for village sticker question
( 1 2 all )
tony8404 3,575 30 08/31/06 10:02 AM
by dampkring
* blessings four_winds 293 2 02/13/06 10:40 PM
by KaptKid

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: Entire Staff
2,343 topic views. 7 members, 54 guests and 95 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2024 Mind Media. Some rights reserved.

Generated in 0.029 seconds spending 0.009 seconds on 14 queries.