Home | Community | Message Board

Mycohaus
This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Shop: North Spore North Spore Mushroom Grow Kits & Cultivation Supplies   Left Coast Kratom Buy Kratom Extract   Original Sensible Seeds Autoflowering Cannabis Seeds   PhytoExtractum Maeng Da Thai Kratom Leaf Powder

Jump to first unread post Pages: 1
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
Invisiblemjshroomer
Sage
Registered: 07/21/99
Posts: 13,774
Loc: gone with my shrooms
The Amsterdam Nuggie
    #5710424 - 06/04/06 07:54 AM (17 years, 7 months ago)

Another iamge form my visit to the Nederlands. Cannot recall the name but it was form a middle eastern owned smoke house.

This is a four gram nuggie




mj


Extras: Filter Print Post Top
Offlinebluelou
NUTCASEdrugbucket!
Male User Gallery

Registered: 05/11/02
Posts: 1,086
Loc: $hroom Central
Last seen: 6 years, 4 months
Re: The Amsterdam Nuggie [Re: mjshroomer]
    #5710437 - 06/04/06 08:00 AM (17 years, 7 months ago)

WEll how is it?

Like the taste and smell type of high!


--------------------
Have you tried my(black kow) pile style tek outdoors!!!!!!!!


Extras: Filter Print Post Top
InvisibleUnderNose
all out of bubble gum
 User Gallery

Registered: 03/04/06
Posts: 1,612
Re: The Amsterdam Nuggie [Re: bluelou]
    #5710446 - 06/04/06 08:11 AM (17 years, 7 months ago)

Nice Nugget:getstoned:
I'm going on a trip there soon, Can't wait
Can you visit the "fresh mushrooms" factory , or thats not allowed

P.S.
Just wanted to say you doing a awesome job with all the mushrooms you have found and brought into the community plus you can grow some monsters. :thumbup: :mushroom2: a


--------------------
LAGM 2.022

:dna::dna:


Extras: Filter Print Post Top
Offlinecybrbeast
Up, then down, then...
Male User Gallery

Folding@home Statistics
Registered: 01/06/03
Posts: 4,777
Loc: event horizon
Last seen: 7 years, 8 months
Re: The Amsterdam Nuggie [Re: mjshroomer]
    #5710685 - 06/04/06 10:48 AM (17 years, 7 months ago)

Hey mj, have you tried our White Widow?


--------------------
futuretribe.space


Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: The Amsterdam Nuggie [Re: mjshroomer]
    #5710780 - 06/04/06 11:32 AM (17 years, 7 months ago)

Looks okay.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Extras: Filter Print Post Top
InvisibleBurke Dennings
baby merchant

Registered: 11/29/04
Posts: 81,641
Re: The Amsterdam Nuggie [Re: mjshroomer]
    #5710850 - 06/04/06 11:49 AM (17 years, 7 months ago)

Shouldn't this be in 'Other Drugs Discussion'? There's an "herb museum" thread there.


Extras: Filter Print Post Top
Offlinewhatever123
Whatever I did, I'm sorry
Male User Gallery

Registered: 04/07/05
Posts: 2,613
Loc: San Diego, CA
Last seen: 5 years, 6 months
Re: The Amsterdam Nuggie [Re: Burke Dennings]
    #5710959 - 06/04/06 12:16 PM (17 years, 7 months ago)

lols @ herb museum


--------------------
Koala Koolio said:
there should be a 3 month waiting period between registration and posting. :wink:


Extras: Filter Print Post Top
OfflineCptnGarden
fuck this site
Registered: 05/13/04
Posts: 11,945
Last seen: 14 years, 9 months
Re: The Amsterdam Nuggie [Re: whatever123]
    #5711037 - 06/04/06 12:41 PM (17 years, 7 months ago)

beautiful, though someone did a sloppy job of trimming that nug.

:spliff: :rastamon:


Extras: Filter Print Post Top
Invisibledurban_poison
myco contractor
Registered: 09/19/01
Posts: 2,417
Re: The Amsterdam Nuggie [Re: mjshroomer]
    #5711051 - 06/04/06 12:45 PM (17 years, 7 months ago)

damn mj i wish i could live your lifestyle. anyway looks good but harvested a little early.


Extras: Filter Print Post Top
InvisibleGGreatOne234
Stranger
Registered: 12/23/99
Posts: 8,946
Re: The Amsterdam Nuggie [Re: mjshroomer]
    #5711069 - 06/04/06 12:50 PM (17 years, 7 months ago)

haha That's a damn nice nugg

I want to visit Holland again badly..


Extras: Filter Print Post Top
Invisiblemjshroomer
Sage
Registered: 07/21/99
Posts: 13,774
Loc: gone with my shrooms
Re: The Amsterdam Nuggie [Re: Burke Dennings]
    #5711107 - 06/04/06 12:58 PM (17 years, 7 months ago)

Actually Burke, I have never in my age considered marijuana to be other drugs, or a drug. It is an ethnobotanical plant of the highest quality and should not be stigmatized as an 'other drugs' and/or plants or in that forum. IT is not a drug.

mj

my opinion

And hi cCyber beast.

Ys I have smoke white widow and it is excellent.

However, I live in Washingon State which is still a producer of the finest indoors grown in the U.S.A.

For a long time, more than 80% of all marijuana from Washington was grown indoors under lights.

Oh well. This is a medical marijuana state but some providers grow shitty pot or sell to medical users the lower buds as they began to appear.

Got to catch them on the right day a at the right time.

I smoked five different kinds of bud in Amsterdam. The best was the White Widow and then this guy here from a shop which had a sign saying 'Smoker Friendly' in their window.

mj


Edited by mjshroomer (06/06/06 11:33 AM)


Extras: Filter Print Post Top
Offlinewhatever123
Whatever I did, I'm sorry
Male User Gallery

Registered: 04/07/05
Posts: 2,613
Loc: San Diego, CA
Last seen: 5 years, 6 months
Re: The Amsterdam Nuggie [Re: mjshroomer]
    #5711289 - 06/04/06 01:43 PM (17 years, 7 months ago)

Christ, are you high right now?


--------------------
Koala Koolio said:
there should be a 3 month waiting period between registration and posting. :wink:


Extras: Filter Print Post Top
Offlinenightkrawler
explorer
Male

Registered: 06/18/04
Posts: 2,980
Loc: new england
Last seen: 5 years, 6 months
Re: The Amsterdam Nuggie [Re: mjshroomer]
    #5711312 - 06/04/06 01:49 PM (17 years, 7 months ago)

looks like a scrumptious nug


--------------------

Not all who wander are lost - J.R.R. Tolkien


Extras: Filter Print Post Top
OfflineCptnGarden
fuck this site
Registered: 05/13/04
Posts: 11,945
Last seen: 14 years, 9 months
Re: The Amsterdam Nuggie [Re: whatever123]
    #5711349 - 06/04/06 01:56 PM (17 years, 7 months ago)

Quote:

whatever123 said:
Christ, are you high right now?




Christ is very high indeed. :mushroom2:


Extras: Filter Print Post Top
InvisiblePsychoslut
The Mother Fucking Bear-o-dactyl
 User Gallery
Registered: 12/10/02
Posts: 20,917
Loc: all up in ya
Re: The Amsterdam Nuggie [Re: mjshroomer]
    #5711425 - 06/04/06 02:21 PM (17 years, 7 months ago)

if my state (illinois) legalizes med marijuana will it bring a bunch of good weed here, we need it bad because for the most part all we have is brick weed


--------------------



[quote]KristiMidocean said:
Good now thats clear.WHO FUCKING CARES. If I am fat u all keep pointing it out like its suppose to be a secret.LIke u really have nothing better to do then make fat jokes. If o know its like I do I know yall can come up with NEW AND BETTER SHIT . This shit is old and boring . I left in the first place cause this shit got boring not because of the fat jokes . Fat jokes dont bother me but seriously its old[/quote]


Extras: Filter Print Post Top
OfflineAnnom
※※※※※※
 User Gallery

Folding@home Statistics
Registered: 12/22/02
Posts: 6,367
Loc: Europe
Last seen: 8 months, 9 days
Re: The Amsterdam Nuggie [Re: mjshroomer]
    #5711608 - 06/04/06 03:21 PM (17 years, 7 months ago)

Here's some white widow from holland:



6euro per gram


Extras: Filter Print Post Top
InvisiblePsychoslut
The Mother Fucking Bear-o-dactyl
 User Gallery
Registered: 12/10/02
Posts: 20,917
Loc: all up in ya
Re: The Amsterdam Nuggie [Re: Annom]
    #5711736 - 06/04/06 04:05 PM (17 years, 7 months ago)

that much good bud right there would go for 60 US dollars in my town


--------------------



[quote]KristiMidocean said:
Good now thats clear.WHO FUCKING CARES. If I am fat u all keep pointing it out like its suppose to be a secret.LIke u really have nothing better to do then make fat jokes. If o know its like I do I know yall can come up with NEW AND BETTER SHIT . This shit is old and boring . I left in the first place cause this shit got boring not because of the fat jokes . Fat jokes dont bother me but seriously its old[/quote]


Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: The Amsterdam Nuggie [Re: Psychoslut]
    #5711776 - 06/04/06 04:22 PM (17 years, 7 months ago)

"if my state (illinois) legalizes med marijuana will it bring a bunch of good weed here, we need it bad because for the most part all we have is brick weed"

Hah...

Make new friends. :smile:

Same as anyone saying "there's no acid in my state! I know a bunch of drug dealers. if it were here, I'd know!"


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Extras: Filter Print Post Top
Offlinewhatever123
Whatever I did, I'm sorry
Male User Gallery

Registered: 04/07/05
Posts: 2,613
Loc: San Diego, CA
Last seen: 5 years, 6 months
Re: The Amsterdam Nuggie [Re: Koala Koolio]
    #5711845 - 06/04/06 04:50 PM (17 years, 7 months ago)

BUT THERE IS NO ACID IN MY STATE Everyone knows there is no cid in California :wink:


--------------------
Koala Koolio said:
there should be a 3 month waiting period between registration and posting. :wink:


Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: The Amsterdam Nuggie [Re: whatever123]
    #5712135 - 06/04/06 06:00 PM (17 years, 7 months ago)

Hehe, funny. But I've read it countless times, even for California. If you want to think it in your head, no harm done, but why embarass yourself? It's Cali-fucking-fornia.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Extras: Filter Print Post Top
Jump to top Pages: 1

Shop: North Spore North Spore Mushroom Grow Kits & Cultivation Supplies   Left Coast Kratom Buy Kratom Extract   Original Sensible Seeds Autoflowering Cannabis Seeds   PhytoExtractum Maeng Da Thai Kratom Leaf Powder


Similar ThreadsPosterViewsRepliesLast post
* Thinking of starting a small weed grow (in Holland) cybrbeast 3,071 19 04/01/06 07:38 AM
by DrJ
* marijuana seeds/canada
( 1 2 all )
TODAY 2,715 22 06/04/05 10:35 PM
by Iamthewalrus
* Growing Marijuana
( 1 2 all )
Fliquid 2,804 30 05/08/07 10:35 AM
by Dexter_Morgan
* looking for a very extensive marijuana strain list drugsaregoodmmk 7,797 16 03/13/07 04:27 AM
by ManicDelirium
* PW420's Marijuana Grow Log
( 1 2 all )
StrandedVoyager 4,754 25 09/06/06 05:20 PM
by Cloud9
* Trip to amsterdam *DELETED* omutumo 1,169 15 12/09/04 10:20 AM
by asd11
* Amsterdam's ethno garden Hamurabi 2,290 18 03/11/03 06:20 PM
by A0999
* what to buy from amsterdam? Hamurabi 1,609 17 08/02/02 02:22 AM
by RemiMartin

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: Mostly_Harmless, A.k.a
1,092 topic views. 0 members, 10 guests and 3 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2024 Mind Media. Some rights reserved.

Generated in 0.032 seconds spending 0.009 seconds on 14 queries.