|
butane
bioresearcher


Registered: 04/02/06
Posts: 113
Loc: Minnesota, USA
Last seen: 14 years, 9 months
|
Depositing illegally acquired cash into bank account
#5682914 - 05/28/06 09:30 AM (17 years, 8 months ago) |
|
|
Hypothetically speaking, if one were ordering certain chemicals on the internet and then selling them to friends, how risky is it to keep depositing this cash into a bank account and then using the debit card to purchase more chemicals online? Is someone going to notice this strange influx of cash? How much can I get away with depositing before someone notices? I would just mail the cash to the company, but that's pretty risky too. Any hints, suggestions? Thanks!
-------------------- "...but by and large it was a simple intoxication with most things seeming quite hilarious. The intoxication was also quite extreme."
|
Brainiac
Rogue Scientist


Registered: 04/29/06
Posts: 13,259
Loc: 與您的女朋
|
Re: Depositing illegally acquired cash into bank account [Re: butane] 1
#5682928 - 05/28/06 09:37 AM (17 years, 8 months ago) |
|
|
just put lass than 10,000 any more and the feds will be called
--------------------
Fair is Fair
|
Prisoner#1
Even Dumber ThanAdvertized!


Registered: 01/22/03
Posts: 193,665
Loc: Pvt. Pubfag NutSuck
|
Re: Depositing illegally acquired cash into bank account [Re: Brainiac]
#5683340 - 05/28/06 12:50 PM (17 years, 8 months ago) |
|
|
Quote:
butane said: Hypothetically speaking, if one were ordering certain chemicals on the internet and then selling them to friends, how risky is it to keep depositing this cash into a bank account and then using the debit card to purchase more chemicals online?
one of the dumbest plans ever, online purchases are easily tracked, the cash deposits are the least of your worries, the watched chemicals will send up a red flag and have the 'purchasing agent' under surveilance in no time
Quote:
Brainiac said: just put lass than 10,000 any more and the feds will be called
I believe the amount is now down to $2500 unless you're a business
|
Microcosmatrix
Spiral staircasetechnician


Registered: 10/20/05
Posts: 11,293
Loc: Ythan's house
Last seen: 17 years, 1 month
|
Re: Depositing illegally acquired cash into bank account [Re: Prisoner#1]
#5683442 - 05/28/06 01:40 PM (17 years, 8 months ago) |
|
|
I'd like to see a link on that. $2500 is an awfully low $$ amount for the fed to keep track of all of them. There are an awful lot more $2500+ transactions than $10,000 ones.
|
KaptKid
Spaced Pirate


Registered: 12/11/03
Posts: 6,252
Loc: Bright Side of the Sun
Last seen: 3 years, 11 months
|
Re: Depositing illegally acquired cash into bank account [Re: Microcosmatrix]
#5684525 - 05/28/06 08:28 PM (17 years, 8 months ago) |
|
|
I know in 1991 it was $6000.00, Ask someone in a bank.
-------------------- Child of the 60's, Tripping ever since.
|
Koala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
|
Re: Depositing illegally acquired cash into bank account [Re: KaptKid]
#5684775 - 05/28/06 09:58 PM (17 years, 8 months ago) |
|
|
I agree that 2500 sounds incredibly low.
-------------------- You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!
|
Prisoner#1
Even Dumber ThanAdvertized!


Registered: 01/22/03
Posts: 193,665
Loc: Pvt. Pubfag NutSuck
|
Re: Depositing illegally acquired cash into bank account [Re: KaptKid]
#5685992 - 05/29/06 10:17 AM (17 years, 8 months ago) |
|
|
Quote:
KaptKid said: I know in 1991 it was $6000.00, Ask someone in a bank.
in about '95 it was at $5k, after that my transactions were much larger and I always knew it was reported from there.
LF, it may sound like a very small amount but again, it's dealing with indiviual accounts, not businesses and given todays modern age where manpower is much less a concern with electronic transfers and notifications that are worldwide in a matter of seconds, all stored in these little boxes called computers, it's really not difficult to track a transaction of any amount
they already track emails and the like through the same means
|
Microcosmatrix
Spiral staircasetechnician


Registered: 10/20/05
Posts: 11,293
Loc: Ythan's house
Last seen: 17 years, 1 month
|
Re: Depositing illegally acquired cash into bank account [Re: Prisoner#1]
#5686432 - 05/29/06 01:11 PM (17 years, 8 months ago) |
|
|
OIC, it would be hard to actually investigate them all tho
|
Liquidkick
H2O
Registered: 05/03/02
Posts: 2,635
|
Re: Depositing illegally acquired cash into bank account [Re: Microcosmatrix]
#5687734 - 05/29/06 06:20 PM (17 years, 8 months ago) |
|
|
My friends who work at banks say 10,000.
For individual accounts. He is bank manager.
|
Microcosmatrix
Spiral staircasetechnician


Registered: 10/20/05
Posts: 11,293
Loc: Ythan's house
Last seen: 17 years, 1 month
|
Re: Depositing illegally acquired cash into bank account [Re: Liquidkick]
#5687753 - 05/29/06 06:26 PM (17 years, 8 months ago) |
|
|
That's what I thought.
|
tak
geo's henchman



Registered: 11/20/00
Posts: 3,776
Loc: nowhereland
|
Re: Depositing illegally acquired cash into bank account [Re: Microcosmatrix]
#5689634 - 05/30/06 03:12 AM (17 years, 8 months ago) |
|
|
they sell prepaid anonymous type credit cards...that way you dont get screwed, and you can keep it out of the bank.
-------------------- The DJ's took pills to stay awake and play for seven days.
|
Prisoner#1
Even Dumber ThanAdvertized!


Registered: 01/22/03
Posts: 193,665
Loc: Pvt. Pubfag NutSuck
|
Re: Depositing illegally acquired cash into bank account [Re: Liquidkick]
#5690024 - 05/30/06 09:02 AM (17 years, 7 months ago) |
|
|
Quote:
Liquidkick said: My friends who work at banks say 10,000. For individual accounts. He is bank manager.
I've had to fill out the IRS forms on $5000 deposits/withdrawals
|
OrizonsHorizon
Stranger
Registered: 10/10/05
Posts: 404
Last seen: 16 years, 10 months
|
Re: Depositing illegally acquired cash into bank account [Re: Prisoner#1]
#5690143 - 05/30/06 10:20 AM (17 years, 7 months ago) |
|
|
I have deposited 25000+ in cash into the bank and havent heard from anybody yet. I own a bunch of vending accounts where all the revune is coins/singles.
|
wilshire
free radical


Registered: 05/11/05
Posts: 2,421
Loc: SE PA
Last seen: 14 years, 3 days
|
Re: Depositing illegally acquired cash into bank account [Re: butane]
#5690295 - 05/30/06 11:21 AM (17 years, 7 months ago) |
|
|
I would just mail the cash to the company, but that's pretty risky too. Any hints, suggestions? Thanks!
money orders.
|
Prisoner#1
Even Dumber ThanAdvertized!


Registered: 01/22/03
Posts: 193,665
Loc: Pvt. Pubfag NutSuck
|
Re: Depositing illegally acquired cash into bank account [Re: OrizonsHorizon]
#5690614 - 05/30/06 12:49 PM (17 years, 7 months ago) |
|
|
Quote:
OrizonsHorizon said: I have deposited 25000+ in cash into the bank and havent heard from anybody yet. I own a bunch of vending accounts where all the revune is coins/singles.
generaly you dont here from them unless you arent paying taxes
|
OrizonsHorizon
Stranger
Registered: 10/10/05
Posts: 404
Last seen: 16 years, 10 months
|
Re: Depositing illegally acquired cash into bank account [Re: Prisoner#1]
#5690696 - 05/30/06 01:18 PM (17 years, 7 months ago) |
|
|
well I'm not paying/claiming sales tax nor income tax....When I place an order from Coke, they do charge sales tax on there bill. I probably should investigate this---I dont know if Im somebody whos just slipping through the cracks but Im currently not paying any taxes watsover. I dont know if having a "student account" has anything to do with it but my bank associate should of told me something by now if I was doing anything blatantly illegal. I have well over 30000 in that account----25,000 was deposited in the form of coin wraps and singles.
|
Shroom_Guy
Boss

Registered: 03/05/03
Posts: 50
Loc: Canada
Last seen: 9 years, 6 months
|
Re: Depositing illegally acquired cash into bank account [Re: OrizonsHorizon]
#5693176 - 05/30/06 11:17 PM (17 years, 7 months ago) |
|
|
how long do they keep bank records? in canada
how do you close ur bank account?
what happends if you dont close your account and theres no money in there.
-------------------- Lay'd back in the Lac Grippin the Grain as i Cruise Through the Streets.
|
OrizonsHorizon
Stranger
Registered: 10/10/05
Posts: 404
Last seen: 16 years, 10 months
|
Re: Depositing illegally acquired cash into bank account [Re: Shroom_Guy]
#5696314 - 05/31/06 07:43 PM (17 years, 7 months ago) |
|
|
Quote:
how long do they keep bank records? in canada
I have no idea....records can probably be accessed for years since everything is stored on a network.
Quote:
how do you close ur bank account?
YOu just go in and say I would like to close my account...takes about 5 minutes and they give you a money order,check (or cash if they amount isnt 5 digits)
Quote:
what happends if you dont close your account and theres no money in there.
Shit doenst happen in the US and I doubt it will happen in Canada either. I access my online banking everyother day, view my available funds/history and transfer money to my paypal moneymarket to get the higher insterest rates.
|
StroFun
Repeater


Registered: 07/11/06
Posts: 977
Loc: Mycotopia.net
|
Re: Depositing illegally acquired cash into bank account [Re: Prisoner#1]
#6742076 - 04/03/07 12:32 PM (16 years, 9 months ago) |
|
|
I know this is old but just in case anyone is searching for info, as of yesterday the USPS anti money laundering program's dollar amount is down to $3000.00 you have to fill out a form blah blah blah.
This includes purchasing money orders.
|
dedjam
Electro Penguin




Registered: 12/14/05
Posts: 2,139
Loc: Moralton, Statesota
Last seen: 12 years, 8 months
|
Re: Depositing illegally acquired cash into bank account [Re: StroFun]
#6742510 - 04/03/07 02:23 PM (16 years, 9 months ago) |
|
|
Yes it is 3000, and it has been 3000 for a while.
I have been through about 30 anti-money laundering classes. There is more in place than you can imagine to connect the dots of money laundering. I also write AML software for banks across the nation. You arent going to get away with any large amounts of money unless you have a business and a good reason for depositing it.
If you want to launder money, then stay under 1000 bucks. And if depositing that much is suspicious for your account, expect our software to alert a banker who may then file a SAR (suspicious activity report). There are many many other reasons SAR's are filed too...dont fuck with banks.
If you really need to launder large amounts of money, get yourself an attorney, set yourself up a good LLC for a front, and get yourself a good accountant (accountants and lawyers can almost always be payed off to do whatever you want them to...but realize they will always put you in the position to take the fall).
Honestly, there are pleanty of things you can still do with cash. Dont try to integrate your drug money into your finances, thats when you really get into some high crime...and you wont have local PD after you, DEA will be all over it when you start to make real money from drugs.
Yea people get away with it, but its only time. People also get caught ever day, and the penalties for money laundering get stricter all the time. Money laundering also falls under the jurisdiction of the Patriot Act...are you ready to lay down all of your rights just to get money into the bank?
|
Le_Canard
The Duk Abides


Registered: 05/16/03
Posts: 94,392
Loc: Earthfarm 1
|
Re: Depositing illegally acquired cash into bank account [Re: Prisoner#1]
#6742520 - 04/03/07 02:25 PM (16 years, 9 months ago) |
|
|
Quote:
Prisoner#1 said:
Quote:
butane said: Hypothetically speaking, if one were ordering certain chemicals on the internet and then selling them to friends, how risky is it to keep depositing this cash into a bank account and then using the debit card to purchase more chemicals online?
one of the dumbest plans ever, online purchases are easily tracked, the cash deposits are the least of your worries, the watched chemicals will send up a red flag and have the 'purchasing agent' under surveilance in no time
Yes, you've left a pretty clear paper trail there.
|
dedjam
Electro Penguin




Registered: 12/14/05
Posts: 2,139
Loc: Moralton, Statesota
Last seen: 12 years, 8 months
|
Re: Depositing illegally acquired cash into bank account [Re: Le_Canard]
#6745370 - 04/04/07 07:39 AM (16 years, 9 months ago) |
|
|
Quote:
ToiletDuk said: Yes, you've left a pretty clear paper trail there.
There is ALWAYS a paper trail, whether you create it or not, someone else is. A paper trail isnt a bad thing, its when the trail leads back to you that the problems arise. Always leave a paper trail, but make sure it leads to a dead end...that takes some time and logical thinking, which most small time drug dealer wannabe's seem to be missing.
|
ninfan77
Stranger
Registered: 09/30/06
Posts: 68
Last seen: 15 years, 3 months
|
Re: Depositing illegally acquired cash into bank account [Re: dedjam]
#6749646 - 04/05/07 07:54 AM (16 years, 9 months ago) |
|
|
This is why you dont use banks.
You can pay for most bills in cash w/ no problems. A few friends can quickly canvas an area to buy money orders if you need to make large purchases. Or just use a credit card and then pay that down over time.
If you want to buy a car/house yea you're gonna need to finance it to avoid suspicion. But then just pay up to 1500 a month on it. sure takes time, but better than being caught for buying a 20,000 car in cash.
If your credit sucks, get a friend to take out the loan, pay it off for them, their credit goes up, and its reasonably simple to hand off property to another person. Pay some laywer/realtor fees for property, and just pay the title xfer fees for cars.
You could start a business, LLC preferably, but this will take more work on your part. Investing into a business may be a better idea. Obviously you can't go out and tell Papa John's you got $100,000 to franchise with. They are going to want bank records, credit history, etc etc.
But a local business that does well, looking to expand, always needs investors. And very few will ask questions.
|
RoosterCogburn
Fearless,one-eyed U.S.Marshall



Registered: 08/25/06
Posts: 8,508
Loc: Dirty South, NJ
Last seen: 12 years, 4 months
|
Re: Depositing illegally acquired cash into bank account [Re: ninfan77]
#6749693 - 04/05/07 08:09 AM (16 years, 9 months ago) |
|
|
1. Buy a good, fireproof heavy ass safe. 2. Memorize combination over a few days. 3. Trade drugs for cash. 4. Stack cash in safe until full. 5. Check out and move to Costa Rica.
Fuck banks... My single bank account exists for the sole purpose of holding less than $5,000 and having a debit card for all my legal purchases. I only deposit paychecks and tax refunds in there...
ANYTHING I make doing anything else, even very legal programming side jobs, goes into a safe. No one but ME needs to know my fucking business.
I been fucked over by banks long enough... I don't need them sending SARs on my behalf!
|
StroFun
Repeater


Registered: 07/11/06
Posts: 977
Loc: Mycotopia.net
|
Re: Depositing illegally acquired cash into bank account [Re: RoosterCogburn]
#6774458 - 04/11/07 10:21 AM (16 years, 9 months ago) |
|
|
Would a sar be filed if one were to disperse funds through separate banks?
|
dedjam
Electro Penguin




Registered: 12/14/05
Posts: 2,139
Loc: Moralton, Statesota
Last seen: 12 years, 8 months
|
Re: Depositing illegally acquired cash into bank account [Re: StroFun]
#6774572 - 04/11/07 10:55 AM (16 years, 9 months ago) |
|
|
Quote:
StroFun said: Would a sar be filed if one were to disperse funds through separate banks?
depends on the situation, and the amounts. If you do throw up flags at either bank, and local law in altered then you will have alot more explaining to do. Of course, if you are doing small deposities in multiple accounts, then you will be ok...for a little while. But dont forget, your accounts are record..when tax time comes you better hope you dont get audited with all those accounts with small numbers filling them up.
If it appearts you are trying to avoid getting a SAR filed on you, but structuring your deposites so they consistently remain under reporting requirements, then that is also a reason to file a SAR.
|
p0ng
Stranger

Registered: 11/08/05
Posts: 435
Last seen: 6 years, 11 months
|
Re: Depositing illegally acquired cash into bank account [Re: dedjam]
#6778499 - 04/12/07 09:45 AM (16 years, 9 months ago) |
|
|
banks are as gay as aids
-------------------- Co-President of http://www.FantomFitness.com
|
Legend9123



Registered: 09/24/06
Posts: 2,590
Last seen: 8 months, 13 days
|
Re: Depositing illegally acquired cash into bank account [Re: p0ng]
#6779346 - 04/12/07 03:15 PM (16 years, 9 months ago) |
|
|
Constructive comment.....
I think the best way to do it is to not put it in a bank and instead keep it in a safe. As was said there is no need for the government to need to know everything going on.
-------------------- Those who would give up a little freedom to get a little security shall soon have neither. -Benjamin Franklin
|
guitarguy0123
Stranger


Registered: 02/26/07
Posts: 233
Last seen: 6 years, 1 month
|
Re: Depositing illegally acquired cash into bank account [Re: Legend9123]
#6780330 - 04/12/07 07:50 PM (16 years, 9 months ago) |
|
|
Maybe look into offshore bank accounts from countries that aren't best buddies with whatever country you're in.
-------------------- I don't know what's gonna happen man, but I wanna have my kicks before the whole shithouse goes up in flames. -Jim Morrison
|
dedjam
Electro Penguin




Registered: 12/14/05
Posts: 2,139
Loc: Moralton, Statesota
Last seen: 12 years, 8 months
|
Re: Depositing illegally acquired cash into bank account [Re: guitarguy0123]
#6782108 - 04/13/07 06:41 AM (16 years, 9 months ago) |
|
|
Quote:
guitarguy0123 said: Maybe look into offshore bank accounts from countries that aren't best buddies with whatever country you're in.
Unless you are traveling there, good luck getting it wired across. Plus the big banks in the Camans and the Swiss banks require big money to open annonymous accounts. Then you have to figure out how to get your money into those accounts....usually the best way is to route it through multinational companies. A wiretransfer will still get you taxed and listed, and there will still be a paper trail.
|
StroFun
Repeater


Registered: 07/11/06
Posts: 977
Loc: Mycotopia.net
|
Re: Depositing illegally acquired cash into bank account [Re: dedjam]
#6782787 - 04/13/07 11:33 AM (16 years, 9 months ago) |
|
|
keep it in the safe until when? I wouldn't want dirty money in my house. I wouldn't want to use dirty money to make legitimate purchases either.
|
kotik
fuckingsuperhero


Registered: 06/29/04
Posts: 3,531
Last seen: 4 years, 24 days
|
Re: Depositing illegally acquired cash into bank account [Re: StroFun]
#6784373 - 04/13/07 07:10 PM (16 years, 9 months ago) |
|
|
put illegally acquired cash (to save) into ANNUITIES. They are probably the only type of account you can open that not even the IRS, FBI, etc. can touch.
-------------------- No statements made in any post or message by myself should be construed to mean that I am now, or have ever been, participating in or considering participation in any activities in violation of any local, state, or federal laws. All posts are works of fiction.
|
fastfred
Old Hand



Registered: 05/17/04
Posts: 6,899
Loc: Dark side of the moon
|
Re: Depositing illegally acquired cash into bank account [Re: kotik] 1
#6785230 - 04/13/07 11:13 PM (16 years, 9 months ago) |
|
|
> I wouldn't want dirty money in my house.
US bills have mostly cotton in them, so you can just throw them in the washer. That should clean them up and give them that cool washed look.
|
HUBSonDUBS



Registered: 09/01/05
Posts: 890
Last seen: 1 day, 18 hours
|
Re: Depositing illegally acquired cash into bank account [Re: fastfred]
#6822093 - 04/23/07 07:07 AM (16 years, 9 months ago) |
|
|
I dunno I just doposited $3,400 into my account all in 100 dollar bills and just handed it to the guy and he put it into my account.
--------------------
|
dedjam
Electro Penguin




Registered: 12/14/05
Posts: 2,139
Loc: Moralton, Statesota
Last seen: 12 years, 8 months
|
Re: Depositing illegally acquired cash into bank account [Re: HUBSonDUBS]
#6826503 - 04/24/07 07:44 AM (16 years, 9 months ago) |
|
|
Quote:
HUBSonDUBS said: I dunno I just doposited $3,400 into my account all in 100 dollar bills and just handed it to the guy and he put it into my account.
Congradulations, computers are now processing that data and printing up a report. Because it was a transaction over 3k, there will be a special report to be reviewed of that transaction. If it differs from your normal banking routine the software will pick up on that and send up a flag for account review. When the bank employee checks your account they will decide if it looks suspicious and from there a SAR may be filled out.
Realize all this happens without you knowing. By LAW you are NOT allowed to know. A tellers job is to take your money and smile, not alert you to what is being done behind the scenes.
|
RemainRandom50
Do You Need ToKnow Me?
Registered: 01/15/06
Posts: 1,695
Last seen: 14 years, 9 months
|
Re: Depositing illegally acquired cash into bank account [Re: dedjam]
#6829344 - 04/24/07 09:00 PM (16 years, 9 months ago) |
|
|
IMO, as told from a wise man.
NEVER use the cash from illegal items (anything including drugs) to deposit into the bank. It will only make more problems arise.
-------------------- At times I get consumed by my everyday life and will leave the Shroomery. Yet, every time drugs come falling into my life for fun.....I always think about the Shroomery and then I'm back!
|
Hippie Chemist
Freeing Minds


Registered: 04/05/07
Posts: 430
Loc: Far Out There
Last seen: 15 years, 9 months
|
Re: Depositing illegally acquired cash into bank account [Re: RemainRandom50]
#6829447 - 04/24/07 09:23 PM (16 years, 9 months ago) |
|
|
Don't sell RC's for a lot of profit. Just make enough to buy another couple grams, and save the rest. After all, +98% pure won't be available forever, dude. Imagine how nice it would be to have a closed container of Sandoz LSD-25 for the aesthetic value...and a few vials on the side for personal use, of course.
-------------------- Long you live and high you fly And smiles you'll give and tears you'll cry And all you touch and all you see Is all your life will ever be. -Pink Floyd-
|
Diploid
Cuban



Registered: 01/09/03
Posts: 19,274
Loc: Rabbit Hole
|
Re: Depositing illegally acquired cash into bank account [Re: butane]
#6830655 - 04/25/07 03:40 AM (16 years, 9 months ago) |
|
|
I think that with the recent passing of the Patriot Act, a lot of electronic snooping and cross referencing of ALL deposits, regardless of amount, is taking place. They're looking for patterns, not dollar amounts, to find terrorists as well as pot heads.
If you're doing something the law doesn't like, don't use a bank. They're all in bed with the government.
That said, here are some details that are known with some certainty.
--
Avoiding suspicious activity reports in cash transactions by Blaine O'Connor
Many people ask "just what is considered illegal or suspicious activity when moving cash?" Some people have gone to the bank with the cash proceeds of a garage sale or a car sale on the weekend, and recounted horror stories of multiple questions by bank employees and have sometimes been reported to the government as suspected criminals. The reality is that such reporting is very plausible. Most western countries have enacted cash transaction legislation that mandates it. In Australia and Canada, anything over $10,000 must be reported to regulators, and any amount under that that bank staff deem suspicious. Likewise in the U.S. So, if you’re unusually scruffy-looking and wander into a bank with only $4,000 cash to deposit - well below the $10,000 limit - it’s still very possible you could be reported to authorities by the teller. (See our article Money Laundering Defined for details on U.S. Currency Transfer Reports, or CTRs.) Here’s a list of most things that can trigger staff’s suspicion and get you reported next time you go to the bank. Banks will not give you a list of or even admit the existence of these criteria, regardless how much you ask.
- A customer refuses to provide identification or explain the purpose of a transaction. - A customer has a known criminal background and engages in substantial transactions. - A customer is ignorant of basic facts regarding the transaction or is unconcerned about rates, taxes, etc. - A customer is controlled by another person, particularly where the customer appears unaware, infirm or elderly and is accompanied by a non-relative. - A customer conducts cash transactions when his/her employment or business does not ordinarily generate or require such amounts of cash. - A customer repeatedly sends or receives wire transfers of any dollar amount when his/her business does not normally require or originate such wires. - A customer has no apparent source of income, yet conducts repeated transactions. - A customer offers a seller a gift, gratuity or bribe to complete a transaction. - A customer divides transactions into smaller amounts to avoid identification or reporting requirements.
Suspicious Customer Behavior
- Customer has an unusual or excessively nervous demeanor. - Customer discusses your record keeping or reporting duties with the apparent intention of avoiding them. - Customer threatens an employee attempting to deter a record keeping or reporting duty. - Customer is reluctant to proceed with a transaction after being told it must be reported. - Customer suggests payment of a gratuity to an employee of the financial institution. - Customer appears to have a hidden agenda or behaves abnormally, such as bypassing the chance to obtain a higher interest rate on a large account balance. - Customer who is a public official opens account in the name of a family member who begins making large deposits not consistent with the known legitimate sources of income of the family. - Customer makes a large cash deposit without counting the cash. - Customer frequently exchanges small bills for large bills. - Customer's cash deposits often contain counterfeit bills or musty or extremely dirty bills. - Customer who is a student uncharacteristically transfers or exchanges large sums of money. - Account shows high velocity in the movement of funds but maintains low beginning and ending daily balances. - Transaction includes correspondence received that is a copy rather than original letterhead. - Transaction involves offshore institutions whose names resemble those of well-known legitimate financial institutions. - Transaction involves unfamiliar countries or islands that cannot be found in an atlas or map. - Agent, attorney or financial advisor acts for another person without proper documentation such as a power of attorney.
Suspicious Customer Identification Circumstances
- Customer furnishes unusual or suspicious identification documents and is unwilling to provide personal background data. - Customer is unwilling to provide personal background information when opening an account. - Customer opens an account without identification, references or a local address. - Customer's permanent address is outside the bank's service area or outside the country. - Customer's home or business telephone is disconnected. - A business customer is reluctant to reveal details about the business activities or to provide financial statements or documents about a related business entity. - Customer provides no record of past or present employment on a loan application. - Customer claims to be a law enforcement agent conducting an undercover operation, when there are no valid indications to support that.
Suspicious Cash Transactions
- Customer comes in with another customer and they go to different tellers to conduct currency transactions of less than $10,000. - Customer makes large cash deposit containing many $50 and $100 dollar bills. - Customer opens several accounts in one or more names, then makes several cash deposits that are less than $10,000. - Customer conducts unusual cash transactions through night deposit boxes, especially large sums that are not consistent with the customer's business. - Customer makes frequent deposits or withdrawals of large amounts of currency for no apparent business reason, or for a business that generally does not generate large amounts of cash. - Customer conducts several large cash transactions at different branches on the same day, or orchestrates persons to do so on his behalf. - Customer deposits cash into several accounts in amounts below $10,000 and then consolidates the funds into one account and wire transfers them outside of the country. - Customer attempts to take back a portion of a cash deposit that exceeds $10,000 after learning that a currency transaction report will be filed on the transaction. - Customer conducts several cash deposits below $10,000 at automated teller machines. - Corporate account has deposits or withdrawals primarily in cash rather than cheques. - Customer frequently deposits large sums of cash wrapped in currency straps, stamped by other banks. - Customer makes frequent purchases of monetary instruments for cash, in amounts less than $10,000. - Customer conducts an unusual number of foreign currency exchange transactions. - Customer frequently uses foreign currency to purchase bank cheques under $3,000.
Suspicious Non-Cash Deposits
- Customer deposits a large number of traveller's cheques often in the same denomination and in sequence. - Customer deposits money orders bearing unusual markings.
Suspicious Wire Transfer Transactions
- Non-accountholder sends wire transfer with funds that include numerous monetary instruments of less than $10,000 each. - An incoming wire transfer has instructions to convert the funds to bank cheques and mail them to a non-accountholder. - A wire transfer that moves large sums to secrecy havens such as the Cayman Islands, Hong Kong, Luxembourg, Panama or Switzerland. - An incoming wire transfer followed by an immediate purchase by the beneficiary of monetary instruments for payment to another party. - An increase in international wire transfer activity, in an account with no history of such activity or where the stated business of the customer does not warrant it. - Customer frequently shifts purported international profits by wire transfer out of their home country. - Customer receives many small incoming wire transfers and then orders a large outgoing wire transfer to another country. - Customer deposits bearer instruments followed by instructions to wire the funds to a third party. - Account in the name of a currency exchange house receives wire transfers or cash deposits of less than $10,000.
Suspicious Safe Deposit Box Activity
- Customer's activity increases in the safe deposit box area, possibly indicating the safekeeping of large amounts of cash. - Customer often visits the safe deposit box area immediately before making cash deposits of sums less than $10,000. - Customer rents multiple safe deposit boxes.
Suspicious Activity in Credit Transactions
- A customer's financial statement makes representations that do not conform to Generally Accepted Accounting Principles. - A transaction is made to appear more complicated than it needs to be by use of impressive but nonsensical terms such as "emission rate," "prime bank notes," "standby commitment," "arbitrage" or "hedge contracts." - Customer requests loans to offshore companies or secured by obligations of offshore banks. - Customer suddenly pays off a large problem loan with no plausible explanation for the source of funds. - Customer purchases certificates of deposit and uses them as collateral for a loan. - Customer collateralises a loan with cash deposits. - Customer uses cash collateral located offshore to obtain a loan. - Customer's loan proceeds are unexpectedly transferred offshore.
Suspicious Commercial Account Activity
- Business customer presents financial statements noticeably different from those of similar businesses. - A large business presents financial statements that are not prepared by an accountant. - Retail business that provides cheque cashing service does not make large withdrawals of cash against cheque deposits, possibly indicating that it has another source of cash. - Customer maintains an inordinately large number of accounts for the type of business purportedly being conducted. - Corporate account shows little or no regular, periodic activity. - A transaction includes circumstances that would cause a banker to reject a loan application because of doubts about the collateral's validity.
Suspicious Trade Financing Transactions
- Customer seeks trade financing on the export or import of commodities whose stated prices are substantially more or less than those in a similar market situation. - Customer makes changes to a letter of credit beneficiary just before payment is to be made. - Customer changes the place of payment in a letter of credit to an account in a country, other than the beneficiary's stated location. - Customer's standby letter of credit is used as a bid or performance bond without the normal reference to an underlying project or contract, or in favor of unusual beneficiaries.
Suspicious Investment Activity
- Customer uses an investment account as a pass-through vehicle to wire funds, particularly to off-shore locations. - Investor seems unconcerned about the usual decisions to be made about an investment account such as fees or suitable investment vehicles. - Customer wants to liquidate a large position through a series of small transactions. - Customer deposits cash, money orders, traveller's cheques or bank cheques in amounts under $10,000 to fund an investment account. - Customer cashes out of annuities during the "free look" period or surrenders early.
Suspicious Employee Activity
- Employee exaggerates the credentials, background or financial ability and resources of a customer, in written reports the bank requires. - Employee frequently is involved in unresolved exceptions or recurring exceptions on exception reports. - Employee lives a lavish lifestyle that could not be supported by his or her salary. - Employee frequently overrides internal controls or established approval authority or circumvents policy. - Employee uses company resources to further private interests. - Employee assists transactions where the identity of the ultimate beneficiary or counter party is undisclosed. - Employee avoids taking holidays.
https://www.powerprivacy.com/site.php/arti/read/suspiciousactivityreports
-------------------- Republican Values: 1) You can't get married to your spouse who is the same sex as you. 2) You can't have an abortion no matter how much you don't want a child. 3) You can't have a certain plant in your possession or you'll get locked up with a rapist and a murderer. 4) We need a smaller, less-intrusive government.
|
dedjam
Electro Penguin




Registered: 12/14/05
Posts: 2,139
Loc: Moralton, Statesota
Last seen: 12 years, 8 months
|
Re: Depositing illegally acquired cash into bank account [Re: Diploid]
#6830960 - 04/25/07 07:32 AM (16 years, 9 months ago) |
|
|
Quote:
Diploid said: They're looking for patterns, not dollar amounts, to find terrorists as well as pot heads.
No, we look for both, and a host of other things. Just stay away from banks with illegal money. Im telling you we write applications that look for so many things and compare and crunch so much data its insane.
Banks arent exactly happy about the provisions of the patriot act, as many banks dont care what their clients do, they want the money, but sadly the government has reached out its strong arm and put a choke hold on the banks. (Kinda good for me though, keeps me writing all sorts of new software every damn time they decide to change a standard)
They do look for pot heads though, well not pot heads, but drug crimes. I could swear some of the algorithms are designed specifically to target even small time dealers. Patterns are bad, but so are lack of patterns. Everything is bad. Heck, legal transactions with cash can get you in trouble unless you have documentation to back that up. Cash is being fazed out, as are checks now. The goal in the industry is to be all electronic as quick as possible. The Fed Reserve is working hard to come up with standards (X9.37) for all forms of electronic money transfers.
|
mycologyslutbag
Stranger
Registered: 11/27/06
Posts: 17
Last seen: 12 years, 6 months
|
Re: Depositing illegally acquired cash into bank account [Re: dedjam]
#6868235 - 05/03/07 04:22 PM (16 years, 8 months ago) |
|
|
I can see what you're saying about cash being fazed out. What will people do to purchase drugs then? Or for prostitution. Or any illegal thing someone wants to purchase. Or when playing a poker game for money? Or what if someone wants to go to the strip club and spend his money anonymously? How can we faze out cash completely and still have anonymity? Or when you say fazed out do you mean mostly fazed out.
In my eyes, there's demand for the ability to make financial transactions completely anonymously, a demand which I see no end to. Are there other possibilities than cash for such transactions? That is, completely or nearly completely untracable transactions, for both parties in a trade?
Edited by mycologyslutbag (05/03/07 11:29 PM)
|
fastfred
Old Hand



Registered: 05/17/04
Posts: 6,899
Loc: Dark side of the moon
|
Re: Depositing illegally acquired cash into bank account [Re: Diploid]
#6872202 - 05/04/07 01:00 PM (16 years, 8 months ago) |
|
|
Thanks for that list Diploid. Very interesting. I get the feeling that Australia knows a lot more about it's citizens than US banks do.
A lot of stuff on that list is kinda silly. That list probably worked better way back when tellers might actually have a clue of who you are or what you do. Most of the stuff on the list is fairly normal banking activity anyway.
Personally, I know I would have a shit-fit if a teller ever asked me anything other than "How would you like that?" or "Checking or savings?" I would seriously raise some hell at that bank if they even asked. It's none of their business. I've been conversational with the tellers many times during transactions (some kind of odd and semi high dollar) and they've never once asked any personal questions about my transactions. I actually knew one teller fairly well and would chat with him for several minutes each time. He never once inquired about anything other than chit-chat questions.
I think that there's a lot of crazy behind the scenes BS going on, but most of the things mentioned here are just paranoia. We're worrying about the wrong things IMO.
-FF
|
fastfred
Old Hand



Registered: 05/17/04
Posts: 6,899
Loc: Dark side of the moon
|
Re: Depositing illegally acquired cash into bank account [Re: fastfred]
#6872322 - 05/04/07 01:44 PM (16 years, 8 months ago) |
|
|
> No, we look for both, and a host of other things. > Im telling you we write applications that look for so many things and compare and crunch so much data its insane.
I think you're probably just generating a bunch of garbage data then. (no offense) Doing that probably just makes it easier for illegal transactions to slip by since you're creating such large lists of "suspicious activity".
People are not very susceptible to analysis by algorithms. They're not robots. Many people have completely erratic banking behavior, and everyone makes a few strange transactions now and again.
Besides, so what if you have a stack of SARs a mile high? The IRS might care if you have massive amounts of unreported income. The FBI might care if they think that you're involved in big-time money laundering. Otherwise there's not really anything to worry about. If banks start sending in SARs for smaller amounts or even patterns that don't add up to big dollars the IRS or FBI is just going to send them straight to the shredder. They don't have time to look at low dollar SARs generated from the 300 billion people in the US.
> I could swear some of the algorithms are designed specifically to target even small time dealers.
I'd like to hear more about that... But the idea is just plain ridiculous. Besides the near impossibility of doing it, most dealers don't even use banks. They don't withdraw several thousand to buy a pound, sell it, deposit the cash, then withdraw money again to re-up.
Besides you could never get a warrant based on bank transactions like that, so why would they even bother looking at them?
> Cash is being fazed out, as are checks now.
No way. That will NEVER happen. In fact, the number of US dollars in circulation has increased steadily since 1930. That's not just population increase either. The amount of cash per capita almost doubled from 1990-2000.
Despite the insane rate of increase in electronic transactions people posses more cash per person now than they ever have. The US treasury prints $698 million dollars EACH DAY. There is over $2,000 dollars in cash for every man, woman, and child in the US. In 2006 8.2 billion paper currency notes were printed.
> How can we faze out cash completely and still have anonymity?
There are many schemes around. You can use eGold.com to use precious metals for transactions. There are also various ideas about how to use cryptography to produce electronic currency. The idea is to produce etokens than can be traded around and redeemed without any central system. It's a good idea, but a long ways off.
-FF
|
mycologyslutbag
Stranger
Registered: 11/27/06
Posts: 17
Last seen: 12 years, 6 months
|
Re: Depositing illegally acquired cash into bank account [Re: fastfred]
#6872367 - 05/04/07 01:59 PM (16 years, 8 months ago) |
|
|
Thanks FF,
Can one raise suspicion if they deposit work checks into an account, and never touch it except for large finances (car, mortgage, etc)? It's possible to use cash for so many things, is there ever suspicion raised if you Don't at all tap into your account. I mean you could always say you live off of your sugar momma. And am I correct that you should absolutely do major finances with your legally backed up money? Will it raise suspicion when buying a car if the car is one of the only things you've withdrawn money for?
I'm very interested in the idea of electronic money which could give one anonymity, cause I know we'll always need it. There are far too many legal goods and services which people have full justification to demand anonymity when procuring them. I brought up simple poker, or going to a stripclub and spending without a trail, do you believe we'll have effective anonymous electronic ways to gamble with money or do you think this is the type of niche cash will survive in?
Edited by mycologyslutbag (05/04/07 02:05 PM)
|
fastfred
Old Hand



Registered: 05/17/04
Posts: 6,899
Loc: Dark side of the moon
|
Re: Depositing illegally acquired cash into bank account [Re: mycologyslutbag]
#6872475 - 05/04/07 02:39 PM (16 years, 8 months ago) |
|
|
I don't think it would be any sort of problem. You could also deposit reasonable sums on top of it without being suspicious. It would probably be best to use a savings account to do what you suggest. People don't often spend from a savings account, they just save money and put it in there. And when people do withdraw from a savings account it's usually in larger chunks.
If you're ever asked you can make up any excuse you want, they're all reasonable. I got a sugar momma, I'm a kept man, my parents support me, I live off an inheritance, I have a scholarship, I'm a hermit, I live in a trailer I own, etc.. If you're going to tell it to the IRS you should have an excuse that is unverifiable or will stand up. If the bank ever asked me I would say "My personal finances are none of your business," if I was in a good mood. Otherwise I would be really pissed if they tried to pry into my personal life.
It's a good idea to deposit your checks in the bank so that you can prove the source of the money. If you want cash you can always go to the bank it's drawn on and cash it there with minimal hassles.
You've got the right idea about buying things... Never, ever use illegal cash to buy any item with a title. Cars, boats, houses, etc.. If it has a title it's a known, trackable asset and the IRS will know about it if they ever care to check.
I know a guy who showed up to a dealership with a briefcase full of cash to buy a car. He knew someone at the dealership so he thought things would go smoothly. As soon as he opened the briefcase they said "Are you crazy, I can't do that!" and pointed him straight out the door. They told him that they were doing him a favor because most places will take the cash, but have to report it right away and then you end up in big trouble.
Even if you have the cash the best thing to do is to finance any large purchases. If you have legal cash like you were talking about then you can pay cash if you want. If you get a loan for a car you can then spend as much as you want because once it's broken down into small payments there's not much they can say about it. Even someone with no reportable income can usually come up with a couple hundred bucks to make a loan payment. Even if you car is $50,000 they can't pin you for ever having had a large sum of cash.
As far as anonymous electronic money... I think it will start to be used a bit more often. But it's going to take a long time to really catch on. Cash is still alive and well all over the world. There is nothing easier to use or more widely accepted than the US dollar. It's not going to die out in our lifetimes. The US would have a really hard time eliminating cash even if they made it their number one priority. The US dollar is the most respected and accepted form of money in the world. You can spank down US money in any country in the world and it is gladly accepted. In quite a few countries it's even preferred to their own currency amongst the people. No other country or form of money can claim that level of acceptance.
Another thing people forget about is that using plastic, checks, money orders, wire transfers, western union, etc. all costs money. Either you or the buyer is throwing money away just for the privilege of making the transaction. Cash doesn't have this problem. Checks are a major hassle both to write and to accept and you don't even know if they're good or not. A lot of places have minimum purchase amounts for plastic or charge a surcharge. Cash is just never going to go away.
|
Beekly
Beaker

Registered: 12/05/14
Posts: 9
Last seen: 8 months, 26 days
|
Re: Depositing illegally acquired cash into bank account [Re: butane]
#27076785 - 12/07/20 09:10 AM (3 years, 1 month ago) |
|
|
IDK if it is applicable, but I have always felt the best things to spend illegal cash on is higher education and qualifications, parties, drugs, and tattoos, as if you ever get caught, they cannot take those things away, and to bury it in containers in the yard or hide it in relatives attics, but don't put all your eggs in 1 basket. Bury it in a time capsule, and it would be good to have a rainy day fund you just need to dig up. Maybe buy gold with it if your country uses paper money and bury that. But if you have that plastic money it helps like Canada and Australia (I think).
|
|