|
Psychoslut
The Mother Fucking Bear-o-dactyl

Registered: 12/10/02
Posts: 20,917
Loc: all up in ya
|
sending disks in the mail
#5677298 - 05/26/06 02:13 PM (17 years, 11 months ago) |
|
|
I heard sometimes disks like Cd's and floppy's are destroyed by x-rays in the mailing process. Is that true at all? How is it prevented?
--------------------
[quote]KristiMidocean said: Good now thats clear.WHO FUCKING CARES. If I am fat u all keep pointing it out like its suppose to be a secret.LIke u really have nothing better to do then make fat jokes. If o know its like I do I know yall can come up with NEW AND BETTER SHIT . This shit is old and boring . I left in the first place cause this shit got boring not because of the fat jokes . Fat jokes dont bother me but seriously its old[/quote]
|
rod
Ψ


Registered: 06/29/05
Posts: 3,727
|
Re: sending disks in the mail [Re: Psychoslut]
#5677674 - 05/26/06 04:48 PM (17 years, 11 months ago) |
|
|
I dont know about ever happening, but it hasent happened yet for me. I worry more about actual breakage.
|
Microcosmatrix
Spiral staircasetechnician


Registered: 10/20/05
Posts: 11,293
Loc: Ythan's house
Last seen: 17 years, 5 months
|
Re: sending disks in the mail [Re: Psychoslut]
#5677682 - 05/26/06 04:51 PM (17 years, 11 months ago) |
|
|
xrays aren't going to alter a piece of foil, they wouldn't use anywhere near the intensity to melt shit. etc.
Wrap the cds in your hat!
|
Koala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
|
|
Floppies are fragile little fucks, and easily demagnitized. Still, they should make a trip through the mail fine.
CD's are perfectly fine. If they weren't, AOL wouldn't get the joy they must experience from sending me a shitload of stuff I don't want.
-------------------- You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!
|
johnjohnandjamal
Stranger

Registered: 04/20/05
Posts: 510
Last seen: 7 years, 3 months
|
Re: sending disks in the mail [Re: Koala Koolio]
#5679354 - 05/27/06 01:44 AM (17 years, 11 months ago) |
|
|
CD's are definitely OK. I've sent them a number of times (original and burned) and they always arrived in good shape.
|
RemainRandom50
Do You Need ToKnow Me?
Registered: 01/15/06
Posts: 1,695
Last seen: 15 years, 1 month
|
|
lol this is the first time ive heard of this.
-------------------- At times I get consumed by my everyday life and will leave the Shroomery. Yet, every time drugs come falling into my life for fun.....I always think about the Shroomery and then I'm back!
|
wilshire
free radical


Registered: 05/11/05
Posts: 2,421
Loc: SE PA
Last seen: 14 years, 3 months
|
Re: sending disks in the mail [Re: Psychoslut]
#5680126 - 05/27/06 11:02 AM (17 years, 11 months ago) |
|
|
1. very little of US mail is x-rayed. 2. neither floppy nor compact disks are damaged by that type of x-ray screening.
|
RandalFlagg
Stranger
Registered: 06/15/02
Posts: 15,608
|
Re: sending disks in the mail [Re: Psychoslut]
#5680143 - 05/27/06 11:08 AM (17 years, 11 months ago) |
|
|
Quote:
Psychoslut said: I heard sometimes disks like Cd's and floppy's are destroyed by x-rays in the mailing process. Is that true at all? How is it prevented?
If this were true then how would AOL have sent all of those disks in the mail over the years?
|
Microcosmatrix
Spiral staircasetechnician


Registered: 10/20/05
Posts: 11,293
Loc: Ythan's house
Last seen: 17 years, 5 months
|
Re: sending disks in the mail [Re: RandalFlagg]
#5680153 - 05/27/06 11:11 AM (17 years, 11 months ago) |
|
|
The government turns off the x-rays for AOL
|
Koala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
|
|
They'd be in big trouble if they didn't. AOL owns all.
-------------------- You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!
|
Microcosmatrix
Spiral staircasetechnician


Registered: 10/20/05
Posts: 11,293
Loc: Ythan's house
Last seen: 17 years, 5 months
|
Re: sending disks in the mail [Re: Koala Koolio]
#5681114 - 05/27/06 05:38 PM (17 years, 11 months ago) |
|
|
They're America!! Where's you're patriotism?
|
Koala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
|
|
I show my patriotism every time I microwave an AOL disc. :P
I don't actually do that on a regular basis... as awesome as it is, I can't afford a new microwave (or cancer treatment, whichever comes first).
-------------------- You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!
|
Microcosmatrix
Spiral staircasetechnician


Registered: 10/20/05
Posts: 11,293
Loc: Ythan's house
Last seen: 17 years, 5 months
|
Re: sending disks in the mail [Re: Koala Koolio]
#5681209 - 05/27/06 06:22 PM (17 years, 11 months ago) |
|
|
Cool stuff. I heard hard drives work great in microwaves too. haha
|
i8an8th
Mrs.


Registered: 06/16/05
Posts: 1,714
|
|
Since when do they have the time or money to x-ray any of the mail going through the country or through customs in that matter?
--------------------
|
Microcosmatrix
Spiral staircasetechnician


Registered: 10/20/05
Posts: 11,293
Loc: Ythan's house
Last seen: 17 years, 5 months
|
Re: sending disks in the mail [Re: i8an8th]
#5683141 - 05/28/06 11:24 AM (17 years, 11 months ago) |
|
|
Who knows what they're doing behind closed doors.
|
doodoomaster
Life's still good


Registered: 06/02/06
Posts: 393
Loc: The united states of Gene...
Last seen: 14 years, 5 months
|
|
Quote:
Microcosmatrix said: Who knows what they're doing behind closed doors.
Everything that they lie to us about or just dont tell us.
-------------------- For all you passive aggressive types. Fuck you, kind of.
|
|