Home | Community | Message Board

Original Seeds Store
This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Shop: North Spore North Spore Mushroom Grow Kits & Cultivation Supplies   Left Coast Kratom Buy Kratom Extract, Kratom Powder For Sale

Jump to first unread post Pages: 1
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
OfflineCrowsnose
Stranger
Registered: 05/30/05
Posts: 52
Last seen: 13 years, 8 months
Peanuts with LSD?
    #5688820 - 05/29/06 10:36 PM (17 years, 8 months ago)

was just rewatching Fear and Loathing in which his attorney states something about peanuts being good for him while experiencing the acid.
Whats the background info on this? in what way will peanuts affect the trip?


Extras: Filter Print Post Top
Offlineonetwo4
herbature
Male

Registered: 07/16/05
Posts: 276
Loc: Lake Tahoe
Last seen: 15 years, 4 months
Re: Peanuts with LSD? [Re: Crowsnose]
    #5688826 - 05/29/06 10:37 PM (17 years, 8 months ago)

they taste good.


--------------------


Extras: Filter Print Post Top
OfflineCptnGarden
fuck this site
Registered: 05/13/04
Posts: 11,945
Last seen: 14 years, 9 months
Re: Peanuts with LSD? [Re: onetwo4]
    #5689005 - 05/29/06 11:25 PM (17 years, 8 months ago)

yeah one time when my cat and his girlfriend and best friend took acid and mushrooms in the woods they ate peanuts at night while trippin balls and they did taste amazing and have a cool sloppy texture in your mouth. better than individualy wrapped taffy squares, which i finaly had fun throwing at things cause they were too frustrating to open while pixelating.


Extras: Filter Print Post Top
Offlinestemmer
Stranger
 User Gallery

Registered: 09/08/05
Posts: 2,672
Last seen: 17 years, 6 months
Re: Peanuts with LSD? [Re: CptnGarden]
    #5689044 - 05/29/06 11:35 PM (17 years, 8 months ago)

Peanuts do have one hell of a unique taste.

Im sure there good while at some stage in a trip.
Kinda like beef jerky, but really just not as good.
Ya shroomie, I said beef jerky.


Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: Peanuts with LSD? [Re: stemmer]
    #5689071 - 05/29/06 11:44 PM (17 years, 8 months ago)

I think I ate peanuts the first time I tripped mushrooms. Or, at least disassembled them from their shells and talked about them with people. I think we all found the taste really interesting, but had no desire to keep eating them.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Extras: Filter Print Post Top
Invisiblehoboblues
Male
Registered: 03/26/06
Posts: 610
Re: Peanuts with LSD? [Re: Koala Koolio]
    #5689115 - 05/29/06 11:58 PM (17 years, 8 months ago)

Pretty sure he said that to calm his ass down. "Peanuts are the only thing that's good for you." Wouldn't you be mowing down on those peanuts if someone said that to you while you're having a bad trip?


--------------------


Extras: Filter Print Post Top
Jump to top Pages: 1

Shop: North Spore North Spore Mushroom Grow Kits & Cultivation Supplies   Left Coast Kratom Buy Kratom Extract, Kratom Powder For Sale


Similar ThreadsPosterViewsRepliesLast post
* will LSD last?
( 1 2 all )
danlennon3 11,875 26 10/01/18 11:06 AM
by nube424
* Diffrence between an LSD trip and Shroom trip.
( 1 2 3 4 all )
ShroomyMcPot 60,647 67 08/22/17 06:02 PM
by Plain
* Preperation of LSD
( 1 2 all )
gargeug 3,874 28 04/05/05 10:15 AM
by Jack_Flash
* making of lsd outdated? gilbert 1,909 12 02/27/05 05:17 PM
by djd586
* do you guys think lsd could affect dna???
( 1 2 all )
agoutihead 6,394 24 12/14/05 10:48 AM
by Mindzpore
* Peanuts and shrooms? Geeno 4,856 12 09/01/03 06:51 PM
by djd586
* making Weed Jerky... a little help Ogla 1,459 6 04/22/06 03:55 AM
by Wysefool
* Peanut shells
( 1 2 all )
t0n3z 35,332 20 04/03/04 12:37 AM
by SummerBreeze

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: psilocybinjunkie, Rose, mushboy, LogicaL Chaos, Northerner, bodhisatta
2,818 topic views. 2 members, 43 guests and 13 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2024 Mind Media. Some rights reserved.

Generated in 0.021 seconds spending 0.007 seconds on 14 queries.