Home | Community | Message Board


This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Shop: Original Sensible Seeds Autoflowering Cannabis Seeds   OlympusMyco.com Olympus Myco Bulk Substrate   MagicBag.co Certified Organic All-In-One Grow Bags by Magic Bag   Mushroom-Hut Mono Tub Substrate   Myyco.com Golden Teacher Liquid Culture For Sale   North Spore North Spore Mushroom Grow Kits & Cultivation Supplies   Kraken Kratom Red Vein Kratom   Left Coast Kratom Buy Kratom Extract

Jump to first unread post Pages: 1
Offlinephoenix012
Stranger
Registered: 06/03/06
Posts: 12
Last seen: 17 years, 5 days
Shipping 'Shrooms
    #5708440 - 06/03/06 06:46 PM (17 years, 11 months ago)

Hey guys, how are you? One of my good friends from University is currently on a mission trip in India. The good thing is magic mushrooms are supposedly pretty cheap and accessible in that country. He wants to ship some back into the States, obviously using a fake return address and all the necessary safety precautions.

The thing we need help with is what to package the shrooms in. We plan on squishing the shrooms flat and packaging them into something and depositing it into a thin envelope. I know the absolute best way is to 3x vacuum seal them and then put them in an envelope, but a vacuum sealer is extremely hard to find in India as well as they set you back hundreds of dollars.

Not all drug dogs are trained to sense magic mushrooms as they mostly deal with weed, coke, heroin, opium, explosives and now MDMA, so even if this is a makeshift project I bet many envelopes will make it through, and even if caught, just thrown into the oven.

So I'm basically asking what is the best way to thinly package these shrooms in to best avoid detection as well make them un-x-ray-able. I'd think tin foil would raise flags and all, but I'm not sure.

Thank you guys so much for your answers.

Extras: Filter Print Post Top
InvisibleDirtMcgirt
in a pinch
 User Gallery

Registered: 10/20/04
Posts: 2,213
Loc: city of angels
Re: Shipping 'Shrooms [Re: phoenix012]
    #5708462 - 06/03/06 06:51 PM (17 years, 11 months ago)

grind up said shrooms, put in food conatiners. Like for indian spices or something. That is a completely valid reason to ship large amounts of organic powder to the US. Thats what i would do. Declare them and pay the customs which won't be very much. Trying to sneak them in will be much more difficult and dangerous


--------------------
"And we, inhabitants of the great coral of the Cosmos, believe the atom (which still we cannot see) to be full matter, whereas, it too, like everything else, is but an embroidery of voids in the Void, and we give the name of being, dense and even eternal, to that dance of inconsistencies, that infinite extension that is identified with absolute Nothingness and that spins from its own non-being the illusion of everything."

Extras: Filter Print Post Top
Offlinewhatever123
Whatever I did, I'm sorry
Male User Gallery

Registered: 04/07/05
Posts: 2,613
Loc: San Diego, CA
Last seen: 5 years, 10 months
Re: Shipping 'Shrooms [Re: DirtMcgirt]
    #5708534 - 06/03/06 07:15 PM (17 years, 11 months ago)

Couldn't have said it better, dirt. In fact, SWIM plans on hooking a couple people up if he can grow a little more than the cake he is currently doing(he needs more jars). These people live accross the country, so the mail is what I am using to transport. I love the idea of using a government agency to defy the government.
Anyways, yea, seeing as how you are shipping through customs, it is probably not a horrible idea to grind up the shrooms, thus destroying any resemblence they had to what they once were. Putting them in a food container, also on the right track. Good advice, dirt. And for shipping state to state, SWIM plans on just using a padded cushion envelope to send the shrooms. But maybe he will try the food containers, I don't know.


--------------------
Koala Koolio said:
there should be a 3 month waiting period between registration and posting. :wink:

Extras: Filter Print Post Top
Offlinephoenix012
Stranger
Registered: 06/03/06
Posts: 12
Last seen: 17 years, 5 days
Re: Shipping 'Shrooms [Re: whatever123]
    #5708608 - 06/03/06 07:32 PM (17 years, 11 months ago)

Thanks for the idea, guys.. and SWIM does plan on flattening and grinding up the shrooms, but SWIM was hoping for a material(plastic, tin foil, etc) that would work best to place into a THIN envelope. We're not really looking for a really sneaky way to ship them in an item or disguised as an import, just things that he can send from a remote Indian mail center and hopefully arrive in a mail box a week or two later.

Maybe this is a pipe dream, but can't we just say.. crush them up and grind them, wrap them in a paper towel, and then staple a really thin piece of "paper" around the towel, so to the touch the letter will feel sturdy(from the thin paper) and the crushed up shrooms will be wrapped safely inside?

In terms of dog sniffing, equal chances of getting caught or associated with both ideas since we're technically not concealing the smell, but Im just looking for a good way to thinly package them inside of a LETTER, and then mailing a ground up quarter or so per envelope.

Any ideas or noticeable problems with my plan that could go awry? Thanks guys.

Extras: Filter Print Post Top
InvisibleZippoZM
Knomadic
 User Gallery

Registered: 06/17/03
Posts: 13,227
Loc: Pongyang, North Korea
Re: Shipping 'Shrooms [Re: phoenix012]
    #5709056 - 06/03/06 09:16 PM (17 years, 11 months ago)

yeah, theres the whole interntaional crug trafficking charges.

to be honest i think that even $40 an eigth for shrooms versus possibly getting nailed for shipping them illegally acros the border... theres a clear obvious choice. dont mail them man, the risk farrr outweighs the benifits.

hell people grow these things in their closet, theres no reason to ship them across an ocean or 2 and into a police state that will give you yeard behind bars for any amount. mmmk?


--------------------
PEACE

:mushroom2:zippoz:mushroom2:



"in times of widespread chaos and confusion, it has been the duty of more advanced human beings - artists, scientists, clowns, and philosophers - to create order. In such times as ours however, when there is too much order, too much m management, too much programming and control, it becomes the duty of superior men and women and women to fling their favorite monkey wrenches into the machinery. To relieve the repression of the human spirit, they must sow doubt and disruption"

"People do it every day, they talk to themselves ... they see themselves as they'd like to be, they don't have the courage you have, to just run with it."

Extras: Filter Print Post Top
Offlinephoenix012
Stranger
Registered: 06/03/06
Posts: 12
Last seen: 17 years, 5 days
Re: Shipping 'Shrooms [Re: ZippoZ]
    #5709112 - 06/03/06 09:28 PM (17 years, 11 months ago)

That's why you use a fake return address and allow the envelopes to sit around for a few days when they arrive. Not as if the DEA or USPS officials would even care about an ounce or two of shrooms, but in the offchance they did how would they prove I ordered them? Unless they're members of this board, and even then, it's a known fact that the only thing customs does when small amounts minor drugs are seized(pot, shrooms) they just put them in an oven and send you a letter.

So I have like two known facts and the innocent until proven guilty clause protecting me.

I don't need advice weighing my legal consequences, I've been doing this for years with Canadian bud. All I want is someone who actually knows something about shrooms and can give me advice on how to effectively ship them. I just read in an article that keeping them in an air tight container actually makes them rot, would this be true with ground up shrooms as well?

And can anyone who knows anything about shrooms tell me whether or not my method in my above post would provide for fresh shrooms even if it takes a couple weeks to arrive?

Thank you guys for the advice so far, but I'm still trying to find an adequate response or idea. I'm sure others on this board have shipped shrooms intercontinental? Maybe..  :tongue:

Edited by phoenix012 (06/03/06 09:32 PM)

Extras: Filter Print Post Top
Offlinekristen
Burn out..don't fade away
 User Gallery
Registered: 04/19/06
Posts: 303
Last seen: 9 years, 4 months
Re: Shipping 'Shrooms [Re: whatever123]
    #5709234 - 06/03/06 09:56 PM (17 years, 11 months ago)

Quote:

whatever123 said:
SWIM plans on hooking a couple people up if he can grow a little more than the cake he is currently doing

I am using to transport.




What's the point of the stupid acronym if you admit it's you a couple sentances later anyway?

Extras: Filter Print Post Top
InvisibleZippoZM
Knomadic
 User Gallery

Registered: 06/17/03
Posts: 13,227
Loc: Pongyang, North Korea
Re: Shipping 'Shrooms [Re: kristen]
    #5709539 - 06/03/06 11:11 PM (17 years, 11 months ago)

really man, dont do it.

im going to take a wild guess and think that your in .... phoenix?

its not worth the risk, its stupid, its going to get you in deep shit.

you want to know how you will get busted. they will deliver it to you, you will rip it open and exclaim, oh joy it worked!

then in about 15 minutes your door gets busted in beacause you signed for it from an undercover delivery man.

have you read the news at all? have you heard about the tapping of international calls?????? if theyre recording the time and date and length of every international call, comprising the largest database of its kind (the cia that is) dont you think that they just might... maybee be paying attention to PACKAGES coming fomr those countries???

its not like india borders pakistan and happens to be the same region where bin ladden is supposedly hiding... oh wait.

well atleast its not a country renouned for opium production... oh wait.


if youre only talking about an ounce or 2 of shrooms then do the right thing, and dont ship them internationally....

really man, really.

the united states has the higest prison population per capita for a reason, beacuse of dumb ass ideas like this.

700 some in 10,000 are in jail in the u.s. this is second to only one country, the former U.S.S.R.

Get it through your head.... BAD IDEA.


--------------------
PEACE

:mushroom2:zippoz:mushroom2:



"in times of widespread chaos and confusion, it has been the duty of more advanced human beings - artists, scientists, clowns, and philosophers - to create order. In such times as ours however, when there is too much order, too much m management, too much programming and control, it becomes the duty of superior men and women and women to fling their favorite monkey wrenches into the machinery. To relieve the repression of the human spirit, they must sow doubt and disruption"

"People do it every day, they talk to themselves ... they see themselves as they'd like to be, they don't have the courage you have, to just run with it."

Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: Shipping 'Shrooms [Re: phoenix012]
    #5709924 - 06/04/06 01:02 AM (17 years, 11 months ago)

Don't bother. What a stupid idea. It's mushrooms, you can make them.

If you want to risk it, use the search engine to find the 200 other mushroom shipping threads.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!

Extras: Filter Print Post Top
Offlinewhatever123
Whatever I did, I'm sorry
Male User Gallery

Registered: 04/07/05
Posts: 2,613
Loc: San Diego, CA
Last seen: 5 years, 10 months
Re: Shipping 'Shrooms [Re: kristen]
    #5710089 - 06/04/06 01:58 AM (17 years, 11 months ago)

Quote:

kristen said:
Quote:

whatever123 said:
SWIM plans on hooking a couple people up if he can grow a little more than the cake he is currently doing

I am using to transport.





haha, fuck.
What's the point of the stupid acronym if you admit it's you a couple sentances later anyway?




--------------------
Koala Koolio said:
there should be a 3 month waiting period between registration and posting. :wink:

Extras: Filter Print Post Top
Offlinedoodoomaster
Life's still good
Male User Gallery

Registered: 06/02/06
Posts: 393
Loc: The united states of Gene...
Last seen: 14 years, 5 months
Re: Shipping 'Shrooms [Re: whatever123]
    #5710275 - 06/04/06 03:48 AM (17 years, 11 months ago)

Agreed, stupid idea. And from what I understand they will still be fresh. Lacking the cracker-dried'ness needed for flawless shipping. If this person is planning on drying them your chances would be better but still bad. But the chances of someone on a mission trip in a middle eastern country properly drying, packaging and mailing to an address in the U.S. or any police state for that matter is highly unlikly. Between what might have been said on your phone and what HAS been said here you have exactly a half and half chance.
%50 says they will be nasty and destroyed and %50 says they will be seized and someone :ohwell: will be held resposnible.


--------------------
For all you passive aggressive types.  Fuck you, kind of.

Extras: Filter Print Post Top
Offlinephoenix012
Stranger
Registered: 06/03/06
Posts: 12
Last seen: 17 years, 5 days
Re: Shipping 'Shrooms [Re: doodoomaster]
    #5710503 - 06/04/06 08:54 AM (17 years, 11 months ago)

I haven't called anyone and you don't sign anything for envelopes delivered USPS. But thank you, doodoomaster, that was the post I was looking for.

Thank you all for your help.

Extras: Filter Print Post Top
OfflineNashbar
just strange.... on drugs
Male User Gallery
Registered: 07/16/05
Posts: 3,536
Loc: strawberry field
Last seen: 6 years, 6 months
Re: Shipping 'Shrooms [Re: phoenix012]
    #5710509 - 06/04/06 09:01 AM (17 years, 11 months ago)

can someone send via USPS from India?

Extras: Filter Print Post Top
Offlinephoenix012
Stranger
Registered: 06/03/06
Posts: 12
Last seen: 17 years, 5 days
Re: Shipping 'Shrooms [Re: Nashbar]
    #5712937 - 06/04/06 09:42 PM (17 years, 11 months ago)

Yup

Extras: Filter Print Post Top
Offlinewilshire
free radical
Male User Gallery

Registered: 05/11/05
Posts: 2,421
Loc: SE PA
Last seen: 14 years, 3 months
Re: Shipping 'Shrooms [Re: phoenix012]
    #5714439 - 06/05/06 10:51 AM (17 years, 11 months ago)

i have always felt that the best way to ship mushrooms is to package them mixed with some kind of food preparation (other than chocolate).


--------------------


Extras: Filter Print Post Top
Offlinenugjug
Wanderer

Registered: 11/07/05
Posts: 703
Last seen: 6 years, 3 months
Re: Shipping 'Shrooms [Re: wilshire]
    #5731324 - 06/09/06 04:18 PM (17 years, 11 months ago)

phoenix012: you're on point.

Ignore the naysayers. You're right about customs confiscating and dropping a letter saying you've been a naughty boy and you can't have that shipped to you. Slightly misspelling the name of the person it is going to helps give you an extra degree of plausible denyability. If you don't sign for anything then you aren't admitting you are expecting that package. If for some odd reason someone shows up and asks you to sign for your package tell them you aren't expecting anything and that it isn't you.

As far as the shipping goes don't ship them unless they are dried. If they are dried something as simple as a ziplock bag will work. Then toss in some cardboard or take another cardboard shipping envelope and cut it down a bit and use it as padding. I've shipped plenty of questionable items this way without any problems.

If you can toss them in one ziploc and crush them down till they are thin. Rub that down with rubbing alcohol and get your hands clean again. Toss it into a second clean ziploc and then take two pieces of thin cardboard (again like what the shipping envelopes are made out of ) that are larger than the bag and staple them around it. Then toss it into the actual envelope, address, and hope for the best.

I'm used to shipping via the large priority envelopes you get at the post office. If you are trying to use a letter sized envelope do the same thing but just make sure it's small enough to fit. If it's a non-secure type envelope, meaning you can see into it, then wrap some newspaper clipping or something around the outside of the package before stuffing it into the envelope.

I'd give it a 99% success rate. Good luck.

Extras: Filter Print Post Top
Offlinephoenix012
Stranger
Registered: 06/03/06
Posts: 12
Last seen: 17 years, 5 days
Re: Shipping 'Shrooms [Re: nugjug]
    #5732122 - 06/09/06 08:47 PM (17 years, 11 months ago)

Holy shit dude, thanks so much for that answer. I had a blind feeling that my method would work, but all of those multi-thousand posters were naysaying my idea, so I figured effectively shipping them was a no-go. I figured atleast one person would have a postive note to tell me but not until your post.

Seriously dude, thanks for that post. Wish me good luck :smile:

Extras: Filter Print Post Top
Offlinenugjug
Wanderer

Registered: 11/07/05
Posts: 703
Last seen: 6 years, 3 months
Re: Shipping 'Shrooms [Re: nugjug]
    #5732586 - 06/09/06 11:06 PM (17 years, 11 months ago)

No problems and GOOD LUCK, although I'm pretty confident you won't need it. But just make sure it is sent with no signature confirmation so that if shit hits the fan you're golden.

Extras: Filter Print Post Top
Jump to top Pages: 1

Shop: Original Sensible Seeds Autoflowering Cannabis Seeds   OlympusMyco.com Olympus Myco Bulk Substrate   MagicBag.co Certified Organic All-In-One Grow Bags by Magic Bag   Mushroom-Hut Mono Tub Substrate   Myyco.com Golden Teacher Liquid Culture For Sale   North Spore North Spore Mushroom Grow Kits & Cultivation Supplies   Kraken Kratom Red Vein Kratom   Left Coast Kratom Buy Kratom Extract


Similar ThreadsPosterViewsRepliesLast post
* Cruise ship security??? Ekstaza 2,603 18 05/14/04 05:59 PM
by Ekstaza
* Shipping From Canada... simplemachine 1,307 4 10/09/03 06:13 PM
by Ahab McBathsalts
* Shipping Salvia to Norway? Toolman 1,179 4 03/04/04 08:58 AM
by shriek
* shipping liquids? valour 874 2 02/16/04 03:35 PM
by valour
* Talk about safe shipping! trippysmurf 497 0 06/11/04 02:39 AM
by trippysmurf
* Can Dogs Smell Shrooms?
( 1 2 all )
Vegeta420 36,507 30 11/21/12 09:59 PM
by ch1ck3n.s0up
* shrooms and the law? law question dodder 4,226 14 09/10/22 01:19 PM
by Enlil
* Drug test for shrooms? GrassyAss 14,046 16 08/08/06 04:04 PM
by CodyH

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: Enlil, Alan Rockefeller
4,257 topic views. 0 members, 2 guests and 1 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2024 Mind Media. Some rights reserved.

Generated in 0.025 seconds spending 0.007 seconds on 15 queries.