Home | Community | Message Board

MagicBag Grow Bags
This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Shop: Left Coast Kratom Buy Kratom Capsules   Unfolding Nature Unfolding Nature: Being in the Implicate Order   PhytoExtractum Kratom Powder for Sale   North Spore Bulk Substrate   Original Sensible Seeds Autoflowering Cannabis Seeds   Mushroom-Hut Substrate Mix

Jump to first unread post Pages: 1 | 2 | Next >  [ show all ]
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
InvisibleUnderNose
all out of bubble gum
 User Gallery

Registered: 03/04/06
Posts: 1,612
Just wanted to share my legal peyote with you
    #5680136 - 05/27/06 11:06 AM (17 years, 8 months ago)

Hay all,
Just got them 3 days ago, Just the start of a big collection I hope.
Time to read up on grafting.


Little one year old peyote aren't they cute :heart:
Totally legal in Australia to have as many of these I want.
I could live in a house made of Peyote and San-Pedro and it don't matter. :crazy2: :laugh: :crazy2:
I also got some seeds


_____________________________________________________________________

Shit I think I got some Rot


Well thats all then...


Edited by UnderNose (05/30/06 01:36 AM)


Extras: Filter Print Post Top
OfflineHerbus
...

Registered: 10/19/04
Posts: 1,477
Loc: Reading the map...
Last seen: 10 years, 23 days
Re: Just wanted to share my legal peyote with you [Re: UnderNose]
    #5680148 - 05/27/06 11:09 AM (17 years, 8 months ago)

Sexy, sexy indeed.


--------------------
...


Extras: Filter Print Post Top
InvisibleUnderNose
all out of bubble gum
 User Gallery

Registered: 03/04/06
Posts: 1,612
Re: Just wanted to share my legal peyote with you [Re: Herbus]
    #5680157 - 05/27/06 11:13 AM (17 years, 8 months ago)

thanks


--------------------
LAGM 2.022

:dna::dna:


Extras: Filter Print Post Top
Offlinewhatever123
Whatever I did, I'm sorry
Male User Gallery

Registered: 04/07/05
Posts: 2,613
Loc: San Diego, CA
Last seen: 5 years, 6 months
Re: Just wanted to share my legal peyote with you [Re: UnderNose]
    #5680305 - 05/27/06 12:22 PM (17 years, 8 months ago)

Why legal?

And yes, I did jerk off to the peyotes.


--------------------
Koala Koolio said:
there should be a 3 month waiting period between registration and posting. :wink:


Extras: Filter Print Post Top
OfflineLegoulash
Stranger
 User Gallery
Registered: 09/07/02
Posts: 4,347
Last seen: 12 years, 7 months
Re: Just wanted to share my legal peyote with you [Re: whatever123]
    #5680314 - 05/27/06 12:27 PM (17 years, 8 months ago)

your catus mix looks like it has too much organic matter in it.. When i make a mix I like to put a layer of rocks to let the lopho sit on, so it dont get "wet feet"

This mix looks good to me.

Taken from: http://forums.mycotopia.net/showthread.php?p=236157#post236157

"Basically what i do is:

1 part bagged top soil

1 part bagged manure and compost

1-1.5 parts of 1/4' crushed limestone (a bitch to find, i recommend going to mulch suppliers/ landscape suppliers etc..this is the finest grade of limestone, it will fit through 1/4' inch screen..comes in sand to pieces of stone form)---this stuff is nice because the 1/4' size and provides good rock chips for drainage and long term minerals

i also add about .5-1 part of powdered(dolomite) lime

and a lil' bit of pelletized lime...........

i also add some bone meal to promtoe fruiting/flowering/root development and long term nutrition

and i toss in some perlite for a little extra aeration/drainage.........

i also recommend some charcoal for the pot bottoms

This mix is good because peyote's natural habitat is limestone in nature......(limestone is high in calcium and calcium is good for peyote.......)

It is recommended to shoot for 1/3 organic material and 2/3 drainage or so but i recommend that you experiment.

as you can see mine is nearly 1/2 and 1/2, really for me every mix is a little different, but they are all limestone in nature just a bit off as sometimes i add more limestone or more bone meal etc........

Procedure:
What i did was let the compost/manure, and soil, sit in open rubbermaids for a day or 2..........the i mixed the mix up in a trash bag/or bow/or tub .........then i put it in the over for 1 hr at about 200F-250f to sterilize.........

I also baked the clay pots

i also plan to use charcoal in the bottom of the clay pots............so it was cooked too..........

another reason we want a mix like this is because peyote takes a long time to grow so we want mediums that can support their long term needs.........with limestone chips, etc we should have good long term drainage and minerals...(if we used a soil /perlite/ cacti- compost mix or something, i tend to think that we will need to change the pot sometime during their life, and etc....which we dont really want to do. So thats why i use this good long term mix)

.....this will also reduce the risk of molds and algaes that could pose problems for our little friends......"


Extras: Filter Print Post Top
OfflineLegoulash
Stranger
 User Gallery
Registered: 09/07/02
Posts: 4,347
Last seen: 12 years, 7 months
Re: Just wanted to share my legal peyote with you [Re: Legoulash]
    #5680317 - 05/27/06 12:29 PM (17 years, 8 months ago)

>Why legal?

I think its like canada, its legal to grow but illegal to dry or prepare in anyway.


Extras: Filter Print Post Top
Offlinewhatever123
Whatever I did, I'm sorry
Male User Gallery

Registered: 04/07/05
Posts: 2,613
Loc: San Diego, CA
Last seen: 5 years, 6 months
Re: Just wanted to share my legal peyote with you [Re: Legoulash]
    #5680322 - 05/27/06 12:30 PM (17 years, 8 months ago)

FUCK THIS COUNTRY!


--------------------
Koala Koolio said:
there should be a 3 month waiting period between registration and posting. :wink:


Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: Just wanted to share my legal peyote with you [Re: whatever123]
    #5680729 - 05/27/06 03:24 PM (17 years, 8 months ago)

There are only 2 countries I know of that peyote is illegal in: the USA, and Mexico.

There are only two countries that Peyote grows naturally (though, practically one these days): the USA, and Mexico.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Extras: Filter Print Post Top
Offlinefaslimy
Dead Man
 User Gallery
Registered: 04/04/04
Posts: 3,436
Last seen: 8 years, 1 month
Re: Just wanted to share my legal peyote with you [Re: Koala Koolio]
    #5681268 - 05/27/06 06:54 PM (17 years, 8 months ago)

it is illegal in NZ


Extras: Filter Print Post Top
InvisibleUnderNose
all out of bubble gum
 User Gallery

Registered: 03/04/06
Posts: 1,612
Re: Just wanted to share my legal peyote with you [Re: faslimy]
    #5681969 - 05/27/06 10:50 PM (17 years, 8 months ago)

Thanks for the heads up Rah I didn't like the look of it either
That pereskiopsis grafting was so cool man I gotta get some.
Australia Legal to grow as many as you want, but preparing them and eating them I don't think so


--------------------
LAGM 2.022

:dna::dna:


Edited by UnderNose (05/27/06 11:08 PM)


Extras: Filter Print Post Top
InvisibleDexter_Morgan
Towlie's Mentor
Male User Gallery

Folding@home Statistics
Registered: 02/09/05
Posts: 6,666
Loc: higher than you
Re: Just wanted to share my legal peyote with you [Re: UnderNose]
    #5682889 - 05/28/06 09:23 AM (17 years, 8 months ago)

Are Loph seeds legal in the US? How about having them mailed to you?


--------------------
Uncleluke, getting his assbeat, then he tries to delete it
http://www.shroomery.org/forums/showflat.php/Number/6355469#Post6355469
Tomato-Faced Banez
http://www.shroomery.org/forums/showflat.php/Number/5933438#Post5933438
Dexter's Thesaurus
beer = guinness
smoke = vaporize
pubers = reasons to be pro-choice


Extras: Filter Print Post Top
InvisiblePsychoslut
The Mother Fucking Bear-o-dactyl
 User Gallery
Registered: 12/10/02
Posts: 20,917
Loc: all up in ya
Re: Just wanted to share my legal peyote with you [Re: Dexter_Morgan]
    #5683027 - 05/28/06 10:22 AM (17 years, 8 months ago)

they are illegal

there are over seas vendors who will send them to you.


--------------------



[quote]KristiMidocean said:
Good now thats clear.WHO FUCKING CARES. If I am fat u all keep pointing it out like its suppose to be a secret.LIke u really have nothing better to do then make fat jokes. If o know its like I do I know yall can come up with NEW AND BETTER SHIT . This shit is old and boring . I left in the first place cause this shit got boring not because of the fat jokes . Fat jokes dont bother me but seriously its old[/quote]


Extras: Filter Print Post Top
OfflinePsilocybeingzz
Male User Gallery

Registered: 12/15/02
Posts: 14,463
Loc: International waters
Last seen: 11 years, 2 months
Re: Just wanted to share my legal peyote with you [Re: UnderNose]
    #5684357 - 05/28/06 07:20 PM (17 years, 8 months ago)

How much did thos cost you I live in canada, peyote is highly LEGAL! :smile: here as well.

I picked up a fat button for 35$ the other day.


--------------------


Extras: Filter Print Post Top
InvisibleUnderNose
all out of bubble gum
 User Gallery

Registered: 03/04/06
Posts: 1,612
Re: Just wanted to share my legal peyote with you [Re: Psilocybeingzz]
    #5685119 - 05/28/06 11:28 PM (17 years, 8 months ago)

They were like Au $4 each but only because this guy named rudolf is cool :cool:


--------------------
LAGM 2.022

:dna::dna:


Extras: Filter Print Post Top
Offlinebeyondsisxth
Title?
Male User Gallery

Registered: 04/08/05
Posts: 232
Last seen: 12 years, 6 months
Re: Just wanted to share my legal peyote with you [Re: UnderNose]
    #5685148 - 05/28/06 11:39 PM (17 years, 8 months ago)

I'm jealous. I just watched Young Guns the other night too. "Did you know we're in the Spirit World?"


--------------------
The sun was pulling cheap shots doing commercial body tricks, Behind the back, Under the leg, I think he even did a headspin, On a crossfader that sounded whack, But looked excellent, All of the sudden it gets dim, The crater face steps in, Puts mexican drumbreaks on the Technics, He's like "Let's begin", He conducted an orchestra so dope the sun started sweatin' him, I guess he'd expected to win on pure artistic merit, Composing complex plays with nothin but soundbytes, Burned out the lights, Made MCs too self conscious quit the master mics, For a thousand nights, It continued without a single slip up, Except once the record skipped, But it kinda sounded cool.


Extras: Filter Print Post Top
Offlinengnyus
the madherbalist
Male User Gallery

Folding@home Statistics
Registered: 03/27/06
Posts: 519
Last seen: 14 years, 10 months
Re: Just wanted to share my legal peyote with you [Re: beyondsisxth]
    #5687823 - 05/29/06 06:50 PM (17 years, 8 months ago)

Oh, yeah, heres to you Australia, neenerneenerbooboo,lol
really though, they sure are beautiful little guys.


--------------------

You reap what you sow


Edited by ngnyus (05/29/06 06:53 PM)


Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: Just wanted to share my legal peyote with you [Re: ngnyus]
    #5688033 - 05/29/06 07:29 PM (17 years, 8 months ago)

I love my sally plants and all.

But I'd happily trade them away (to a loving family) for the right to grow l. williamsii legally and openly.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Extras: Filter Print Post Top
Offlinengnyus
the madherbalist
Male User Gallery

Folding@home Statistics
Registered: 03/27/06
Posts: 519
Last seen: 14 years, 10 months
Re: Just wanted to share my legal peyote with you [Re: Koala Koolio]
    #5688355 - 05/29/06 08:37 PM (17 years, 8 months ago)

No joke!!!!!


--------------------

You reap what you sow


Extras: Filter Print Post Top
InvisibleUnderNose
all out of bubble gum
 User Gallery

Registered: 03/04/06
Posts: 1,612
Re: Just wanted to share my legal peyote with you [Re: ngnyus]
    #5689119 - 05/29/06 11:58 PM (17 years, 8 months ago)

Quote:

I love my sally plants and all.

But I'd happily trade them away (to a loving family) for the right to grow l. williamsii legally and openly.





That's funny I think salvia was made illegal here in aus in 2000-2002,
Can't get seeds that 10X salvia stuff nothing. But peyote still legal, don't ask me why
If there is a Aussie somewhere out there with lady salvia seeds or cuttings please PM me I beg you.


--------------------
LAGM 2.022

:dna::dna:


Extras: Filter Print Post Top
Offlinewhatever123
Whatever I did, I'm sorry
Male User Gallery

Registered: 04/07/05
Posts: 2,613
Loc: San Diego, CA
Last seen: 5 years, 6 months
Re: Just wanted to share my legal peyote with you [Re: UnderNose]
    #5689146 - 05/30/06 12:06 AM (17 years, 8 months ago)

Good luck getting seeds, amigo.


--------------------
Koala Koolio said:
there should be a 3 month waiting period between registration and posting. :wink:


Extras: Filter Print Post Top
Jump to top Pages: 1 | 2 | Next >  [ show all ]

Shop: Left Coast Kratom Buy Kratom Capsules   Unfolding Nature Unfolding Nature: Being in the Implicate Order   PhytoExtractum Kratom Powder for Sale   North Spore Bulk Substrate   Original Sensible Seeds Autoflowering Cannabis Seeds   Mushroom-Hut Substrate Mix


Similar ThreadsPosterViewsRepliesLast post
* Peyote Legal?
( 1 2 all )
Psychedelics 4,608 23 11/19/03 11:05 PM
by iamhimheisme
* legalization for mj may never happen a0007jason 2,115 13 10/12/01 06:09 AM
by Crobih
* Peyote the legal way :)
( 1 2 all )
DailyPot 5,252 32 08/13/03 04:00 PM
by Aneglakya
* Peyote and Peruvian Torch seedlings (Pictures) SalviaEngland 3,637 14 05/14/05 05:38 PM
by Fluxburn
* Peyote Kid 1,981 4 01/29/02 07:25 AM
by AzulAgave
* Peyote without mescaline ? Possible ? tomldp 1,650 2 05/29/02 05:14 AM
by tomldp
* PEYOTE 173% legal in CANADA Psilocybeingzz 1,495 12 07/08/03 09:47 PM
by Psilocybeingzz
* Trip: Peyote + san pedro + salvia shaganoz 1,311 5 02/17/03 01:27 AM
by Bilge

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: Mostly_Harmless, A.k.a
3,639 topic views. 1 members, 5 guests and 7 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2024 Mind Media. Some rights reserved.

Generated in 0.054 seconds spending 0.033 seconds on 16 queries.