Home | Community | Message Board


This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Shop: Unfolding Nature Unfolding Nature: Being in the Implicate Order   North Spore North Spore Mushroom Grow Kits & Cultivation Supplies   Original Sensible Seeds Bulk Cannabis Seeds   PhytoExtractum Maeng Da Thai Kratom Leaf Powder

Jump to first unread post Pages: 1
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
OfflineJB201
Desert Dweller
Male User Gallery

Registered: 04/09/05
Posts: 323
Loc: Sonoran Desert
Last seen: 6 years, 11 months
Update on Loph. Graft
    #5420429 - 03/19/06 09:20 PM (17 years, 10 months ago)

It's been a few months since I updated, and I promised to keep updating you guys so here are the pics of the Loph. grafted to the areole.

This pic is right after I grafted it on August 29, 2005:



Here the graft is as of march 17, 2006:









It's not growing that fast but I'm happy with it non the less. Seems to grow 1-2 more areoles per week. Soon I'm going to try some pereskiopsis grafting.

Edited: This pic is right after I grafted it on August 29, 2205


--------------------


Edited by JB201 (03/20/06 11:41 AM)


Extras: Filter Print Post Top
Invisiblellamabox
Myco/Ethnoresearcher
Male User Gallery

Registered: 11/23/05
Posts: 564
Loc: Third moon of the Indole ...
Re: Update on Loph. Graft [Re: JB201]
    #5420514 - 03/19/06 09:40 PM (17 years, 10 months ago)

Looks good.


Question though. What gives it the special time travel ability?


--------------------

Free Ethnobotanical Seed Ring


Extras: Filter Print Post Top
Offlinefelixhigh
Scientist
Male User Gallery

Registered: 06/24/01
Posts: 7,557
Loc: Ly
Last seen: 1 month, 9 days
Re: Update on Loph. Graft [Re: JB201]
    #5420527 - 03/19/06 09:44 PM (17 years, 10 months ago)

very good!
but... wouldn't be interesting to cut the tip of the rootstock in order to redirect growth to the areoles?


FH


Extras: Filter Print Post Top
OfflineJB201
Desert Dweller
Male User Gallery

Registered: 04/09/05
Posts: 323
Loc: Sonoran Desert
Last seen: 6 years, 11 months
Re: Update on Loph. Graft [Re: felixhigh]
    #5420579 - 03/19/06 09:58 PM (17 years, 10 months ago)

I've already cut the tip and all the areoles. Although you cant see it in the pics I posted.


--------------------


Extras: Filter Print Post Top
OfflineJB201
Desert Dweller
Male User Gallery

Registered: 04/09/05
Posts: 323
Loc: Sonoran Desert
Last seen: 6 years, 11 months
Re: Update on Loph. Graft [Re: JB201]
    #5420663 - 03/19/06 10:28 PM (17 years, 10 months ago)

llama - time travel ability? I was just showing a pic of when it was first grafted and how it looks now, to give you an idea of how much it has grown.


--------------------


Extras: Filter Print Post Top
OfflineClammyJoe
Azurescen Head
Male

Folding@home Statistics
Registered: 11/03/05
Posts: 3,691
Loc: PNW
Last seen: 11 years, 1 month
Re: Update on Loph. Graft [Re: JB201]
    #5420991 - 03/20/06 12:31 AM (17 years, 10 months ago)

Look at the pictures dates :smile:


Extras: Filter Print Post Top
OfflineSchwip
Never sleeps.
 User Gallery

Registered: 06/27/05
Posts: 3,937
Last seen: 11 years, 2 months
Re: Update on Loph. Graft [Re: JB201]
    #5421866 - 03/20/06 10:09 AM (17 years, 10 months ago)

hehe i think llama kids about your typo :smile:

"This pic is right after I grafted it on August 29,2205"


looks good though! :smile:


--------------------
--------------------------------

" If the sky were to suddenly open up there would be no law. There would be no rule. There would only be you and your memories... the choices you've made, and the people you've touched. If this world were to end there would only be you and him and no-one else. "

..............

"MAN! You know there aint no such thing as left over crack!"



Extras: Filter Print Post Top
OfflineJB201
Desert Dweller
Male User Gallery

Registered: 04/09/05
Posts: 323
Loc: Sonoran Desert
Last seen: 6 years, 11 months
Re: Update on Loph. Graft [Re: Schwip]
    #5422153 - 03/20/06 11:37 AM (17 years, 10 months ago)

Oh, now I get it. Sorry guys/gals (I was in an altered state of mind when I made the post :wink:). I'll edit that. I noticed today that the Loph. has a new tiny little areole growing from the center. I'm hoping that the growth of the Loph. will speed up once I transplant the stock plant into a bigger pot and give it some ferts. I've just been giving it Ironite the past couple months.


--------------------


Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: Update on Loph. Graft [Re: JB201]
    #5422575 - 03/20/06 01:48 PM (17 years, 10 months ago)

I do suggest cutting the growing tip as well. Seems like it is going very well, though pretty slowly.

Good job. :smile:


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Extras: Filter Print Post Top
OfflineJB201
Desert Dweller
Male User Gallery

Registered: 04/09/05
Posts: 323
Loc: Sonoran Desert
Last seen: 6 years, 11 months
Re: Update on Loph. Graft [Re: Koala Koolio]
    #5423901 - 03/20/06 10:59 PM (17 years, 10 months ago)

Koala - I cut the growth tip off a few months ago, although you cant see it in the pictures. I also cut off all the areoles so that no off-shoots would develop and inhibit the growth of the scion. I've only been fertilizing with Ironite, so that probably has something to do with the slow growth. Once the weather warms up a bit more I'm going to transplant it to a larger container and give it a mild dose of cactus fertilizer. Hopefully that will speed up the growth a little bit more.


--------------------


Extras: Filter Print Post Top
Jump to top Pages: 1

Shop: Unfolding Nature Unfolding Nature: Being in the Implicate Order   North Spore North Spore Mushroom Grow Kits & Cultivation Supplies   Original Sensible Seeds Bulk Cannabis Seeds   PhytoExtractum Maeng Da Thai Kratom Leaf Powder


Similar ThreadsPosterViewsRepliesLast post
* New Loph Graft! And Question :D Olgualion 2,160 8 06/25/04 09:10 PM
by felixhigh
* emergency graft successful rockstafarian 1,377 4 12/20/04 03:12 PM
by faslimy
* Lophophora Growers Unite!
( 1 2 3 4 ... 888 889 )
ferrel_human 919,838 17,769 01/28/24 06:47 PM
by Griye
* Amazing growth of Tr. pachanoi grafted on Pereskiopsis
( 1 2 3 all )
Una 15,458 41 03/26/08 12:55 PM
by Zinglons Acolyte
* (02-17: UPDATED) Solanaceous series: a multipost dhutra primer: Part one and two
( 1 2 all )
Aneglakya 5,667 20 02/19/05 01:11 AM
by BorgFace
* peyote plants/grafts Blu Spore 5,832 6 03/04/05 09:08 PM
by Blu Spore
* Shoot development in Tr peruvianus variegata (daily updates)
( 1 2 all )
Una 4,783 37 10/20/04 04:55 AM
by zee_werp
* lophophora growth felixhigh 971 9 09/30/04 04:05 PM
by felixhigh

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: Mostly_Harmless, A.k.a
2,053 topic views. 0 members, 8 guests and 5 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2024 Mind Media. Some rights reserved.

Generated in 0.022 seconds spending 0.006 seconds on 14 queries.