Home | Community | Message Board

MushroomMan Mycology
This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Shop: Original Sensible Seeds Autoflowering Cannabis Seeds   Left Coast Kratom Kratom Powder For Sale   Kraken Kratom Red Vein Kratom   Mushroom-Hut Mono Tub Substrate

Jump to first unread post Pages: 1 | 2  [ show all ]
OfflineSirFrancisBacon
Frog
 User Gallery

Registered: 03/14/05
Posts: 283
Loc: low earth orbit
Last seen: 1 year, 7 months
Evidence Blimp
    #5595023 - 05/05/06 05:36 PM (17 years, 8 months ago)

I've often wondered what would happen if you sent your incriminating evidence out in a helium filled blimp during a raid or what have you. What are your thoughts?


Extras: Filter Print Post Top
Offlinewiggles
Miffed a Milf
Male User Gallery
Folding@home Statistics
Registered: 11/09/05
Posts: 2,615
Last seen: 10 years, 5 months
Re: Evidence Blimp [Re: SirFrancisBacon]
    #5595336 - 05/05/06 07:06 PM (17 years, 8 months ago)

Cops have guns. Balloons and blimps can go pop :undecided:


--------------------


You can turn your back on a person, but never turn your back on a drug, especially when its waving a razor sharp hunting knife in your eye.
Hunter S. Thompson


Extras: Filter Print Post Top
OfflineSirFrancisBacon
Frog
 User Gallery

Registered: 03/14/05
Posts: 283
Loc: low earth orbit
Last seen: 1 year, 7 months
Re: Evidence Blimp [Re: wiggles]
    #5595369 - 05/05/06 07:14 PM (17 years, 8 months ago)

@wiggles
true, very true. But i wonder if cops would open fire in a city. Even if they hit the blimp, the stray bullet would keep on flying!


Extras: Filter Print Post Top
InvisibleOJK
Stranger
 User Gallery
Registered: 06/08/03
Posts: 10,629
Re: Evidence Blimp [Re: SirFrancisBacon]
    #5595514 - 05/05/06 07:54 PM (17 years, 8 months ago)

to be honest, I think that that is an innovative and potentially workable idea

the key element would be surprise, I imagine. If it became a common method, workarounds would be developed, but the concept is sound

ideally, the blimp would not contain any identifiable markings of any kind, including fingerprints

assuming you had enough time to gather evidence (ideally wearing gloves), put it into a container and successfully launch the blimp, I think that, compared to other methods of evidence disposal, it would be fairly succesful


Extras: Filter Print Post Top
InvisibleLana
Head Banana
Female

Registered: 10/27/99
Posts: 3,109
Loc: www.MycoSupply.com
Re: Evidence Blimp [Re: SirFrancisBacon]
    #5597235 - 05/06/06 09:05 AM (17 years, 8 months ago)

Interesting idea :smile:

But sooner or later the blimp would come down.

A commercial food disposal unit would work better.  Just dump everything in, turn a switch and within seconds your evidence is chopped up and riding down your drain.

Lana


--------------------
Myco Supply - Distributors of Mycological Products
http://www.MycoSupply.com

The Premiere Source for Mushroom Growing Supplies.
Visit us online or call us toll free


Extras: Filter Print Post Top
OfflineDobie
Dopeless Hopefiend
Male User Gallery
Registered: 08/15/02
Posts: 52,841
Loc: ON DA BLOCK Flag
Last seen: 5 months, 30 days
Re: Evidence Blimp [Re: OJK]
    #5602240 - 05/07/06 07:18 PM (17 years, 8 months ago)

you know what would be sweet put some gps on the ballon so you could get it back later :laugh:


--------------------
This place is gayer than when the balls touch


Extras: Filter Print Post Top
InvisibleZippoZM
Knomadic
 User Gallery

Registered: 06/17/03
Posts: 13,227
Loc: Pongyang, North Korea
Re: Evidence Blimp [Re: Dobie]
    #5602473 - 05/07/06 08:24 PM (17 years, 8 months ago)

yeah as long as it actually works... the people that tried this had their rocket not work

---------------------------------------s that a rocket in your trunk, or are you just happy to see me?
Submitted by steve silverman on July 7, 2005 - 6:48pm.

Two men in Missouri were arrested following an inspired, though unsuccessful, attempt at concealing evidence by launching it out of their car in a rocket. Apparently nervous about driving around with $145,000 worth of methamphetamine, the suspects rigged their trunk with ropes and pulleys to position the drug-filled rocket, which would ignite with a push of the dashboard cigarette lighter. It didn't work.

A few reasons why this might be a bad idea come to mind:

1. Knowing your rights is always easier than rigging your car so that when you push the cigarette lighter the trunk pops open and launches your stash far away with rockets.

2. Police tend to be edgy during traffic stops. If they pull you over and your trunk pops open and a rocket shoots out in their general direction, they'll totally freak out and shoot you repeatedly.

3. If the rocket actually launches successfully and you're not shot to death, they'll look for the rocket. And if they find it -- which they will -- you can't say "Well that could be anybody's rocket full of meth you found in a field 300 yards away with my fingerprints on it."

If and when Congress authorizes the death penalty for meth, we may reconsider our stance on the "stash rocket" approach to police encounters, but for now we'll stick with the conventional tactics offered in BUSTED.


--------------------
PEACE

:mushroom2:zippoz:mushroom2:



"in times of widespread chaos and confusion, it has been the duty of more advanced human beings - artists, scientists, clowns, and philosophers - to create order. In such times as ours however, when there is too much order, too much m management, too much programming and control, it becomes the duty of superior men and women and women to fling their favorite monkey wrenches into the machinery. To relieve the repression of the human spirit, they must sow doubt and disruption"

"People do it every day, they talk to themselves ... they see themselves as they'd like to be, they don't have the courage you have, to just run with it."


Extras: Filter Print Post Top
Offlinebhamlaxy
Shroomerite
Female

Registered: 01/23/05
Posts: 714
Loc: Nevada
Last seen: 3 years, 5 months
Re: Evidence Blimp [Re: ZippoZ]
    #5602865 - 05/07/06 09:48 PM (17 years, 8 months ago)

ive thought about a rocket type thing for a car. Maybe a little chamber that, with the push of a button, would launch a bag of weed, a pipe, or a few pills skidding on the ground in front of the car. If done right, the police pulling you over wouldnt be able to see it, and you may be able to retrieve it.


Extras: Filter Print Post Top
OfflineKaptKid
Spaced Pirate
Male User Gallery

Registered: 12/11/03
Posts: 6,252
Loc: Bright Side of the Sun
Last seen: 3 years, 11 months
Re: Evidence Blimp [Re: Lana]
    #5603466 - 05/08/06 12:19 AM (17 years, 8 months ago)

Quote:

Lana said:
A commercial food disposal unit would work better.  Just dump everything in, turn a switch and within seconds your evidence is chopped up and riding down your drain.

Lana




Could even have a remote.


:sun:


--------------------
Child of the 60's, Tripping ever since.


:sun:


Extras: Filter Print Post Top
OfflineSirFrancisBacon
Frog
 User Gallery

Registered: 03/14/05
Posts: 283
Loc: low earth orbit
Last seen: 1 year, 7 months
Re: Evidence Blimp [Re: KaptKid]
    #5604930 - 05/08/06 12:45 PM (17 years, 8 months ago)

The rocket idea has some obvious holes in it. Plus, relatively simple calculations can determine where the rockey may land. The blimp is a bit more complex to calculate.


Extras: Filter Print Post Top
Offlinedebianlinux
Myconerd - DBK
Male User Gallery

Folding@home Statistics
Registered: 12/09/02
Posts: 8,334
Loc: Over There
Last seen: 7 months, 1 day
Re: Evidence Blimp [Re: ZippoZ]
    #5669980 - 05/24/06 07:32 PM (17 years, 8 months ago)

:rofl:      :rofl2:      :lol:      :lolz0rz:      :yesnod:


Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: Evidence Blimp [Re: debianlinux]
    #5671266 - 05/25/06 01:39 AM (17 years, 8 months ago)

Reminds me of a story about people smuggling pot via the lakes from Canada.

They used speedboats I believe, and tied the haul behind them, and it stayed submerged underwater. If the cops came around, it would be tied off, and only float to the surface hours later to be found via GPS.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Extras: Filter Print Post Top
Offlinecyberthreat
Stranger

Registered: 03/06/05
Posts: 676
Last seen: 7 years, 7 months
Re: Evidence Blimp [Re: Koala Koolio]
    #5674380 - 05/25/06 07:43 PM (17 years, 8 months ago)

they would just shoot it out of the sky with a bean bad round or a a 40 mm wooden baton whit they use to take out street lights in raids


Extras: Filter Print Post Top
InvisibleBrainiac
Rogue Scientist
Male

Registered: 04/29/06
Posts: 13,259
Loc: 與您的女朋 Flag
Re: Evidence Blimp [Re: cyberthreat]
    #5674643 - 05/25/06 09:00 PM (17 years, 8 months ago)

:crazy2: :imslow: :rofl2: :lolz0rz: :cuckoo: :shake: :cuckoo: :cuckoo: :cuckoo: :cuckoo: :cuckoo: :cuckoo: :cuckoo: :cuckoo: :cuckoo: :cuckoo: :cuckoo: :cuckoo: :cuckoo: :cuckoo: :cuckoo: :cuckoo: :cuckoo: :cuckoo: :cuckoo: :cuckoo: :cuckoo: :cuckoo: :cuckoo: :cuckoo: :cuckoo: :cuckoo: :cuckoo: :cuckoo: :cuckoo: :cuckoo: :cuckoo: :cuckoo: :cuckoo: :cuckoo:


--------------------
:Awesketch:

:cool: Fair is Fair :devil:


Extras: Filter Print Post Top
InvisibleFungusMan
I81U812
Male User Gallery

Folding@home Statistics
Registered: 08/06/05
Posts: 3,112
Loc: Everywhere
Re: Evidence Blimp [Re: Brainiac]
    #5675320 - 05/26/06 12:08 AM (17 years, 8 months ago)

Ive thought about rigging up my cubensis lab in a metal container full of heating elements. That way, if I hear my door get busted down, I could just flip a switch and bake the actives out of any fruits or subs I may have. Then I would just get a tempering with evidence charge, lol.


Extras: Filter Print Post Top
InvisibleZippoZM
Knomadic
 User Gallery

Registered: 06/17/03
Posts: 13,227
Loc: Pongyang, North Korea
Re: Evidence Blimp [Re: FungusMan]
    #5677256 - 05/26/06 02:03 PM (17 years, 8 months ago)

yeah i have thought of wiring stuff with dynamite... id just be worried that when i blew it up someone like me or a cop would get hurt... and thats not a good thing.


i think that once in a drunken rant i offered to strap the shroomery's server with dynamite :smile: for safetys sake!


--------------------
PEACE

:mushroom2:zippoz:mushroom2:



"in times of widespread chaos and confusion, it has been the duty of more advanced human beings - artists, scientists, clowns, and philosophers - to create order. In such times as ours however, when there is too much order, too much m management, too much programming and control, it becomes the duty of superior men and women and women to fling their favorite monkey wrenches into the machinery. To relieve the repression of the human spirit, they must sow doubt and disruption"

"People do it every day, they talk to themselves ... they see themselves as they'd like to be, they don't have the courage you have, to just run with it."


Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: Evidence Blimp [Re: ZippoZ]
    #5678526 - 05/26/06 09:28 PM (17 years, 8 months ago)

You blow up a cop, you'd better have a backup cyanide plan.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Extras: Filter Print Post Top
Offlinemickywilliams2
journeyman
Registered: 05/27/03
Posts: 136
Last seen: 3 months, 3 days
Re: Evidence Blimp [Re: Koala Koolio]
    #5689536 - 05/30/06 02:04 AM (17 years, 8 months ago)

A homing pigeon could carry a small stash straight to a friends house or wherever you want.
This idea has been used in tourist parks. The birds carry film back to have it developed before the tourists can hike back down the mountain. By the time the tourists makes it back, the pictures are already developed and waiting for them, thanks to the homing pigeon.
The birds have cute little back packs.

I do like the blimp idea.


Extras: Filter Print Post Top
Offlinewhatever123
Whatever I did, I'm sorry
Male User Gallery

Registered: 04/07/05
Posts: 2,613
Loc: San Diego, CA
Last seen: 5 years, 6 months
Re: Evidence Blimp [Re: mickywilliams2]
    #5700894 - 06/01/06 06:55 PM (17 years, 7 months ago)

You would have to have a VERY stable head on your shoulders to be able to take care of the blimp during a raid. You would need to remember gloves, all your shit, setting it up and shit....all in who knows how long.


--------------------
Koala Koolio said:
there should be a 3 month waiting period between registration and posting. :wink:


Extras: Filter Print Post Top
InvisibleEgo Death
Justadropofwaterinanendlesssea
 User Gallery

Registered: 04/27/03
Posts: 10,447
Loc: The War Machine
Re: Evidence Blimp [Re: SirFrancisBacon]
    #5703230 - 06/02/06 08:19 AM (17 years, 7 months ago)

I had a similar idea -
a small incinerator!

You would have to have a button that would release all of your contraband into the inferno :evil:


Extras: Filter Print Post Top
OfflineMicrocosmatrix
Spiral staircasetechnician
Male

Registered: 10/20/05
Posts: 11,293
Loc: Ythan's house
Last seen: 17 years, 1 month
Re: Evidence Blimp [Re: bhamlaxy]
    #5704050 - 06/02/06 01:07 PM (17 years, 7 months ago)

Quote:

bhamlaxy said:
ive thought about a rocket type thing for a car. Maybe a little chamber that, with the push of a button, would launch a bag of weed, a pipe, or a few pills skidding on the ground in front of the car. If done right, the police pulling you over wouldnt be able to see it, and you may be able to retrieve it.




I like that one.


--------------------
:orly:



Extras: Filter Print Post Top
Offlinedoodoomaster
Life's still good
Male User Gallery

Registered: 06/02/06
Posts: 393
Loc: The united states of Gene...
Last seen: 14 years, 1 month
Re: Evidence Blimp [Re: Koala Koolio]
    #5704434 - 06/02/06 02:58 PM (17 years, 7 months ago)

Quote:

Koala Koolio said:
You blow up a cop, you'd better have a backup cyanide plan.





:rofl: :rofl: :rofl2: :rofl2:

Yes you must always have a backup plan.
That is one of the teachings of the art of DooDoo


--------------------
For all you passive aggressive types.  Fuck you, kind of.


Extras: Filter Print Post Top
Invisiblecricket
Lord Cricket
Male User Gallery

Registered: 08/29/03
Posts: 960
Loc: in my house, in front of ...
Re: Evidence Blimp [Re: doodoomaster]
    #5706899 - 06/03/06 09:02 AM (17 years, 7 months ago)

I don't know if anyone touched on this yet but the Japs used to send firebomb blims over the ocean in hopes that they would land here in the states.
If you have a blimp with enough lift to keep it out of reach of cops with rakes you may end up with a trafficing charge when it lands out of state, or worse over seas.
I doubt they would need fingerprints if they got photos of it leaving your house.


--------------------
I tried to leave my signature but it didn't work...
By the way... Does anybody know how to get sharpie markers off of a computer screen?


Extras: Filter Print Post Top
Offlinewilshire
free radical
Male User Gallery

Registered: 05/11/05
Posts: 2,421
Loc: SE PA
Last seen: 14 years, 3 days
Re: Evidence Blimp [Re: Microcosmatrix]
    #5707161 - 06/03/06 11:24 AM (17 years, 7 months ago)

ive thought about a rocket type thing for a car.

so did these guys:

http://www.showmenews.com/2005/Jun/20050628News007.asp


--------------------



Extras: Filter Print Post Top
InvisibleZippoZM
Knomadic
 User Gallery

Registered: 06/17/03
Posts: 13,227
Loc: Pongyang, North Korea
Re: Evidence Blimp [Re: cricket]
    #5709068 - 06/03/06 09:18 PM (17 years, 7 months ago)

Quote:

cricket said:
I don't know if anyone touched on this yet but the Japs used to send firebomb blims over the ocean in hopes that they would land here in the states.
If you have a blimp with enough lift to keep it out of reach of cops with rakes you may end up with a trafficing charge when it lands out of state, or worse over seas.
I doubt they would need fingerprints if they got photos of it leaving your house.




one thousand of the 5 thousand launched actually made it to the states and caused some big problems.


with that being said, i still say that massive amounts of dynamite or black powder would probably b e your best bet... mmmk?


--------------------
PEACE

:mushroom2:zippoz:mushroom2:



"in times of widespread chaos and confusion, it has been the duty of more advanced human beings - artists, scientists, clowns, and philosophers - to create order. In such times as ours however, when there is too much order, too much m management, too much programming and control, it becomes the duty of superior men and women and women to fling their favorite monkey wrenches into the machinery. To relieve the repression of the human spirit, they must sow doubt and disruption"

"People do it every day, they talk to themselves ... they see themselves as they'd like to be, they don't have the courage you have, to just run with it."


Extras: Filter Print Post Top
Offlinenugjug
Wanderer

Registered: 11/07/05
Posts: 703
Last seen: 5 years, 11 months
Re: Evidence Blimp [Re: Ego Death]
    #5731264 - 06/09/06 04:00 PM (17 years, 7 months ago)

Quote:

danoEoboy said:
I had a similar idea -
a small incinerator!

You would have to have a button that would release all of your contraband into the inferno :evil:




I like this idea.  I've always had the idea to have a room set up with an acid sprinkler system.  Hit the panic button, door slams shut, acid rains down and destroys everything.


Extras: Filter Print Post Top
Jump to top Pages: 1 | 2  [ show all ]

Shop: Original Sensible Seeds Autoflowering Cannabis Seeds   Left Coast Kratom Kratom Powder For Sale   Kraken Kratom Red Vein Kratom   Mushroom-Hut Mono Tub Substrate


Similar ThreadsPosterViewsRepliesLast post
* panic button system: A controlled burn of evidence
( 1 2 3 4 all )
ZippoZM 8,313 66 08/09/06 02:37 PM
by ZippoZ
* Police manufacture/ switch evidence that frames guy for murder, & cost Cty thousands, Def. released johnm214 1,049 7 04/11/08 09:17 AM
by johnm214
* destroying evidence
( 1 2 all )
fren0128 1,520 23 12/24/04 05:40 PM
by donkey_lipz
* . Anonymous 1,805 15 12/14/06 06:01 AM
by gregorio
* perlite+vermiculite= circumstantial evidence? Derami 823 7 06/04/07 09:07 PM
by AuroricDistortions
* it's the original evidence eliminator vanillasoulja 581 3 08/02/05 01:10 PM
by johnson657
* Is this web site Illegal?
( 1 2 all )
Brainiac 2,404 30 03/30/07 03:03 PM
by jewunit
* Commonly Misunderstood U.S. Legal Issues +The Mail and The Law
( 1 2 3 all )
johnm214 34,187 57 01/02/20 09:36 AM
by Ka Faraq Gatri

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: Enlil, Alan Rockefeller
1,828 topic views. 0 members, 1 guests and 0 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2024 Mind Media. Some rights reserved.

Generated in 0.031 seconds spending 0.009 seconds on 15 queries.