Home | Community | Message Board

Cannabis Seeds - Original Sensible Seeds
This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

PhytoExtractum Shop: Maeng Da Thai Kratom Leaf Powder

Jump to first unread post Pages: 1
Offlinepshawny
Mycobian
Male

Folding@home Statistics
Registered: 09/11/04
Posts: 1,332
Loc: Shroomery
Last seen: 14 years, 11 months
To "www." or not
    #5399029 - 03/14/06 12:35 PM (17 years, 10 months ago)

Do you type www. before web addresses? I find myself doing it sometimes and not othertimes.
What do you type the most?
You may choose only one


Votes accepted from (03/14/06 12:30 PM) to (No end specified)
View the results of this poll



--------------------


Extras: Filter Print Post Top
Offlinerawtoxic
Stranger
Registered: 10/06/02
Posts: 2,097
Loc: smokey mountains
Last seen: 13 years, 5 months
Re: To "www." or not [Re: pshawny]
    #5400318 - 03/14/06 06:11 PM (17 years, 10 months ago)

.com


Extras: Filter Print Post Top
OfflineSprings
Mine(d)
Male User Gallery

Registered: 05/08/04
Posts: 330
Loc: sky hi
Last seen: 11 years, 5 months
Re: To "www." or not [Re: rawtoxic]
    #5400332 - 03/14/06 06:16 PM (17 years, 10 months ago)

My quicklink and bookmark are http


Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: To "www." or not [Re: Springs]
    #5400443 - 03/14/06 06:39 PM (17 years, 10 months ago)

I press "shr", then I press down once, which selects "http://www.shroomery.org/forums". Then, I press enter.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Extras: Filter Print Post Top
Invisiblemoog
Stranger

Registered: 02/15/05
Posts: 1,296
Re: To "www." or not [Re: pshawny]
    #5400903 - 03/14/06 08:20 PM (17 years, 10 months ago)

Bookmarked.

But for every other web site that i have to type in, no http://www. It's usually not needed so why bother?


Extras: Filter Print Post Top
Offlinepshawny
Mycobian
Male

Folding@home Statistics
Registered: 09/11/04
Posts: 1,332
Loc: Shroomery
Last seen: 14 years, 11 months
Re: To "www." or not [Re: moog]
    #5401595 - 03/14/06 11:25 PM (17 years, 10 months ago)

I use IE's pulldown menu to select this site and a few others that I frequent. Yeah, I'm still stuck on IE.


--------------------


Extras: Filter Print Post Top
OfflineMetaShroom
菌类
 User Gallery

Registered: 06/02/02
Posts: 1,462
Loc: East Anglia UK
Last seen: 16 years, 7 months
Re: To "www." or not [Re: pshawny]
    #5402912 - 03/15/06 11:05 AM (17 years, 10 months ago)



--------------------
:sleepingcow:  :penguinmonkey: :blah:

JOIN MAPS -> www.MAPS.ORG


Extras: Filter Print Post Top
OfflineInfrared
sleeping
Male User Gallery

Registered: 07/15/02
Posts: 12,988
Loc: Chicago, USA Flag
Last seen: 2 years, 4 days
Re: To "www." or not [Re: pshawny]
    #5403224 - 03/15/06 12:28 PM (17 years, 10 months ago)



--------------------
When chemistry is outlawed.. Only outlaws have chemistry:rainbowdrink:


Extras: Filter Print Post Top
Offlineduduklu_tencere
starnger
Male

Registered: 12/16/05
Posts: 18
Loc: istanbul
Last seen: 16 years, 5 months
Re: To "www." or not [Re: Infrared]
    #5403328 - 03/15/06 12:55 PM (17 years, 10 months ago)

homepage :smile:


Extras: Filter Print Post Top
Offlinezappa
please excusethe filth, yourmom was justhere
Female User Gallery

Registered: 02/23/06
Posts: 256
Loc: motor city madness
Last seen: 16 years, 1 month
Re: To "www." or not [Re: duduklu_tencere]
    #5425183 - 03/21/06 12:55 PM (17 years, 10 months ago)

yeah, i just type "shroomery.com"
i have this in my favorites too. i can just scroll down and click the link. either way


--------------------
:blackspy: :whitespy: :snowman: :farmerdance: :scaryshroom: :bananahorsey: :bananabang:

I :heart: GARY SINISE!!!!


Extras: Filter Print Post Top
InvisibleOJK
Stranger
 User Gallery
Registered: 06/08/03
Posts: 10,629
Re: To "www." or not [Re: pshawny]
    #5440406 - 03/25/06 07:33 AM (17 years, 10 months ago)

I type 69.28.174.162

domain names are for pussies :laugh:


Extras: Filter Print Post Top
InvisibleSilversoul
Rhizome
Male User Gallery

Registered: 01/01/05
Posts: 23,576
Loc: The Barricades
Re: To "www." or not [Re: pshawny]
    #5440945 - 03/25/06 12:48 PM (17 years, 10 months ago)

Bookmarked


--------------------


Extras: Filter Print Post Top
InvisibleEasy_Cheese
Cheese in a can

Registered: 05/12/06
Posts: 62
Re: To "www." or not [Re: Silversoul]
    #5625549 - 05/13/06 06:34 PM (17 years, 8 months ago)

Bookmarked now as "Roomery" but if i was typing it i just type shroomery.org.Actually all i have to do is type "Shr" and autocomplete finishes it.


--------------------
....Said the can of Cheese!


Extras: Filter Print Post Top
Offlinetriple_
Mushroom!Mushroom!
Male
Registered: 02/08/06
Posts: 102
Loc: Melbourne, Australia
Last seen: 13 years, 9 months
Re: To "www." or not [Re: Easy_Cheese]
    #5625791 - 05/13/06 07:25 PM (17 years, 8 months ago)

I use Opera, and have it bookmarked, so I just have to type 'shroomery' in the address bar and away I go. But, if I didn't have the bookmark, I'd type without the 'www.'


Extras: Filter Print Post Top
InvisibleGumby
Fishnologist
 User Gallery

Registered: 06/13/01
Posts: 26,656
Re: To "www." or not [Re: pshawny]
    #5626340 - 05/13/06 09:16 PM (17 years, 8 months ago)

I never type the address. I always just follow my bookmark.


Extras: Filter Print Post Top
Offlinewhatever123
Whatever I did, I'm sorry
Male User Gallery

Registered: 04/07/05
Posts: 2,613
Loc: San Diego, CA
Last seen: 5 years, 6 months
Re: To "www." or not [Re: Koala Koolio]
    #5626836 - 05/13/06 11:08 PM (17 years, 8 months ago)

Quote:

Koala Koolio said:
I press "shr", then I press down once, which selects "http://www.shroomery.org/forums". Then, I press enter.




Same here.
Only I press down twice, whenever shroomery.org is above shroomery.org/forums


--------------------
Koala Koolio said:
there should be a 3 month waiting period between registration and posting. :wink:


Extras: Filter Print Post Top
Jump to top Pages: 1

PhytoExtractum Shop: Maeng Da Thai Kratom Leaf Powder


Similar ThreadsPosterViewsRepliesLast post
* How old are you, the 1st Shroomery census
( 1 2 3 4 ... 43 44 )
Ripple 141,517 860 01/07/24 05:50 PM
by 2C-Beatz
* How Did You Find The Shroomery?
( 1 2 all )
Jackal 8,897 38 04/08/04 07:58 PM
by tom234my
* Should the Shroomery add a Chemistry forum? ZippoZM 5,792 18 03/04/04 01:59 AM
by Anonymous
* What does the Shroomery mean to you?
( 1 2 3 all )
ThorA 12,830 43 11/13/03 06:40 PM
by shroomophile
* Is gay homosex a sin?
( 1 2 all )
MyInsanityTrip 37,111 28 11/22/05 07:13 PM
by Locus
* Should Saddam face the death penalty?
( 1 2 all )
Annom 9,405 37 01/26/04 01:40 AM
by YesItsMe
* gender distribution maggot 2,571 15 03/08/04 02:24 PM
by Yarry
* The Great Penis Size Poll
( 1 2 3 4 5 6 7 8 all )
Gumby 66,024 142 01/26/24 08:48 PM
by Beepboop134

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: Ythan, Anno, Thor, Link, Seuss, geokills
1,207 topic views. 0 members, 0 guests and 0 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2024 Mind Media. Some rights reserved.

Generated in 0.055 seconds spending 0.036 seconds on 18 queries.