Home | Community | Message Board

Mycohaus
This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Kraken Kratom Shop: Red Vein Kratom

Jump to first unread post Pages: 1
InvisiblePriitK
Stranger
 User Gallery

Registered: 06/06/03
Posts: 850
N64 & PS Roms?
    #5692437 - 05/30/06 08:35 PM (17 years, 7 months ago)

I am playing some N64 roms with my girl, but there are not many, and a lot of them have problems, like shaking of the screen or blurry.

I never tried any PS roms yet, do they work?

So my question is, does anyone know where to get tons of quality N64 roms?

Same with any new systems like PS

thanks everyone!


--------------------
I don't do drugs....I am drugs


Extras: Filter Print Post Top
OfflineSnape
Eternal Chaos
Male

Registered: 08/04/03
Posts: 2,285
Loc: Montreal, Quebec
Last seen: 9 years, 2 months
Re: N64 & PS Roms? [Re: PriitK]
    #5692472 - 05/30/06 08:45 PM (17 years, 7 months ago)

Quote:

PriitK said:
I never tried any PS roms yet, do they work?





That doesn't exist. PlayStation emulation works this way: You download a program that can read a PlayStation disc, you insert a game in your CD-ROM player and voilĂ ..


--------------------
I'm floating in the sea of stars,
I'm drifting away from the shore
I will be lost in the dream when the dark days come
But I will make the time run backwards and
I'll make the stars shine again


Extras: Filter Print Post Top
InvisiblePriitK
Stranger
 User Gallery

Registered: 06/06/03
Posts: 850
Re: N64 & PS Roms? [Re: Snape]
    #5692530 - 05/30/06 09:00 PM (17 years, 7 months ago)

thanks, so does anyone know where to get tons of good n64 roms?


--------------------
I don't do drugs....I am drugs


Extras: Filter Print Post Top
OfflineSnape
Eternal Chaos
Male

Registered: 08/04/03
Posts: 2,285
Loc: Montreal, Quebec
Last seen: 9 years, 2 months
Re: N64 & PS Roms? [Re: PriitK]
    #5692534 - 05/30/06 09:01 PM (17 years, 7 months ago)



--------------------
I'm floating in the sea of stars,
I'm drifting away from the shore
I will be lost in the dream when the dark days come
But I will make the time run backwards and
I'll make the stars shine again


Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: N64 & PS Roms? [Re: Snape]
    #5692564 - 05/30/06 09:07 PM (17 years, 7 months ago)

It has nothing to do with the "quality of the roms".

A rom dump is a rom dump. It's the quality of the emulation that you're lacking. Either you need a new pc, or a more up to date emulator. Try PJ64 if you haven't.

I've got a full set of N64 roms if you want any, let me know.

Or, since I'm lazy:

Download MiRC. Go on efnet. Join #romland they've got a full set of roms from every region.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Extras: Filter Print Post Top
OfflineDrunkenAttempt
Chemically Inclined
Male User Gallery

Registered: 03/10/05
Posts: 1,780
Loc: Nova Scotia, CANADA
Last seen: 9 years, 8 months
Re: N64 & PS Roms? [Re: Koala Koolio]
    #5692646 - 05/30/06 09:26 PM (17 years, 7 months ago)

Romhustler.com

if thats not it than just type Rom Hustler in google...its a wicked rom site with no bullshit


--------------------


Nature is my God, Science is my religion.


Extras: Filter Print Post Top
OfflineDrunkenAttempt
Chemically Inclined
Male User Gallery

Registered: 03/10/05
Posts: 1,780
Loc: Nova Scotia, CANADA
Last seen: 9 years, 8 months
Re: N64 & PS Roms? [Re: DrunkenAttempt]
    #5692652 - 05/30/06 09:27 PM (17 years, 7 months ago)

your best bet for playstation roms is fulldls.com


--------------------


Nature is my God, Science is my religion.


Extras: Filter Print Post Top
InvisibleVoidOfsPg
Stranger
Female User Gallery
Registered: 05/09/05
Posts: 4,899
Loc: San Antonio, TX
Re: N64 & PS Roms? [Re: DrunkenAttempt]
    #5692666 - 05/30/06 09:30 PM (17 years, 7 months ago)

Quote:

DrunkenAttempt said:
Romhustler.com 

if thats not it than just type Rom Hustler in google...its a wicked rom site with no bullshit




:thumbup:


Extras: Filter Print Post Top
OfflineDrunkenAttempt
Chemically Inclined
Male User Gallery

Registered: 03/10/05
Posts: 1,780
Loc: Nova Scotia, CANADA
Last seen: 9 years, 8 months
Re: N64 & PS Roms? [Re: VoidOfsPg]
    #5692689 - 05/30/06 09:35 PM (17 years, 7 months ago)

k it's romhustler.net actually


--------------------


Nature is my God, Science is my religion.


Extras: Filter Print Post Top
InvisibleVoidOfsPg
Stranger
Female User Gallery
Registered: 05/09/05
Posts: 4,899
Loc: San Antonio, TX
Re: N64 & PS Roms? [Re: DrunkenAttempt]
    #5692709 - 05/30/06 09:39 PM (17 years, 7 months ago)

I was just there downloading Cruisin World and Carmageddon 64.

Ah good times.

I own WCW Revenge and WWF Wrestlemania from back when I was a wrestling freak. :grin:


Extras: Filter Print Post Top
OfflineDrunkenAttempt
Chemically Inclined
Male User Gallery

Registered: 03/10/05
Posts: 1,780
Loc: Nova Scotia, CANADA
Last seen: 9 years, 8 months
Re: N64 & PS Roms? [Re: VoidOfsPg]
    #5692721 - 05/30/06 09:41 PM (17 years, 7 months ago)

me and my friends used to play WCW vs. NWO for N64 like a bunch of rabid madmen, totally good times


--------------------


Nature is my God, Science is my religion.


Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: N64 & PS Roms? [Re: DrunkenAttempt]
    #5692910 - 05/30/06 10:23 PM (17 years, 7 months ago)

It's much nicer when you have one of these bad boys:

http://www.robwebb.clara.co.uk/backup/misc/miscz64.html

Can't find them anymore. You might find the cd64 or v64 (same thing but CD drives), though they'll be expensive as hell these days.

It's a zip drive that sits on top of the n64. Download rom. Put rom on zip disk. Play on n64. :smile:

Beats the emulators.



--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Extras: Filter Print Post Top
InvisiblePriitK
Stranger
 User Gallery

Registered: 06/06/03
Posts: 850
Re: N64 & PS Roms? [Re: Koala Koolio]
    #5693357 - 05/31/06 12:05 AM (17 years, 7 months ago)

Hi,

What are the best Emulators for N64? I'm going to play with a friend, also, whats a good way to lag less with the emulator, if theres any options that I can make so its faster, besides connection and all that


thx, also what are some good 2 player games for 64/?


--------------------
I don't do drugs....I am drugs


Extras: Filter Print Post Top
OfflineDaytripper420
Bitchin!

Registered: 07/14/05
Posts: 428
Loc: South carolina
Last seen: 15 years, 8 months
Re: N64 & PS Roms? [Re: PriitK]
    #5693465 - 05/31/06 12:44 AM (17 years, 7 months ago)

holy shit get golden eye if its the only game you ever get for n64 that game is hands down the best game in the world


--------------------
Turn on, Tune in, Drop out.


Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: N64 & PS Roms? [Re: Daytripper420]
    #5693546 - 05/31/06 01:21 AM (17 years, 7 months ago)

PriitK

I already said, PJ64.

"if theres any options that I can make so its faster, besides connection and all that"

I'm sorry, I realize we all can't be computer nerds, but...

THINK MCFLY, THINK.

Did you really just suggest that the games aren't working well because of your internet speed? You know that once you download a file... it's downloaded? You could unplug yourself from the internet, and it would still be there.

If you're using pj64, the problem is that your computer isn't good enough. N64 isn't the most advanced system on the planet, if you cna't emulate it, your PC is probably quite old. No shame in that, but you'll want a better one to do this, better gfx card maybe? The problem isn't how 'good' the rom is, or your internet speed, unless the files are taking too long to download.

Some games will take less out of your system to play: Simpler games like mario64 and mario kart will run better than goldeneye or turok2.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Extras: Filter Print Post Top
Jump to top Pages: 1

Kraken Kratom Shop: Red Vein Kratom


Similar ThreadsPosterViewsRepliesLast post
* PSX Roms TheDudeAbides 1,266 14 05/24/05 10:23 PM
by Boom
* N64 Emulator and roms DNKYD 964 11 02/26/05 12:40 PM
by MetaShroom
* SNES ROMS particularly RPGs? blacksabbathrulz 951 16 05/26/06 05:22 PM
by browndustin
* The Future of XBox and Playstation (THEY ARE DOOMED!!!)
( 1 2 all )
DarkFluFFy 3,839 20 04/13/06 10:08 PM
by Penguarky Tunguin
* FF7 and FFXI for Playstation 3 Octavius 974 10 04/25/06 11:11 PM
by recalcitrant
* New to Game System Emulators and Roms for them Locus 938 6 10/07/07 02:55 PM
by Locus
* PLAYSTATION 3!!!!!!
( 1 2 all )
KrazieH8er 2,402 35 12/24/03 09:54 AM
by djd586
* "Haight Ashbury In the 60's" cd-rom LearyfanS 951 3 10/20/03 12:44 AM
by LCid

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: Entire Staff
910 topic views. 6 members, 36 guests and 44 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2024 Mind Media. Some rights reserved.

Generated in 0.022 seconds spending 0.008 seconds on 14 queries.