Home | Community | Message Board

MRCA Tyroler Gluckspilze
This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Kraken Kratom Shop: Red Vein Kratom

Jump to first unread post Pages: 1
InvisiblePsychoslut
The Mother Fucking Bear-o-dactyl
 User Gallery
Registered: 12/10/02
Posts: 20,917
Loc: all up in ya
sending disks in the mail
    #5677298 - 05/26/06 02:13 PM (17 years, 8 months ago)

I heard sometimes disks like Cd's and floppy's are destroyed by x-rays in the mailing process. Is that true at all? How is it prevented? :confused:


--------------------



[quote]KristiMidocean said:
Good now thats clear.WHO FUCKING CARES. If I am fat u all keep pointing it out like its suppose to be a secret.LIke u really have nothing better to do then make fat jokes. If o know its like I do I know yall can come up with NEW AND BETTER SHIT . This shit is old and boring . I left in the first place cause this shit got boring not because of the fat jokes . Fat jokes dont bother me but seriously its old[/quote]


Extras: Filter Print Post Top
Invisiblerod
Ψ
 User Gallery

Registered: 06/29/05
Posts: 3,727
Re: sending disks in the mail [Re: Psychoslut]
    #5677674 - 05/26/06 04:48 PM (17 years, 8 months ago)

I dont know about ever happening, but it hasent happened yet for me.
I worry more about actual breakage.


Extras: Filter Print Post Top
OfflineMicrocosmatrix
Spiral staircasetechnician
Male

Registered: 10/20/05
Posts: 11,293
Loc: Ythan's house
Last seen: 17 years, 1 month
Re: sending disks in the mail [Re: Psychoslut]
    #5677682 - 05/26/06 04:51 PM (17 years, 8 months ago)

xrays aren't going to alter a piece of foil, they wouldn't use anywhere near the intensity to melt shit. etc.

Wrap the cds in your hat!


--------------------
:orly:



Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: sending disks in the mail [Re: Microcosmatrix]
    #5678524 - 05/26/06 09:27 PM (17 years, 8 months ago)

Floppies are fragile little fucks, and easily demagnitized. Still, they should make a trip through the mail fine.

CD's are perfectly fine. If they weren't, AOL wouldn't get the joy they must experience from sending me a shitload of stuff I don't want.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Extras: Filter Print Post Top
Offlinejohnjohnandjamal
Stranger

Registered: 04/20/05
Posts: 510
Last seen: 6 years, 11 months
Re: sending disks in the mail [Re: Koala Koolio]
    #5679354 - 05/27/06 01:44 AM (17 years, 8 months ago)

CD's are definitely OK. I've sent them a number of times (original and burned) and they always arrived in good shape.


Extras: Filter Print Post Top
OfflineRemainRandom50
Do You Need ToKnow Me?
Registered: 01/15/06
Posts: 1,695
Last seen: 14 years, 9 months
Re: sending disks in the mail [Re: johnjohnandjamal]
    #5679870 - 05/27/06 09:00 AM (17 years, 8 months ago)

lol this is the first time ive heard of this.


--------------------
At times I get consumed by my everyday life and will leave the Shroomery. Yet, every time drugs come falling into my life for fun.....I always think about the Shroomery and then I'm back!


Extras: Filter Print Post Top
Offlinewilshire
free radical
Male User Gallery

Registered: 05/11/05
Posts: 2,421
Loc: SE PA
Last seen: 14 years, 3 days
Re: sending disks in the mail [Re: Psychoslut]
    #5680126 - 05/27/06 11:02 AM (17 years, 8 months ago)

1. very little of US mail is x-rayed.
2. neither floppy nor compact disks are damaged by that type of x-ray screening.

:thumbup:


--------------------



Extras: Filter Print Post Top
InvisibleRandalFlagg
Stranger
Registered: 06/15/02
Posts: 15,608
Re: sending disks in the mail [Re: Psychoslut]
    #5680143 - 05/27/06 11:08 AM (17 years, 8 months ago)

Quote:

Psychoslut said:
I heard sometimes disks like Cd's and floppy's are destroyed by x-rays in the mailing process. Is that true at all? How is it prevented? :confused:




If this were true then how would AOL have sent all of those disks in the mail over the years?


Extras: Filter Print Post Top
OfflineMicrocosmatrix
Spiral staircasetechnician
Male

Registered: 10/20/05
Posts: 11,293
Loc: Ythan's house
Last seen: 17 years, 1 month
Re: sending disks in the mail [Re: RandalFlagg]
    #5680153 - 05/27/06 11:11 AM (17 years, 8 months ago)

The government turns off the x-rays for AOL :lol:


--------------------
:orly:



Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: sending disks in the mail [Re: Microcosmatrix]
    #5680759 - 05/27/06 03:28 PM (17 years, 8 months ago)

They'd be in big trouble if they didn't. AOL owns all.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Extras: Filter Print Post Top
OfflineMicrocosmatrix
Spiral staircasetechnician
Male

Registered: 10/20/05
Posts: 11,293
Loc: Ythan's house
Last seen: 17 years, 1 month
Re: sending disks in the mail [Re: Koala Koolio]
    #5681114 - 05/27/06 05:38 PM (17 years, 8 months ago)

They're America!! Where's you're patriotism? :lol:


--------------------
:orly:



Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: sending disks in the mail [Re: Microcosmatrix]
    #5681154 - 05/27/06 05:57 PM (17 years, 8 months ago)

I show my patriotism every time I microwave an AOL disc. :P

I don't actually do that on a regular basis... as awesome as it is, I can't afford a new microwave (or cancer treatment, whichever comes first).


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Extras: Filter Print Post Top
OfflineMicrocosmatrix
Spiral staircasetechnician
Male

Registered: 10/20/05
Posts: 11,293
Loc: Ythan's house
Last seen: 17 years, 1 month
Re: sending disks in the mail [Re: Koala Koolio]
    #5681209 - 05/27/06 06:22 PM (17 years, 8 months ago)

Cool stuff. I heard hard drives work great in microwaves too. haha


--------------------
:orly:



Extras: Filter Print Post Top
Invisiblei8an8th
Mrs.
Male User Gallery

Registered: 06/16/05
Posts: 1,714
Re: sending disks in the mail [Re: Microcosmatrix]
    #5681954 - 05/27/06 10:46 PM (17 years, 8 months ago)

Since when do they have the time or money to x-ray any of the mail going through the country or through customs in that matter?


--------------------
:sporedrop:


Extras: Filter Print Post Top
OfflineMicrocosmatrix
Spiral staircasetechnician
Male

Registered: 10/20/05
Posts: 11,293
Loc: Ythan's house
Last seen: 17 years, 1 month
Re: sending disks in the mail [Re: i8an8th]
    #5683141 - 05/28/06 11:24 AM (17 years, 8 months ago)

Who knows what they're doing behind closed doors.


--------------------
:orly:



Extras: Filter Print Post Top
Offlinedoodoomaster
Life's still good
Male User Gallery

Registered: 06/02/06
Posts: 393
Loc: The united states of Gene...
Last seen: 14 years, 1 month
Re: sending disks in the mail [Re: Microcosmatrix]
    #5710299 - 06/04/06 04:37 AM (17 years, 7 months ago)

Quote:

Microcosmatrix said:
Who knows what they're doing behind closed doors.




Everything that they lie to us about or just dont tell us.


--------------------
For all you passive aggressive types.  Fuck you, kind of.


Extras: Filter Print Post Top
Jump to top Pages: 1

Kraken Kratom Shop: Red Vein Kratom


Similar ThreadsPosterViewsRepliesLast post
* A question about mail to different location theocean06 435 0 12/20/04 03:34 PM
by theocean06
* Mail forwarding services - U.S. address or overseas? Renegade8 759 2 04/21/05 06:11 AM
by Deadmaker
* A site to send anon mail from Catman 224 0 10/23/05 09:54 PM
by Catman
* The BASICS of Securing your computer and E-mail. Cyber 2,674 12 06/09/09 03:34 PM
by Alan Rockefeller
* lol funny lil e-mail i got today Protester 1,805 16 04/21/04 05:45 PM
by Zaphoid
* What you should know about foreign mail postmaster 2,813 5 03/04/05 10:42 PM
by Fluxburn
* mailing mushrooms safe?
( 1 2 3 all )
jostml 10,116 54 03/17/15 10:24 PM
by Alan Rockefeller
* can i get in trouble for sending spores to cali THEDANGLER 1,758 18 05/03/05 07:11 AM
by JoeDeertay

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: Enlil, Alan Rockefeller
703 topic views. 0 members, 0 guests and 0 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2024 Mind Media. Some rights reserved.

Generated in 0.026 seconds spending 0.008 seconds on 15 queries.